Incidental Mutation 'R4780:Sdk1'
ID366408
Institutional Source Beutler Lab
Gene Symbol Sdk1
Ensembl Gene ENSMUSG00000039683
Gene Namesidekick cell adhesion molecule 1
Synonyms6720466O15Rik
MMRRC Submission 041993-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.101) question?
Stock #R4780 (G1)
Quality Score225
Status Validated
Chromosome5
Chromosomal Location141241490-142215586 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 141959238 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 304 (D304G)
Ref Sequence ENSEMBL: ENSMUSP00000074133 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000074546] [ENSMUST00000085774]
Predicted Effect probably damaging
Transcript: ENSMUST00000074546
AA Change: D304G

PolyPhen 2 Score 0.970 (Sensitivity: 0.77; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000074133
Gene: ENSMUSG00000039683
AA Change: D304G

DomainStartEndE-ValueType
IGc2 28 91 4.67e-4 SMART
IGc2 121 187 1.45e-9 SMART
IGc2 214 282 1.58e-10 SMART
IG 302 387 1.8e-5 SMART
FN3 390 474 7.39e-14 SMART
FN3 490 576 8.96e-13 SMART
FN3 591 679 1.95e-4 SMART
FN3 694 776 2e-10 SMART
FN3 792 879 4.22e-9 SMART
FN3 896 983 1.41e-10 SMART
FN3 999 1084 2.7e-7 SMART
FN3 1100 1183 1.3e-9 SMART
FN3 1199 1284 2.19e-7 SMART
FN3 1300 1408 5.73e-11 SMART
FN3 1424 1509 1.79e-12 SMART
FN3 1524 1611 1.16e-11 SMART
FN3 1625 1709 1.32e-10 SMART
transmembrane domain 1730 1752 N/A INTRINSIC
low complexity region 1806 1815 N/A INTRINSIC
low complexity region 1846 1858 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000085774
AA Change: D564G

PolyPhen 2 Score 0.960 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000082928
Gene: ENSMUSG00000039683
AA Change: D564G

DomainStartEndE-ValueType
low complexity region 2 29 N/A INTRINSIC
low complexity region 67 80 N/A INTRINSIC
IGc2 99 158 2.77e-6 SMART
IG 179 264 3.74e-3 SMART
IGc2 288 351 4.67e-4 SMART
IGc2 381 447 1.45e-9 SMART
IGc2 474 542 1.58e-10 SMART
IG 562 647 1.8e-5 SMART
FN3 650 734 7.39e-14 SMART
FN3 750 836 8.96e-13 SMART
FN3 851 939 1.95e-4 SMART
FN3 954 1036 2e-10 SMART
FN3 1052 1139 4.22e-9 SMART
FN3 1156 1243 1.41e-10 SMART
FN3 1259 1344 2.7e-7 SMART
FN3 1360 1443 1.3e-9 SMART
FN3 1459 1544 2.19e-7 SMART
FN3 1560 1668 5.73e-11 SMART
FN3 1684 1769 1.79e-12 SMART
FN3 1784 1871 1.16e-11 SMART
FN3 1885 1969 1.32e-10 SMART
transmembrane domain 1990 2012 N/A INTRINSIC
low complexity region 2066 2075 N/A INTRINSIC
low complexity region 2106 2118 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000145908
Meta Mutation Damage Score 0.5129 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 94.6%
Validation Efficiency 98% (107/109)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the immunoglobulin superfamily. The protein contains six immunoglobulin-like domains and thirteen fibronectin type III domains. Fibronectin type III domains are present in both extracellular and intracellular proteins and tandem repeats are known to contain binding sites for DNA, heparin and the cell surface. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jul 2016]
Allele List at MGI
Other mutations in this stock
Total: 105 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110002E22Rik A G 3: 138,065,370 N107D probably benign Het
4833413E03Rik A C 17: 31,558,764 noncoding transcript Het
4931429L15Rik G T 9: 46,308,846 H129Q possibly damaging Het
A730018C14Rik A G 12: 112,415,635 noncoding transcript Het
Abcc6 T A 7: 45,996,691 K791N probably benign Het
Adcy4 T G 14: 55,775,036 Q550P probably benign Het
Add3 C A 19: 53,234,792 A325E possibly damaging Het
Agbl4 T A 4: 111,657,331 I513N possibly damaging Het
Agfg1 C A 1: 82,886,387 T392K probably damaging Het
Akna C A 4: 63,379,254 M854I probably benign Het
Ankrd44 T C 1: 54,763,757 N194S probably benign Het
Anks1b A G 10: 89,873,732 K21E probably damaging Het
Ap1s3 A G 1: 79,609,172 F154L probably benign Het
Apbb2 T A 5: 66,362,817 N477I probably damaging Het
Apobec3 T C 15: 79,899,024 C101R possibly damaging Het
Arnt G T 3: 95,488,385 V410F probably damaging Het
Arsg G A 11: 109,534,013 R270H possibly damaging Het
B3gnt7 T A 1: 86,305,270 D79E probably damaging Het
BC067074 A G 13: 113,317,858 Y146C probably damaging Het
Cd44 G T 2: 102,861,565 A126D probably damaging Het
Cd69 A G 6: 129,271,355 I56T probably damaging Het
Cep120 G A 18: 53,724,536 P286S probably benign Het
Ces2a T C 8: 104,737,208 F184S probably damaging Het
Chrng A G 1: 87,207,524 N185S probably damaging Het
Cldn6 A T 17: 23,681,247 M62L probably benign Het
Cntn6 T A 6: 104,845,784 N765K probably damaging Het
Ctnnal1 T C 4: 56,847,857 D94G probably damaging Het
Cyp2c69 T C 19: 39,877,594 N185S probably benign Het
Depdc1a A G 3: 159,526,706 N698S probably benign Het
Dnah2 A T 11: 69,473,871 I1986N probably damaging Het
Dnah7b A G 1: 46,353,014 E3845G probably benign Het
Dpysl3 C T 18: 43,354,802 V159I probably benign Het
Dync1h1 T C 12: 110,661,196 Y4047H probably damaging Het
E130308A19Rik C T 4: 59,691,057 P297L probably benign Het
E2f5 A G 3: 14,587,319 T72A probably benign Het
Ephb6 G T 6: 41,616,139 R437L probably damaging Het
Erbb4 T C 1: 68,298,314 H615R probably damaging Het
Erbin T C 13: 103,884,206 T82A probably damaging Het
Eri2 T C 7: 119,785,680 N533D probably benign Het
Fkbp9 A G 6: 56,850,716 N174S probably damaging Het
Fsbp C T 4: 11,583,709 T136I possibly damaging Het
Fubp3 C A 2: 31,583,211 D47E probably damaging Het
Gm21850 G A 2: 154,056,499 noncoding transcript Het
Gm5141 T A 13: 62,774,950 Y135F unknown Het
Gm7353 T A 7: 3,110,725 noncoding transcript Het
Gm8765 C A 13: 50,701,080 S251R probably damaging Het
Gm9925 T C 18: 74,065,273 probably benign Het
Greb1l T C 18: 10,541,792 S1180P probably benign Het
Hist1h2ag G A 13: 22,042,909 Q7* probably null Het
Kiz A G 2: 146,889,246 T192A possibly damaging Het
Klhl24 T A 16: 20,106,958 C79S probably damaging Het
Map3k11 A G 19: 5,690,938 H231R probably damaging Het
Mbd4 C A 6: 115,849,384 R194S probably benign Het
Mettl21e A C 1: 44,211,143 S34R probably benign Het
Mrps5 T C 2: 127,598,241 V245A probably benign Het
Mtrf1 T C 14: 79,401,688 Y87H probably benign Het
Myh15 T C 16: 49,120,057 I790T probably benign Het
Necab1 T G 4: 14,989,248 I176L probably benign Het
Nfkb2 T A 19: 46,309,922 L555Q probably damaging Het
Nhlrc3 T A 3: 53,458,567 E168D probably benign Het
Nlrp5 T A 7: 23,435,778 C949S probably damaging Het
Nup155 C A 15: 8,157,703 A1372E probably benign Het
Nynrin G T 14: 55,863,263 R170L probably damaging Het
Ogfrl1 T A 1: 23,370,321 N275Y probably damaging Het
Olfr1110 C T 2: 87,135,877 S148N probably damaging Het
Olfr1302 A G 2: 111,780,845 D175G probably damaging Het
Olfr1480 A G 19: 13,529,955 N138S probably benign Het
Olfr912 A G 9: 38,581,969 T231A possibly damaging Het
Olr1 A T 6: 129,488,876 S56T probably damaging Het
Ovol2 A T 2: 144,331,283 probably benign Het
Pcdha6 A T 18: 36,969,853 I700F probably damaging Het
Prkcz C T 4: 155,289,702 V86M probably damaging Het
Ptpn13 A G 5: 103,586,773 T2124A probably benign Het
Ranbp3 G T 17: 56,673,346 probably benign Het
Rapgef2 A G 3: 79,169,769 probably benign Het
Rbl1 A G 2: 157,174,804 V625A probably benign Het
Rbm38 G T 2: 173,022,151 G38C probably damaging Het
Reg1 T G 6: 78,426,350 F7C possibly damaging Het
Retnlg A T 16: 48,874,334 Q115L possibly damaging Het
Rhobtb1 G A 10: 69,270,153 V183I probably benign Het
Rims1 T C 1: 22,291,105 Q1186R probably damaging Het
Ryr1 A G 7: 29,095,097 F1246L possibly damaging Het
Samm50 A G 15: 84,210,610 N401S possibly damaging Het
Scn3a T A 2: 65,506,193 I690F probably damaging Het
Skint6 T C 4: 113,236,397 Y183C probably damaging Het
Slamf1 A T 1: 171,777,261 T200S probably benign Het
Slc34a2 C T 5: 53,069,451 R639C probably damaging Het
Smap1 A T 1: 23,853,436 M149K probably benign Het
Sorcs1 T C 19: 50,143,981 probably benign Het
Sp140 T A 1: 85,610,828 D95E possibly damaging Het
Spata13 G A 14: 60,753,907 W366* probably null Het
Strip1 G A 3: 107,626,998 T136I probably benign Het
Tacr1 A T 6: 82,557,072 T360S probably benign Het
Tbc1d14 T A 5: 36,571,256 probably benign Het
Tcaf2 T C 6: 42,628,062 Y596C probably damaging Het
Tspoap1 C T 11: 87,778,443 T1454I possibly damaging Het
Ttc30a2 A C 2: 75,977,576 C197W probably benign Het
Ttn A T 2: 76,914,583 M5374K probably benign Het
Uts2r G A 11: 121,160,879 V190I possibly damaging Het
Vmn1r181 A G 7: 23,984,583 T158A possibly damaging Het
Wdr35 A T 12: 9,018,150 T778S probably benign Het
Xrn1 A T 9: 95,974,744 probably benign Het
Zfp35 A T 18: 24,003,269 K223N probably damaging Het
Zfp764 T C 7: 127,404,771 Q396R probably benign Het
Zfyve1 T C 12: 83,558,647 Y11C probably damaging Het
Other mutations in Sdk1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00498:Sdk1 APN 5 142085606 missense probably damaging 1.00
IGL00945:Sdk1 APN 5 142084613 critical splice donor site probably null
IGL00946:Sdk1 APN 5 142084613 critical splice donor site probably null
IGL01394:Sdk1 APN 5 141613215 missense probably benign 0.03
IGL01398:Sdk1 APN 5 141937577 missense probably benign 0.00
IGL01410:Sdk1 APN 5 142212120 missense probably benign 0.30
IGL01525:Sdk1 APN 5 141999920 missense probably damaging 1.00
IGL01548:Sdk1 APN 5 142085765 missense possibly damaging 0.95
IGL01672:Sdk1 APN 5 142185175 missense probably benign 0.33
IGL01676:Sdk1 APN 5 142127836 missense probably damaging 0.99
IGL01679:Sdk1 APN 5 142046164 missense probably benign
IGL01929:Sdk1 APN 5 141953030 missense probably damaging 0.99
IGL01970:Sdk1 APN 5 142085682 missense possibly damaging 0.67
IGL02016:Sdk1 APN 5 142034429 missense possibly damaging 0.85
IGL02060:Sdk1 APN 5 141953012 missense possibly damaging 0.79
IGL02457:Sdk1 APN 5 141953016 missense probably damaging 1.00
IGL02634:Sdk1 APN 5 141610032 missense probably benign 0.01
IGL02637:Sdk1 APN 5 142094572 missense probably damaging 1.00
IGL02731:Sdk1 APN 5 142172544 missense probably damaging 1.00
IGL03180:Sdk1 APN 5 142085742 missense probably damaging 0.96
IGL03259:Sdk1 APN 5 141953033 nonsense probably null
PIT4453001:Sdk1 UTSW 5 142212038 missense probably benign 0.00
PIT4544001:Sdk1 UTSW 5 141956232 missense probably benign 0.08
R0149:Sdk1 UTSW 5 141857054 intron probably benign
R0173:Sdk1 UTSW 5 142173809 splice site probably benign
R0240:Sdk1 UTSW 5 141998747 missense probably damaging 1.00
R0240:Sdk1 UTSW 5 141998747 missense probably damaging 1.00
R0242:Sdk1 UTSW 5 142143922 splice site probably benign
R0245:Sdk1 UTSW 5 141954958 missense probably benign 0.02
R0270:Sdk1 UTSW 5 142084566 missense possibly damaging 0.79
R0398:Sdk1 UTSW 5 141962721 missense probably benign 0.05
R0401:Sdk1 UTSW 5 142046161 missense possibly damaging 0.55
R0501:Sdk1 UTSW 5 141937718 missense probably benign
R0558:Sdk1 UTSW 5 142132065 missense probably damaging 1.00
R0652:Sdk1 UTSW 5 141954958 missense probably benign 0.02
R0834:Sdk1 UTSW 5 141242024 missense probably benign
R0962:Sdk1 UTSW 5 142161875 missense probably damaging 1.00
R1424:Sdk1 UTSW 5 142161866 missense probably damaging 1.00
R1438:Sdk1 UTSW 5 142038323 missense probably damaging 0.96
R1517:Sdk1 UTSW 5 142127836 missense probably damaging 0.99
R1519:Sdk1 UTSW 5 141999950 missense probably benign 0.00
R1539:Sdk1 UTSW 5 142094599 missense probably damaging 1.00
R1574:Sdk1 UTSW 5 141998879 missense probably benign 0.03
R1574:Sdk1 UTSW 5 141998879 missense probably benign 0.03
R1673:Sdk1 UTSW 5 141948506 missense possibly damaging 0.90
R1686:Sdk1 UTSW 5 142034537 missense probably benign 0.00
R1806:Sdk1 UTSW 5 141613195 missense probably damaging 1.00
R1806:Sdk1 UTSW 5 142161926 missense probably benign
R1925:Sdk1 UTSW 5 142185285 missense probably benign 0.09
R1956:Sdk1 UTSW 5 142094581 missense probably damaging 1.00
R1976:Sdk1 UTSW 5 142143818 missense probably damaging 1.00
R2124:Sdk1 UTSW 5 142185188 missense possibly damaging 0.70
R2152:Sdk1 UTSW 5 141792944 missense probably damaging 1.00
R2186:Sdk1 UTSW 5 142046292 missense probably benign 0.00
R2187:Sdk1 UTSW 5 142114574 missense probably damaging 1.00
R2306:Sdk1 UTSW 5 141962700 missense probably benign 0.00
R2520:Sdk1 UTSW 5 142085771 missense probably benign 0.19
R2698:Sdk1 UTSW 5 142212050 missense possibly damaging 0.95
R2763:Sdk1 UTSW 5 142084551 missense possibly damaging 0.90
R3023:Sdk1 UTSW 5 142046236 missense probably benign
R3500:Sdk1 UTSW 5 142006616 splice site probably benign
R3613:Sdk1 UTSW 5 142119686 missense probably damaging 1.00
R3824:Sdk1 UTSW 5 141936049 missense probably benign
R3916:Sdk1 UTSW 5 142051244 missense probably damaging 0.98
R3917:Sdk1 UTSW 5 142051244 missense probably damaging 0.98
R4158:Sdk1 UTSW 5 142114399 missense probably benign 0.00
R4160:Sdk1 UTSW 5 142114399 missense probably benign 0.00
R4161:Sdk1 UTSW 5 142114399 missense probably benign 0.00
R4386:Sdk1 UTSW 5 142094626 missense probably damaging 0.99
R4649:Sdk1 UTSW 5 142006625 missense probably damaging 1.00
R4701:Sdk1 UTSW 5 142185231 missense probably damaging 1.00
R4787:Sdk1 UTSW 5 141582413 missense probably benign
R4825:Sdk1 UTSW 5 141582294 missense probably benign 0.11
R4853:Sdk1 UTSW 5 142146263 missense probably damaging 1.00
R4857:Sdk1 UTSW 5 142161776 missense probably benign 0.01
R4928:Sdk1 UTSW 5 141857003 intron probably benign
R5111:Sdk1 UTSW 5 142127845 missense probably damaging 1.00
R5188:Sdk1 UTSW 5 141956260 critical splice donor site probably null
R5246:Sdk1 UTSW 5 142114562 missense possibly damaging 0.72
R5273:Sdk1 UTSW 5 141998828 missense probably damaging 0.99
R5484:Sdk1 UTSW 5 142100186 missense probably damaging 1.00
R5525:Sdk1 UTSW 5 142185265 missense possibly damaging 0.84
R5578:Sdk1 UTSW 5 141613125 nonsense probably null
R5593:Sdk1 UTSW 5 141956124 missense probably damaging 0.98
R5654:Sdk1 UTSW 5 141936098 missense probably damaging 0.96
R5672:Sdk1 UTSW 5 142188145 missense possibly damaging 0.94
R5768:Sdk1 UTSW 5 142143871 missense probably benign 0.00
R5781:Sdk1 UTSW 5 141936048 missense probably benign 0.00
R5846:Sdk1 UTSW 5 142114393 missense probably damaging 1.00
R5851:Sdk1 UTSW 5 141962669 missense probably benign 0.00
R6164:Sdk1 UTSW 5 142132069 missense probably damaging 1.00
R6235:Sdk1 UTSW 5 142034426 missense possibly damaging 0.85
R6364:Sdk1 UTSW 5 141962709 missense probably benign 0.00
R6453:Sdk1 UTSW 5 142096921 missense probably damaging 1.00
R6892:Sdk1 UTSW 5 142046298 missense probably benign 0.00
R6996:Sdk1 UTSW 5 142212014 missense probably benign 0.16
R7003:Sdk1 UTSW 5 142096734 missense probably benign 0.01
R7022:Sdk1 UTSW 5 142094657 intron probably null
R7027:Sdk1 UTSW 5 142096726 splice site probably null
R7098:Sdk1 UTSW 5 142096870 missense probably damaging 0.96
R7107:Sdk1 UTSW 5 142081716 missense probably damaging 0.99
R7203:Sdk1 UTSW 5 142046176 missense probably benign 0.08
R7313:Sdk1 UTSW 5 141937622 missense probably damaging 0.97
R7363:Sdk1 UTSW 5 142188142 missense probably benign 0.05
R7375:Sdk1 UTSW 5 141998843 missense probably benign 0.01
R7446:Sdk1 UTSW 5 142144976 missense probably damaging 1.00
R7527:Sdk1 UTSW 5 141792976 missense possibly damaging 0.61
R7598:Sdk1 UTSW 5 141609998 nonsense probably null
R7747:Sdk1 UTSW 5 142084491 missense probably damaging 1.00
R7810:Sdk1 UTSW 5 141937679 missense probably benign
X0017:Sdk1 UTSW 5 141998780 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- TCTCTGAACATCACTGAGCG -3'
(R):5'- CATCATCAGAGGTCTGCTGC -3'

Sequencing Primer
(F):5'- TGAACATCACTGAGCGCTTCC -3'
(R):5'- CCCAAGGAATCTTAACCAG -3'
Posted On2015-12-21