Incidental Mutation 'R4780:Abcc6'
ID 366423
Institutional Source Beutler Lab
Gene Symbol Abcc6
Ensembl Gene ENSMUSG00000030834
Gene Name ATP-binding cassette, sub-family C member 6
Synonyms DCC, Mrp6, Dyscalc1
MMRRC Submission 041993-MU
Accession Numbers
Essential gene? Probably essential (E-score: 0.822) question?
Stock # R4780 (G1)
Quality Score 191
Status Validated
Chromosome 7
Chromosomal Location 45625804-45679915 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to A at 45646115 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Lysine to Asparagine at position 791 (K791N)
Ref Sequence ENSEMBL: ENSMUSP00000002850 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000002850]
AlphaFold Q9R1S7
Predicted Effect probably benign
Transcript: ENSMUST00000002850
AA Change: K791N

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000002850
Gene: ENSMUSG00000030834
AA Change: K791N

DomainStartEndE-ValueType
transmembrane domain 44 61 N/A INTRINSIC
transmembrane domain 81 100 N/A INTRINSIC
transmembrane domain 110 129 N/A INTRINSIC
transmembrane domain 142 161 N/A INTRINSIC
transmembrane domain 171 193 N/A INTRINSIC
Pfam:ABC_membrane 309 580 3.5e-29 PFAM
AAA 653 828 1.19e-9 SMART
low complexity region 871 885 N/A INTRINSIC
Pfam:ABC_membrane 942 1211 2.5e-32 PFAM
AAA 1286 1473 1.71e-10 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000134200
AA Change: N249I
Predicted Effect noncoding transcript
Transcript: ENSMUST00000211780
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 94.6%
Validation Efficiency 98% (107/109)
MGI Phenotype FUNCTION: The protein encoded by this gene is a member of the superfamily of ATP-binding cassette (ABC) transporters. ABC proteins transport various molecules across extra- and intra-cellular membranes. ABC genes are divided into seven distinct subfamilies (ABC1, MDR/TAP, MRP, ALD, OABP, GCN20, White). This protein is a member of the MRP subfamily which is involved in multi-drug resistance. The specific function of this protein is unknown; however, a similar rat protein has been identified as the major canalicular bile salt export pump of liver. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous null mice display patchy mineralization which may include the capsule surrounding the sinuses of vibrissae, medium sized arteries, skin, retina, kidney, and interscapular brown fat. Strain differences at this locus may lead to altered susceptibility to cardiac calcinosis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 105 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110002E22Rik A G 3: 137,771,131 (GRCm39) N107D probably benign Het
4833413E03Rik A C 17: 31,777,738 (GRCm39) noncoding transcript Het
4931429L15Rik G T 9: 46,220,144 (GRCm39) H129Q possibly damaging Het
A730018C14Rik A G 12: 112,382,069 (GRCm39) noncoding transcript Het
Adcy4 T G 14: 56,012,493 (GRCm39) Q550P probably benign Het
Add3 C A 19: 53,223,223 (GRCm39) A325E possibly damaging Het
Agbl4 T A 4: 111,514,528 (GRCm39) I513N possibly damaging Het
Agfg1 C A 1: 82,864,108 (GRCm39) T392K probably damaging Het
Akna C A 4: 63,297,491 (GRCm39) M854I probably benign Het
Ankrd44 T C 1: 54,802,916 (GRCm39) N194S probably benign Het
Anks1b A G 10: 89,709,594 (GRCm39) K21E probably damaging Het
Ap1s3 A G 1: 79,586,889 (GRCm39) F154L probably benign Het
Apbb2 T A 5: 66,520,160 (GRCm39) N477I probably damaging Het
Apobec3 T C 15: 79,783,225 (GRCm39) C101R possibly damaging Het
Arnt G T 3: 95,395,696 (GRCm39) V410F probably damaging Het
Arsg G A 11: 109,424,839 (GRCm39) R270H possibly damaging Het
B3gnt7 T A 1: 86,232,992 (GRCm39) D79E probably damaging Het
Cd44 G T 2: 102,691,910 (GRCm39) A126D probably damaging Het
Cd69 A G 6: 129,248,318 (GRCm39) I56T probably damaging Het
Cep120 G A 18: 53,857,608 (GRCm39) P286S probably benign Het
Ces2a T C 8: 105,463,840 (GRCm39) F184S probably damaging Het
Chrng A G 1: 87,135,246 (GRCm39) N185S probably damaging Het
Cldn6 A T 17: 23,900,221 (GRCm39) M62L probably benign Het
Cntn6 T A 6: 104,822,745 (GRCm39) N765K probably damaging Het
Cspg4b A G 13: 113,454,392 (GRCm39) Y146C probably damaging Het
Ctnnal1 T C 4: 56,847,857 (GRCm39) D94G probably damaging Het
Cyp2c69 T C 19: 39,866,038 (GRCm39) N185S probably benign Het
Depdc1a A G 3: 159,232,343 (GRCm39) N698S probably benign Het
Dnah2 A T 11: 69,364,697 (GRCm39) I1986N probably damaging Het
Dnah7b A G 1: 46,392,174 (GRCm39) E3845G probably benign Het
Dpysl3 C T 18: 43,487,867 (GRCm39) V159I probably benign Het
Dync1h1 T C 12: 110,627,630 (GRCm39) Y4047H probably damaging Het
E130308A19Rik C T 4: 59,691,057 (GRCm39) P297L probably benign Het
E2f5 A G 3: 14,652,379 (GRCm39) T72A probably benign Het
Ephb6 G T 6: 41,593,073 (GRCm39) R437L probably damaging Het
Erbb4 T C 1: 68,337,473 (GRCm39) H615R probably damaging Het
Erbin T C 13: 104,020,714 (GRCm39) T82A probably damaging Het
Eri2 T C 7: 119,384,903 (GRCm39) N533D probably benign Het
Fkbp9 A G 6: 56,827,701 (GRCm39) N174S probably damaging Het
Fsbp C T 4: 11,583,709 (GRCm39) T136I possibly damaging Het
Fubp3 C A 2: 31,473,223 (GRCm39) D47E probably damaging Het
Gm21850 G A 2: 153,898,419 (GRCm39) noncoding transcript Het
Gm5141 T A 13: 62,922,764 (GRCm39) Y135F unknown Het
Gm7353 T A 7: 3,160,725 (GRCm39) noncoding transcript Het
Gm9925 T C 18: 74,198,344 (GRCm39) probably benign Het
Greb1l T C 18: 10,541,792 (GRCm39) S1180P probably benign Het
H2ac11 G A 13: 22,227,079 (GRCm39) Q7* probably null Het
Ift70a2 A C 2: 75,807,920 (GRCm39) C197W probably benign Het
Kiz A G 2: 146,731,166 (GRCm39) T192A possibly damaging Het
Klhl24 T A 16: 19,925,708 (GRCm39) C79S probably damaging Het
Map3k11 A G 19: 5,740,966 (GRCm39) H231R probably damaging Het
Mbd4 C A 6: 115,826,345 (GRCm39) R194S probably benign Het
Mettl21e A C 1: 44,250,303 (GRCm39) S34R probably benign Het
Mrps5 T C 2: 127,440,161 (GRCm39) V245A probably benign Het
Mtrf1 T C 14: 79,639,128 (GRCm39) Y87H probably benign Het
Myh15 T C 16: 48,940,420 (GRCm39) I790T probably benign Het
Necab1 T G 4: 14,989,248 (GRCm39) I176L probably benign Het
Nfkb2 T A 19: 46,298,361 (GRCm39) L555Q probably damaging Het
Nhlrc3 T A 3: 53,365,988 (GRCm39) E168D probably benign Het
Nlrp5 T A 7: 23,135,203 (GRCm39) C949S probably damaging Het
Nup155 C A 15: 8,187,187 (GRCm39) A1372E probably benign Het
Nynrin G T 14: 56,100,720 (GRCm39) R170L probably damaging Het
Ogfrl1 T A 1: 23,409,402 (GRCm39) N275Y probably damaging Het
Olr1 A T 6: 129,465,839 (GRCm39) S56T probably damaging Het
Or4k52 A G 2: 111,611,190 (GRCm39) D175G probably damaging Het
Or5aq1 C T 2: 86,966,221 (GRCm39) S148N probably damaging Het
Or5b121 A G 19: 13,507,319 (GRCm39) N138S probably benign Het
Or8b48 A G 9: 38,493,265 (GRCm39) T231A possibly damaging Het
Ovol2 A T 2: 144,173,203 (GRCm39) probably benign Het
Pcdha6 A T 18: 37,102,906 (GRCm39) I700F probably damaging Het
Prkcz C T 4: 155,374,159 (GRCm39) V86M probably damaging Het
Ptpn13 A G 5: 103,734,639 (GRCm39) T2124A probably benign Het
Ranbp3 G T 17: 56,980,346 (GRCm39) probably benign Het
Rapgef2 A G 3: 79,077,076 (GRCm39) probably benign Het
Rbl1 A G 2: 157,016,724 (GRCm39) V625A probably benign Het
Rbm38 G T 2: 172,863,944 (GRCm39) G38C probably damaging Het
Reg1 T G 6: 78,403,333 (GRCm39) F7C possibly damaging Het
Retnlg A T 16: 48,694,697 (GRCm39) Q115L possibly damaging Het
Rhobtb1 G A 10: 69,105,983 (GRCm39) V183I probably benign Het
Rims1 T C 1: 22,361,329 (GRCm39) Q1186R probably damaging Het
Ryr1 A G 7: 28,794,522 (GRCm39) F1246L possibly damaging Het
Samm50 A G 15: 84,094,811 (GRCm39) N401S possibly damaging Het
Scn3a T A 2: 65,336,537 (GRCm39) I690F probably damaging Het
Sdk1 A G 5: 141,944,993 (GRCm39) D304G probably damaging Het
Skint6 T C 4: 113,093,594 (GRCm39) Y183C probably damaging Het
Slamf1 A T 1: 171,604,829 (GRCm39) T200S probably benign Het
Slc34a2 C T 5: 53,226,793 (GRCm39) R639C probably damaging Het
Smap1 A T 1: 23,892,517 (GRCm39) M149K probably benign Het
Sorcs1 T C 19: 50,132,419 (GRCm39) probably benign Het
Sp140 T A 1: 85,538,549 (GRCm39) D95E possibly damaging Het
Spata13 G A 14: 60,991,356 (GRCm39) W366* probably null Het
Spata31e4 C A 13: 50,855,116 (GRCm39) S251R probably damaging Het
Strip1 G A 3: 107,534,314 (GRCm39) T136I probably benign Het
Tacr1 A T 6: 82,534,053 (GRCm39) T360S probably benign Het
Tbc1d14 T A 5: 36,728,600 (GRCm39) probably benign Het
Tcaf2 T C 6: 42,604,996 (GRCm39) Y596C probably damaging Het
Tspoap1 C T 11: 87,669,269 (GRCm39) T1454I possibly damaging Het
Ttn A T 2: 76,744,927 (GRCm39) M5374K probably benign Het
Uts2r G A 11: 121,051,705 (GRCm39) V190I possibly damaging Het
Vmn1r181 A G 7: 23,684,008 (GRCm39) T158A possibly damaging Het
Wdr35 A T 12: 9,068,150 (GRCm39) T778S probably benign Het
Xrn1 A T 9: 95,856,797 (GRCm39) probably benign Het
Zfp35 A T 18: 24,136,326 (GRCm39) K223N probably damaging Het
Zfp764 T C 7: 127,003,943 (GRCm39) Q396R probably benign Het
Zfyve1 T C 12: 83,605,421 (GRCm39) Y11C probably damaging Het
Other mutations in Abcc6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01589:Abcc6 APN 7 45,652,096 (GRCm39) splice site probably benign
IGL01731:Abcc6 APN 7 45,652,034 (GRCm39) missense possibly damaging 0.71
IGL01743:Abcc6 APN 7 45,646,238 (GRCm39) missense probably benign 0.02
IGL01757:Abcc6 APN 7 45,639,705 (GRCm39) splice site probably benign
IGL01895:Abcc6 APN 7 45,678,482 (GRCm39) missense possibly damaging 0.88
IGL01942:Abcc6 APN 7 45,635,997 (GRCm39) missense possibly damaging 0.89
IGL02251:Abcc6 APN 7 45,626,840 (GRCm39) missense probably damaging 1.00
IGL02277:Abcc6 APN 7 45,650,485 (GRCm39) missense probably benign 0.00
IGL02548:Abcc6 APN 7 45,654,686 (GRCm39) missense probably damaging 0.98
IGL03063:Abcc6 APN 7 45,665,856 (GRCm39) missense probably benign
IGL03092:Abcc6 APN 7 45,635,894 (GRCm39) missense probably damaging 1.00
IGL03251:Abcc6 APN 7 45,631,661 (GRCm39) unclassified probably benign
R0057:Abcc6 UTSW 7 45,669,567 (GRCm39) missense probably benign 0.03
R0944:Abcc6 UTSW 7 45,664,929 (GRCm39) missense possibly damaging 0.81
R1019:Abcc6 UTSW 7 45,663,531 (GRCm39) missense possibly damaging 0.77
R1183:Abcc6 UTSW 7 45,634,677 (GRCm39) missense probably damaging 0.99
R1543:Abcc6 UTSW 7 45,665,928 (GRCm39) missense probably benign 0.01
R1550:Abcc6 UTSW 7 45,654,668 (GRCm39) missense probably benign 0.25
R1725:Abcc6 UTSW 7 45,641,781 (GRCm39) missense possibly damaging 0.76
R1907:Abcc6 UTSW 7 45,663,593 (GRCm39) missense probably benign 0.04
R1908:Abcc6 UTSW 7 45,669,558 (GRCm39) splice site probably null
R1909:Abcc6 UTSW 7 45,669,558 (GRCm39) splice site probably null
R2138:Abcc6 UTSW 7 45,630,475 (GRCm39) missense probably damaging 1.00
R2145:Abcc6 UTSW 7 45,648,165 (GRCm39) missense probably benign 0.01
R2402:Abcc6 UTSW 7 45,664,999 (GRCm39) missense probably benign 0.04
R3983:Abcc6 UTSW 7 45,644,713 (GRCm39) missense probably benign
R4013:Abcc6 UTSW 7 45,668,104 (GRCm39) missense probably benign 0.01
R4051:Abcc6 UTSW 7 45,635,987 (GRCm39) missense probably damaging 1.00
R4052:Abcc6 UTSW 7 45,635,987 (GRCm39) missense probably damaging 1.00
R4208:Abcc6 UTSW 7 45,635,987 (GRCm39) missense probably damaging 1.00
R4362:Abcc6 UTSW 7 45,648,256 (GRCm39) splice site probably benign
R4385:Abcc6 UTSW 7 45,644,752 (GRCm39) missense possibly damaging 0.93
R4399:Abcc6 UTSW 7 45,652,031 (GRCm39) missense probably benign
R4479:Abcc6 UTSW 7 45,654,663 (GRCm39) missense possibly damaging 0.60
R4480:Abcc6 UTSW 7 45,654,663 (GRCm39) missense possibly damaging 0.60
R4791:Abcc6 UTSW 7 45,631,584 (GRCm39) missense probably benign 0.00
R4895:Abcc6 UTSW 7 45,630,414 (GRCm39) missense possibly damaging 0.95
R4898:Abcc6 UTSW 7 45,639,111 (GRCm39) missense probably damaging 0.96
R4905:Abcc6 UTSW 7 45,644,649 (GRCm39) missense probably benign
R4941:Abcc6 UTSW 7 45,661,947 (GRCm39) missense probably benign 0.00
R5040:Abcc6 UTSW 7 45,669,578 (GRCm39) missense probably benign 0.04
R5128:Abcc6 UTSW 7 45,639,070 (GRCm39) missense probably benign 0.00
R5284:Abcc6 UTSW 7 45,630,483 (GRCm39) missense probably benign 0.05
R5328:Abcc6 UTSW 7 45,641,735 (GRCm39) missense probably benign 0.01
R5459:Abcc6 UTSW 7 45,631,607 (GRCm39) missense probably benign 0.00
R5543:Abcc6 UTSW 7 45,638,960 (GRCm39) critical splice donor site probably null
R6178:Abcc6 UTSW 7 45,678,468 (GRCm39) missense probably benign
R6228:Abcc6 UTSW 7 45,679,680 (GRCm39) missense probably benign 0.02
R6532:Abcc6 UTSW 7 45,626,803 (GRCm39) missense probably damaging 1.00
R6605:Abcc6 UTSW 7 45,630,481 (GRCm39) missense probably damaging 1.00
R7000:Abcc6 UTSW 7 45,654,946 (GRCm39) missense possibly damaging 0.60
R7067:Abcc6 UTSW 7 45,668,114 (GRCm39) missense probably benign
R7553:Abcc6 UTSW 7 45,648,545 (GRCm39) missense probably damaging 1.00
R7597:Abcc6 UTSW 7 45,644,661 (GRCm39) missense probably damaging 1.00
R7718:Abcc6 UTSW 7 45,626,816 (GRCm39) missense possibly damaging 0.91
R7781:Abcc6 UTSW 7 45,655,030 (GRCm39) missense probably damaging 1.00
R7798:Abcc6 UTSW 7 45,626,277 (GRCm39) nonsense probably null
R7896:Abcc6 UTSW 7 45,626,803 (GRCm39) missense probably damaging 1.00
R8098:Abcc6 UTSW 7 45,646,089 (GRCm39) missense probably damaging 1.00
R8443:Abcc6 UTSW 7 45,629,449 (GRCm39) missense probably damaging 1.00
R8773:Abcc6 UTSW 7 45,634,569 (GRCm39) missense probably benign
R8784:Abcc6 UTSW 7 45,652,025 (GRCm39) missense probably benign
R8802:Abcc6 UTSW 7 45,658,283 (GRCm39) missense probably damaging 0.99
R8807:Abcc6 UTSW 7 45,648,431 (GRCm39) missense possibly damaging 0.67
R9006:Abcc6 UTSW 7 45,665,820 (GRCm39) missense probably benign 0.00
R9127:Abcc6 UTSW 7 45,629,184 (GRCm39) missense probably damaging 1.00
R9475:Abcc6 UTSW 7 45,665,892 (GRCm39) missense probably damaging 1.00
R9480:Abcc6 UTSW 7 45,629,197 (GRCm39) missense probably damaging 1.00
R9535:Abcc6 UTSW 7 45,626,687 (GRCm39) missense probably damaging 1.00
R9642:Abcc6 UTSW 7 45,639,765 (GRCm39) missense probably benign 0.07
R9715:Abcc6 UTSW 7 45,629,359 (GRCm39) missense probably damaging 1.00
R9731:Abcc6 UTSW 7 45,669,660 (GRCm39) nonsense probably null
X0065:Abcc6 UTSW 7 45,669,621 (GRCm39) missense probably damaging 0.99
Z1176:Abcc6 UTSW 7 45,641,730 (GRCm39) critical splice donor site probably null
Z1176:Abcc6 UTSW 7 45,629,158 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CACTGATTTGGGAAACTGTTACAC -3'
(R):5'- AGTGTTTCCAGCCAAGGGTG -3'

Sequencing Primer
(F):5'- CTTGGCTAGGACAGAACT -3'
(R):5'- ACTGGGATTAAAGGTGTGCTCCAC -3'
Posted On 2015-12-21