Incidental Mutation 'R0411:Naa15'
Institutional Source Beutler Lab
Gene Symbol Naa15
Ensembl Gene ENSMUSG00000063273
Gene NameN(alpha)-acetyltransferase 15, NatA auxiliary subunit
Synonymstubedown, ASTBDN, Tbdn-1, mNAT1, 5730450D16Rik, Narg1
MMRRC Submission 038613-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.962) question?
Stock #R0411 (G1)
Quality Score225
Status Not validated
Chromosomal Location51415148-51476507 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 51465639 bp
Amino Acid Change Isoleucine to Asparagine at position 701 (I701N)
Ref Sequence ENSEMBL: ENSMUSP00000029303 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000029303] [ENSMUST00000193266]
Predicted Effect possibly damaging
Transcript: ENSMUST00000029303
AA Change: I701N

PolyPhen 2 Score 0.807 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000029303
Gene: ENSMUSG00000063273
AA Change: I701N

TPR 46 79 6.24e1 SMART
TPR 80 113 1.01e0 SMART
Blast:TPR 224 257 3e-12 BLAST
TPR 374 407 1.87e1 SMART
TPR 408 441 5.06e1 SMART
low complexity region 603 641 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000192523
Predicted Effect possibly damaging
Transcript: ENSMUST00000193266
AA Change: I651N

PolyPhen 2 Score 0.691 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000141433
Gene: ENSMUSG00000063273
AA Change: I651N

Blast:TPR 1 29 3e-10 BLAST
TPR 30 63 4.9e-3 SMART
Blast:TPR 174 207 3e-12 BLAST
TPR 324 357 8.9e-2 SMART
TPR 358 391 2.4e-1 SMART
coiled coil region 533 585 N/A INTRINSIC
Blast:TPR 622 655 7e-10 BLAST
Predicted Effect noncoding transcript
Transcript: ENSMUST00000193267
Predicted Effect noncoding transcript
Transcript: ENSMUST00000193694
Predicted Effect noncoding transcript
Transcript: ENSMUST00000194685
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 95.0%
Validation Efficiency 97% (66/68)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] N-alpha-acetylation is among the most common post-translational protein modifications in eukaryotic cells. This process involves the transfer of an acetyl group from acetyl-coenzyme A to the alpha-amino group on a nascent polypeptide and is essential for normal cell function. This gene encodes the auxillary subunit of the N-terminal acetyltransferase A (NatA) complex. [provided by RefSeq, Jan 2017]
Allele List at MGI
Other mutations in this stock
Total: 66 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
0610040J01Rik A G 5: 63,896,491 probably benign Het
6030469F06Rik A T 12: 31,184,731 noncoding transcript Het
Acad11 T C 9: 104,116,296 F541L probably damaging Het
Acin1 G T 14: 54,646,774 R92S probably damaging Het
Appl1 A G 14: 26,940,256 S490P probably benign Het
Aqp9 C A 9: 71,130,444 V184L probably benign Het
Arih1 A T 9: 59,485,983 I122N possibly damaging Het
Bmi1 T C 2: 18,683,172 probably benign Het
Bmpr1a G A 14: 34,415,877 T391I possibly damaging Het
Cacna1s A G 1: 136,113,303 K1256E probably damaging Het
Cacng3 C T 7: 122,768,572 P225L probably damaging Het
Cd101 A T 3: 101,018,527 probably null Het
Cd55 A G 1: 130,462,557 probably benign Het
Cenpe T C 3: 135,222,255 I258T probably damaging Het
Cma2 A G 14: 55,973,678 probably benign Het
Ddost T A 4: 138,309,653 S176T probably benign Het
Ddx19b A T 8: 111,023,964 probably null Het
Dmxl2 A G 9: 54,378,939 I2681T probably damaging Het
Ern1 C T 11: 106,398,586 E964K probably benign Het
Galntl5 C T 5: 25,220,174 R430C probably benign Het
Gga3 A G 11: 115,587,433 L511P probably damaging Het
Gm7271 G T 5: 76,500,487 V47L possibly damaging Het
Gria2 C T 3: 80,710,858 probably benign Het
Hmbs A T 9: 44,341,652 L28* probably null Het
Iffo2 A G 4: 139,603,221 E220G probably damaging Het
Ifi30 A G 8: 70,764,918 probably benign Het
Irf2 T A 8: 46,846,061 C297S probably benign Het
Izumo4 T C 10: 80,703,084 Y94H probably damaging Het
Klhdc9 A G 1: 171,359,785 V215A probably benign Het
Kmt2a T C 9: 44,819,964 probably benign Het
Kmt2c A T 5: 25,375,957 C513S probably damaging Het
Lyg1 A T 1: 37,949,896 M81K possibly damaging Het
Maip1 T G 1: 57,415,693 W279G probably damaging Het
Myo7a T C 7: 98,071,937 T1263A probably benign Het
Ncoa3 A G 2: 166,068,543 N1292S probably benign Het
Necab2 T A 8: 119,454,240 probably benign Het
Nfatc1 T A 18: 80,698,042 I234F possibly damaging Het
Olfm1 G A 2: 28,208,211 R95K possibly damaging Het
Olfr1118 A G 2: 87,309,058 T90A probably benign Het
Olfr1329 A T 4: 118,916,626 N280K possibly damaging Het
Otoa T C 7: 121,156,527 probably null Het
Padi4 GCTGCGTACCTCCAC GC 4: 140,748,449 probably benign Het
Pard6g A G 18: 80,117,122 D150G probably damaging Het
Pax5 A G 4: 44,609,783 L215S probably damaging Het
Pja2 A T 17: 64,287,521 probably benign Het
Plk4 T A 3: 40,811,219 probably benign Het
Polr1a A T 6: 71,978,421 H1687L possibly damaging Het
Ptcd2 G A 13: 99,343,391 L41F probably damaging Het
Ropn1 T A 16: 34,669,964 S62T probably benign Het
Setd1a T C 7: 127,796,051 probably benign Het
Setdb1 T C 3: 95,327,686 D902G probably damaging Het
Sik3 T A 9: 46,208,770 L719Q probably damaging Het
Slc36a1 G T 11: 55,232,507 V433F probably benign Het
Slc6a3 T C 13: 73,557,050 V220A possibly damaging Het
Slc6a5 A T 7: 49,911,791 R24W probably damaging Het
Smox G T 2: 131,520,644 R281L probably benign Het
Sulf2 G T 2: 166,093,516 H226N probably damaging Het
Syne2 C T 12: 76,059,584 probably null Het
Tenm3 C T 8: 48,287,791 S1210N possibly damaging Het
Tns1 A T 1: 73,925,761 V1237E probably damaging Het
Trf C T 9: 103,217,501 V92M probably damaging Het
Ttn A G 2: 76,709,373 V34423A possibly damaging Het
Vmn2r118 A G 17: 55,611,021 probably benign Het
Vmn2r19 A G 6: 123,309,744 Y112C probably damaging Het
Wdr66 C T 5: 123,290,054 T538M probably damaging Het
Zfp326 G T 5: 105,878,775 A15S possibly damaging Het
Other mutations in Naa15
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00088:Naa15 APN 3 51438405 missense probably damaging 1.00
IGL01753:Naa15 APN 3 51442853 missense probably damaging 1.00
IGL01837:Naa15 APN 3 51443948 nonsense probably null
IGL02619:Naa15 APN 3 51460131 missense probably benign 0.03
IGL02691:Naa15 APN 3 51451326 missense probably damaging 0.97
IGL02974:Naa15 APN 3 51461207 missense possibly damaging 0.95
R0009:Naa15 UTSW 3 51470219 missense probably damaging 1.00
R0010:Naa15 UTSW 3 51436213 critical splice acceptor site probably null
R0114:Naa15 UTSW 3 51448438 critical splice donor site probably null
R1348:Naa15 UTSW 3 51465670 missense probably damaging 1.00
R1941:Naa15 UTSW 3 51455934 nonsense probably null
R3082:Naa15 UTSW 3 51460050 missense probably damaging 1.00
R4377:Naa15 UTSW 3 51448365 missense possibly damaging 0.91
R4591:Naa15 UTSW 3 51441924 missense probably damaging 1.00
R4980:Naa15 UTSW 3 51458752 critical splice donor site probably null
R5087:Naa15 UTSW 3 51457285 splice site probably null
R5139:Naa15 UTSW 3 51443840 missense probably damaging 1.00
R5289:Naa15 UTSW 3 51455894 missense probably damaging 1.00
R5527:Naa15 UTSW 3 51441947 missense probably damaging 1.00
R5776:Naa15 UTSW 3 51460026 missense probably damaging 0.96
R5909:Naa15 UTSW 3 51460064 missense probably damaging 1.00
R6034:Naa15 UTSW 3 51442821 missense probably damaging 0.98
R6034:Naa15 UTSW 3 51442821 missense probably damaging 0.98
R6194:Naa15 UTSW 3 51463300 missense probably benign 0.00
R6291:Naa15 UTSW 3 51442791 missense probably damaging 1.00
R6522:Naa15 UTSW 3 51471514 missense probably damaging 1.00
R6731:Naa15 UTSW 3 51455873 missense probably damaging 1.00
R6984:Naa15 UTSW 3 51472600 missense probably benign 0.10
R7040:Naa15 UTSW 3 51472784 missense possibly damaging 0.89
R7091:Naa15 UTSW 3 51458756 splice site probably null
X0020:Naa15 UTSW 3 51470132 missense probably benign 0.00
X0061:Naa15 UTSW 3 51448600 missense probably damaging 1.00
X0061:Naa15 UTSW 3 51448601 missense probably benign 0.11
Predicted Primers PCR Primer

Sequencing Primer
(R):5'- ccagggctacacagagaaac -3'
Posted On2013-05-09