Incidental Mutation 'R4780:Dync1h1'
ID366437
Institutional Source Beutler Lab
Gene Symbol Dync1h1
Ensembl Gene ENSMUSG00000018707
Gene Namedynein cytoplasmic 1 heavy chain 1
Synonyms9930018I23Rik, Dnchc1, dynein heavy chain, retrograde transport, Swl, MAP1C, Loa, Dnec1
MMRRC Submission 041993-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R4780 (G1)
Quality Score225
Status Validated
Chromosome12
Chromosomal Location110601452-110666945 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 110661196 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Histidine at position 4047 (Y4047H)
Ref Sequence ENSEMBL: ENSMUSP00000018851 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000018851]
PDB Structure
Microtubule binding domain from mouse cytoplasmic dynein as a fusion with seryl-tRNA synthetase [X-RAY DIFFRACTION]
High affinity dynein microtubule binding domain - tubulin complex [ELECTRON MICROSCOPY]
Low affinity dynein microtubule binding domain - tubulin complex [ELECTRON MICROSCOPY]
Structure of the entire stalk region of the dynein motor domain [X-RAY DIFFRACTION]
Predicted Effect probably damaging
Transcript: ENSMUST00000018851
AA Change: Y4047H

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000018851
Gene: ENSMUSG00000018707
AA Change: Y4047H

DomainStartEndE-ValueType
low complexity region 46 61 N/A INTRINSIC
low complexity region 83 95 N/A INTRINSIC
Pfam:DHC_N1 237 830 1.9e-145 PFAM
coiled coil region 1171 1198 N/A INTRINSIC
Pfam:DHC_N2 1317 1721 3.3e-116 PFAM
AAA 1899 2043 5.39e-2 SMART
low complexity region 2102 2116 N/A INTRINSIC
AAA 2214 2365 2.13e0 SMART
low complexity region 2394 2405 N/A INTRINSIC
AAA 2585 2735 8.6e-7 SMART
Blast:AAA 2777 2811 2e-13 BLAST
AAA 2927 3093 4.79e-5 SMART
Pfam:MT 3197 3534 1.1e-44 PFAM
Pfam:AAA_9 3554 3778 8.5e-75 PFAM
Pfam:Dynein_heavy 3919 4642 4.3e-163 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000107660
Predicted Effect noncoding transcript
Transcript: ENSMUST00000166185
Predicted Effect noncoding transcript
Transcript: ENSMUST00000166323
Predicted Effect probably benign
Transcript: ENSMUST00000167395
SMART Domains Protein: ENSMUSP00000126117
Gene: ENSMUSG00000018707

DomainStartEndE-ValueType
Pfam:MT 1 178 5.3e-18 PFAM
Pfam:AAA_9 154 252 3.6e-24 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000169981
Predicted Effect noncoding transcript
Transcript: ENSMUST00000170024
Predicted Effect noncoding transcript
Transcript: ENSMUST00000171535
Meta Mutation Damage Score 0.5714 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 94.6%
Validation Efficiency 98% (107/109)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Dyneins are a group of microtubule-activated ATPases that function as molecular motors. They are divided into two subgroups of axonemal and cytoplasmic dyneins. The cytoplasmic dyneins function in intracellular motility, including retrograde axonal transport, protein sorting, organelle movement, and spindle dynamics. Molecules of conventional cytoplasmic dynein are comprised of 2 heavy chain polypeptides and a number of intermediate and light chains.This gene encodes a member of the cytoplasmic dynein heavy chain family. [provided by RefSeq, Oct 2008]
PHENOTYPE: Mice homozygous for either the Cra1 or Loa ENU mutation exhibit neonatal lethality with reduced anterior horn cell number, abnormal motor neuron innervation, neuronal inclusions, and abnormal axonal transport. Heterozygotes display motor neuron degeneration and muscle spasms. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 105 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110002E22Rik A G 3: 138,065,370 N107D probably benign Het
4833413E03Rik A C 17: 31,558,764 noncoding transcript Het
4931429L15Rik G T 9: 46,308,846 H129Q possibly damaging Het
A730018C14Rik A G 12: 112,415,635 noncoding transcript Het
Abcc6 T A 7: 45,996,691 K791N probably benign Het
Adcy4 T G 14: 55,775,036 Q550P probably benign Het
Add3 C A 19: 53,234,792 A325E possibly damaging Het
Agbl4 T A 4: 111,657,331 I513N possibly damaging Het
Agfg1 C A 1: 82,886,387 T392K probably damaging Het
Akna C A 4: 63,379,254 M854I probably benign Het
Ankrd44 T C 1: 54,763,757 N194S probably benign Het
Anks1b A G 10: 89,873,732 K21E probably damaging Het
Ap1s3 A G 1: 79,609,172 F154L probably benign Het
Apbb2 T A 5: 66,362,817 N477I probably damaging Het
Apobec3 T C 15: 79,899,024 C101R possibly damaging Het
Arnt G T 3: 95,488,385 V410F probably damaging Het
Arsg G A 11: 109,534,013 R270H possibly damaging Het
B3gnt7 T A 1: 86,305,270 D79E probably damaging Het
BC067074 A G 13: 113,317,858 Y146C probably damaging Het
Cd44 G T 2: 102,861,565 A126D probably damaging Het
Cd69 A G 6: 129,271,355 I56T probably damaging Het
Cep120 G A 18: 53,724,536 P286S probably benign Het
Ces2a T C 8: 104,737,208 F184S probably damaging Het
Chrng A G 1: 87,207,524 N185S probably damaging Het
Cldn6 A T 17: 23,681,247 M62L probably benign Het
Cntn6 T A 6: 104,845,784 N765K probably damaging Het
Ctnnal1 T C 4: 56,847,857 D94G probably damaging Het
Cyp2c69 T C 19: 39,877,594 N185S probably benign Het
Depdc1a A G 3: 159,526,706 N698S probably benign Het
Dnah2 A T 11: 69,473,871 I1986N probably damaging Het
Dnah7b A G 1: 46,353,014 E3845G probably benign Het
Dpysl3 C T 18: 43,354,802 V159I probably benign Het
E130308A19Rik C T 4: 59,691,057 P297L probably benign Het
E2f5 A G 3: 14,587,319 T72A probably benign Het
Ephb6 G T 6: 41,616,139 R437L probably damaging Het
Erbb4 T C 1: 68,298,314 H615R probably damaging Het
Erbin T C 13: 103,884,206 T82A probably damaging Het
Eri2 T C 7: 119,785,680 N533D probably benign Het
Fkbp9 A G 6: 56,850,716 N174S probably damaging Het
Fsbp C T 4: 11,583,709 T136I possibly damaging Het
Fubp3 C A 2: 31,583,211 D47E probably damaging Het
Gm21850 G A 2: 154,056,499 noncoding transcript Het
Gm5141 T A 13: 62,774,950 Y135F unknown Het
Gm7353 T A 7: 3,110,725 noncoding transcript Het
Gm8765 C A 13: 50,701,080 S251R probably damaging Het
Gm9925 T C 18: 74,065,273 probably benign Het
Greb1l T C 18: 10,541,792 S1180P probably benign Het
Hist1h2ag G A 13: 22,042,909 Q7* probably null Het
Kiz A G 2: 146,889,246 T192A possibly damaging Het
Klhl24 T A 16: 20,106,958 C79S probably damaging Het
Map3k11 A G 19: 5,690,938 H231R probably damaging Het
Mbd4 C A 6: 115,849,384 R194S probably benign Het
Mettl21e A C 1: 44,211,143 S34R probably benign Het
Mrps5 T C 2: 127,598,241 V245A probably benign Het
Mtrf1 T C 14: 79,401,688 Y87H probably benign Het
Myh15 T C 16: 49,120,057 I790T probably benign Het
Necab1 T G 4: 14,989,248 I176L probably benign Het
Nfkb2 T A 19: 46,309,922 L555Q probably damaging Het
Nhlrc3 T A 3: 53,458,567 E168D probably benign Het
Nlrp5 T A 7: 23,435,778 C949S probably damaging Het
Nup155 C A 15: 8,157,703 A1372E probably benign Het
Nynrin G T 14: 55,863,263 R170L probably damaging Het
Ogfrl1 T A 1: 23,370,321 N275Y probably damaging Het
Olfr1110 C T 2: 87,135,877 S148N probably damaging Het
Olfr1302 A G 2: 111,780,845 D175G probably damaging Het
Olfr1480 A G 19: 13,529,955 N138S probably benign Het
Olfr912 A G 9: 38,581,969 T231A possibly damaging Het
Olr1 A T 6: 129,488,876 S56T probably damaging Het
Ovol2 A T 2: 144,331,283 probably benign Het
Pcdha6 A T 18: 36,969,853 I700F probably damaging Het
Prkcz C T 4: 155,289,702 V86M probably damaging Het
Ptpn13 A G 5: 103,586,773 T2124A probably benign Het
Ranbp3 G T 17: 56,673,346 probably benign Het
Rapgef2 A G 3: 79,169,769 probably benign Het
Rbl1 A G 2: 157,174,804 V625A probably benign Het
Rbm38 G T 2: 173,022,151 G38C probably damaging Het
Reg1 T G 6: 78,426,350 F7C possibly damaging Het
Retnlg A T 16: 48,874,334 Q115L possibly damaging Het
Rhobtb1 G A 10: 69,270,153 V183I probably benign Het
Rims1 T C 1: 22,291,105 Q1186R probably damaging Het
Ryr1 A G 7: 29,095,097 F1246L possibly damaging Het
Samm50 A G 15: 84,210,610 N401S possibly damaging Het
Scn3a T A 2: 65,506,193 I690F probably damaging Het
Sdk1 A G 5: 141,959,238 D304G probably damaging Het
Skint6 T C 4: 113,236,397 Y183C probably damaging Het
Slamf1 A T 1: 171,777,261 T200S probably benign Het
Slc34a2 C T 5: 53,069,451 R639C probably damaging Het
Smap1 A T 1: 23,853,436 M149K probably benign Het
Sorcs1 T C 19: 50,143,981 probably benign Het
Sp140 T A 1: 85,610,828 D95E possibly damaging Het
Spata13 G A 14: 60,753,907 W366* probably null Het
Strip1 G A 3: 107,626,998 T136I probably benign Het
Tacr1 A T 6: 82,557,072 T360S probably benign Het
Tbc1d14 T A 5: 36,571,256 probably benign Het
Tcaf2 T C 6: 42,628,062 Y596C probably damaging Het
Tspoap1 C T 11: 87,778,443 T1454I possibly damaging Het
Ttc30a2 A C 2: 75,977,576 C197W probably benign Het
Ttn A T 2: 76,914,583 M5374K probably benign Het
Uts2r G A 11: 121,160,879 V190I possibly damaging Het
Vmn1r181 A G 7: 23,984,583 T158A possibly damaging Het
Wdr35 A T 12: 9,018,150 T778S probably benign Het
Xrn1 A T 9: 95,974,744 probably benign Het
Zfp35 A T 18: 24,003,269 K223N probably damaging Het
Zfp764 T C 7: 127,404,771 Q396R probably benign Het
Zfyve1 T C 12: 83,558,647 Y11C probably damaging Het
Other mutations in Dync1h1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01291:Dync1h1 APN 12 110649104 missense probably benign 0.31
IGL01299:Dync1h1 APN 12 110614107 missense probably benign 0.04
IGL01321:Dync1h1 APN 12 110625607 splice site probably benign
IGL01324:Dync1h1 APN 12 110626865 missense probably damaging 0.99
IGL01327:Dync1h1 APN 12 110616692 splice site probably benign
IGL01371:Dync1h1 APN 12 110638851 missense probably benign 0.05
IGL01598:Dync1h1 APN 12 110658128 missense probably damaging 0.99
IGL01782:Dync1h1 APN 12 110614940 missense probably damaging 1.00
IGL01791:Dync1h1 APN 12 110658930 missense probably damaging 0.99
IGL01797:Dync1h1 APN 12 110652196 critical splice donor site probably null
IGL02040:Dync1h1 APN 12 110637124 missense probably benign 0.21
IGL02096:Dync1h1 APN 12 110632820 missense possibly damaging 0.68
IGL02164:Dync1h1 APN 12 110662559 missense probably damaging 1.00
IGL02216:Dync1h1 APN 12 110663002 missense probably damaging 0.98
IGL02298:Dync1h1 APN 12 110640888 missense probably damaging 1.00
IGL02422:Dync1h1 APN 12 110640210 missense possibly damaging 0.68
IGL02610:Dync1h1 APN 12 110659232 nonsense probably null
IGL02643:Dync1h1 APN 12 110659272 unclassified probably benign
IGL03076:Dync1h1 APN 12 110657893 missense probably damaging 1.00
IGL03292:Dync1h1 APN 12 110666555 unclassified probably null
IGL03293:Dync1h1 APN 12 110628734 missense probably benign 0.12
IGL03299:Dync1h1 APN 12 110619210 missense possibly damaging 0.49
Gesund UTSW 12 110616404 missense probably benign 0.35
gymnast UTSW 12 110618368 missense probably damaging 1.00
Lightfoot UTSW 12 110617920 missense probably damaging 1.00
Lissom UTSW 12 110632820 missense possibly damaging 0.68
Strong UTSW 12 110658126 missense probably damaging 1.00
waters UTSW 12 110629679 missense probably damaging 1.00
ANU05:Dync1h1 UTSW 12 110649104 missense probably benign 0.31
H8562:Dync1h1 UTSW 12 110616807 missense probably benign 0.01
R0082:Dync1h1 UTSW 12 110636446 missense probably benign
R0110:Dync1h1 UTSW 12 110639944 missense probably benign 0.42
R0130:Dync1h1 UTSW 12 110618674 missense probably benign 0.16
R0233:Dync1h1 UTSW 12 110640980 missense probably benign 0.45
R0233:Dync1h1 UTSW 12 110640980 missense probably benign 0.45
R0242:Dync1h1 UTSW 12 110649851 missense possibly damaging 0.67
R0242:Dync1h1 UTSW 12 110649851 missense possibly damaging 0.67
R0408:Dync1h1 UTSW 12 110631692 missense probably benign
R0450:Dync1h1 UTSW 12 110639944 missense probably benign 0.42
R0611:Dync1h1 UTSW 12 110632788 missense probably damaging 0.97
R0612:Dync1h1 UTSW 12 110616496 missense probably damaging 1.00
R0624:Dync1h1 UTSW 12 110651747 unclassified probably benign
R0685:Dync1h1 UTSW 12 110657192 missense probably damaging 1.00
R0747:Dync1h1 UTSW 12 110612411 missense probably benign
R0747:Dync1h1 UTSW 12 110629284 missense probably damaging 0.99
R0843:Dync1h1 UTSW 12 110665213 missense possibly damaging 0.81
R0970:Dync1h1 UTSW 12 110636509 missense probably benign 0.04
R1161:Dync1h1 UTSW 12 110636509 missense probably benign 0.04
R1211:Dync1h1 UTSW 12 110636509 missense probably benign 0.04
R1214:Dync1h1 UTSW 12 110636509 missense probably benign 0.04
R1215:Dync1h1 UTSW 12 110636509 missense probably benign 0.04
R1227:Dync1h1 UTSW 12 110636509 missense probably benign 0.04
R1230:Dync1h1 UTSW 12 110636509 missense probably benign 0.04
R1232:Dync1h1 UTSW 12 110636509 missense probably benign 0.04
R1237:Dync1h1 UTSW 12 110665959 missense probably benign 0.00
R1274:Dync1h1 UTSW 12 110636509 missense probably benign 0.04
R1275:Dync1h1 UTSW 12 110636509 missense probably benign 0.04
R1289:Dync1h1 UTSW 12 110636509 missense probably benign 0.04
R1290:Dync1h1 UTSW 12 110636509 missense probably benign 0.04
R1331:Dync1h1 UTSW 12 110649264 missense probably damaging 0.98
R1340:Dync1h1 UTSW 12 110636509 missense probably benign 0.04
R1383:Dync1h1 UTSW 12 110636509 missense probably benign 0.04
R1394:Dync1h1 UTSW 12 110636509 missense probably benign 0.04
R1396:Dync1h1 UTSW 12 110636509 missense probably benign 0.04
R1397:Dync1h1 UTSW 12 110636509 missense probably benign 0.04
R1413:Dync1h1 UTSW 12 110636509 missense probably benign 0.04
R1432:Dync1h1 UTSW 12 110636509 missense probably benign 0.04
R1500:Dync1h1 UTSW 12 110636509 missense probably benign 0.04
R1661:Dync1h1 UTSW 12 110656357 missense probably damaging 1.00
R1678:Dync1h1 UTSW 12 110665662 critical splice acceptor site probably null
R1698:Dync1h1 UTSW 12 110626992 missense possibly damaging 0.88
R1767:Dync1h1 UTSW 12 110636509 missense probably benign 0.04
R1776:Dync1h1 UTSW 12 110632928 splice site probably benign
R1812:Dync1h1 UTSW 12 110662900 missense possibly damaging 0.46
R1831:Dync1h1 UTSW 12 110614059 missense probably damaging 1.00
R1832:Dync1h1 UTSW 12 110614059 missense probably damaging 1.00
R1856:Dync1h1 UTSW 12 110636509 missense probably benign 0.04
R1857:Dync1h1 UTSW 12 110662625 missense probably damaging 0.96
R1879:Dync1h1 UTSW 12 110624636 missense probably benign 0.04
R1892:Dync1h1 UTSW 12 110646304 missense probably damaging 1.00
R1909:Dync1h1 UTSW 12 110662629 missense probably damaging 1.00
R1962:Dync1h1 UTSW 12 110636509 missense probably benign 0.04
R1974:Dync1h1 UTSW 12 110625732 missense possibly damaging 0.80
R1999:Dync1h1 UTSW 12 110666423 critical splice donor site probably null
R2073:Dync1h1 UTSW 12 110614592 missense probably damaging 1.00
R2091:Dync1h1 UTSW 12 110649588 missense probably benign 0.07
R2113:Dync1h1 UTSW 12 110629986 missense probably damaging 1.00
R2128:Dync1h1 UTSW 12 110640882 missense probably damaging 1.00
R2134:Dync1h1 UTSW 12 110656631 missense possibly damaging 0.68
R2496:Dync1h1 UTSW 12 110641220 missense possibly damaging 0.65
R2680:Dync1h1 UTSW 12 110643247 missense probably damaging 1.00
R2890:Dync1h1 UTSW 12 110616891 missense probably damaging 1.00
R2964:Dync1h1 UTSW 12 110641026 critical splice donor site probably null
R3705:Dync1h1 UTSW 12 110640586 missense possibly damaging 0.80
R3708:Dync1h1 UTSW 12 110643129 missense probably damaging 0.96
R3735:Dync1h1 UTSW 12 110631675 missense probably benign
R3736:Dync1h1 UTSW 12 110631675 missense probably benign
R3882:Dync1h1 UTSW 12 110629058 missense probably benign 0.41
R3971:Dync1h1 UTSW 12 110665965 missense probably benign 0.00
R4017:Dync1h1 UTSW 12 110643190 missense probably damaging 1.00
R4032:Dync1h1 UTSW 12 110618049 nonsense probably null
R4355:Dync1h1 UTSW 12 110632899 missense possibly damaging 0.55
R4514:Dync1h1 UTSW 12 110657139 missense possibly damaging 0.76
R4586:Dync1h1 UTSW 12 110649483 missense probably benign 0.30
R4619:Dync1h1 UTSW 12 110638844 missense probably benign 0.09
R4659:Dync1h1 UTSW 12 110628767 missense possibly damaging 0.50
R4676:Dync1h1 UTSW 12 110662541 missense probably damaging 0.99
R4688:Dync1h1 UTSW 12 110655528 missense probably damaging 0.99
R4732:Dync1h1 UTSW 12 110649507 nonsense probably null
R4733:Dync1h1 UTSW 12 110649507 nonsense probably null
R4846:Dync1h1 UTSW 12 110658126 missense probably damaging 1.00
R4861:Dync1h1 UTSW 12 110658126 missense probably damaging 1.00
R4861:Dync1h1 UTSW 12 110658126 missense probably damaging 1.00
R4865:Dync1h1 UTSW 12 110639801 missense possibly damaging 0.84
R4872:Dync1h1 UTSW 12 110658126 missense probably damaging 1.00
R4873:Dync1h1 UTSW 12 110658126 missense probably damaging 1.00
R4874:Dync1h1 UTSW 12 110658126 missense probably damaging 1.00
R4875:Dync1h1 UTSW 12 110658126 missense probably damaging 1.00
R4927:Dync1h1 UTSW 12 110662855 missense possibly damaging 0.82
R4949:Dync1h1 UTSW 12 110658126 missense probably damaging 1.00
R4954:Dync1h1 UTSW 12 110658126 missense probably damaging 1.00
R4956:Dync1h1 UTSW 12 110658126 missense probably damaging 1.00
R4957:Dync1h1 UTSW 12 110658126 missense probably damaging 1.00
R4958:Dync1h1 UTSW 12 110658126 missense probably damaging 1.00
R4984:Dync1h1 UTSW 12 110658126 missense probably damaging 1.00
R4985:Dync1h1 UTSW 12 110658126 missense probably damaging 1.00
R4988:Dync1h1 UTSW 12 110658126 missense probably damaging 1.00
R5029:Dync1h1 UTSW 12 110618010 missense possibly damaging 0.46
R5032:Dync1h1 UTSW 12 110626892 nonsense probably null
R5036:Dync1h1 UTSW 12 110630535 missense probably damaging 1.00
R5037:Dync1h1 UTSW 12 110640907 missense probably benign 0.09
R5105:Dync1h1 UTSW 12 110617932 missense probably damaging 0.99
R5122:Dync1h1 UTSW 12 110629680 missense probably damaging 1.00
R5156:Dync1h1 UTSW 12 110628830 missense probably benign 0.00
R5290:Dync1h1 UTSW 12 110615068 missense probably benign 0.03
R5453:Dync1h1 UTSW 12 110632665 missense probably benign 0.12
R5540:Dync1h1 UTSW 12 110660950 missense probably benign 0.00
R5613:Dync1h1 UTSW 12 110632820 missense possibly damaging 0.68
R5626:Dync1h1 UTSW 12 110641141 missense probably benign 0.01
R5652:Dync1h1 UTSW 12 110665988 missense possibly damaging 0.70
R5655:Dync1h1 UTSW 12 110629062 missense probably benign 0.03
R5686:Dync1h1 UTSW 12 110616404 missense probably benign 0.35
R5772:Dync1h1 UTSW 12 110646273 nonsense probably null
R5806:Dync1h1 UTSW 12 110651653 missense probably damaging 1.00
R5891:Dync1h1 UTSW 12 110614220 critical splice donor site probably null
R5921:Dync1h1 UTSW 12 110618368 missense probably damaging 1.00
R5965:Dync1h1 UTSW 12 110632778 missense probably benign
R6113:Dync1h1 UTSW 12 110620414 missense probably benign
R6119:Dync1h1 UTSW 12 110628006 missense possibly damaging 0.82
R6154:Dync1h1 UTSW 12 110617993 missense probably damaging 1.00
R6339:Dync1h1 UTSW 12 110646205 missense probably damaging 0.97
R6522:Dync1h1 UTSW 12 110616737 missense probably damaging 0.99
R6531:Dync1h1 UTSW 12 110617920 missense probably damaging 1.00
R6554:Dync1h1 UTSW 12 110649848 missense probably benign 0.06
R6672:Dync1h1 UTSW 12 110658134 missense probably damaging 1.00
R6746:Dync1h1 UTSW 12 110651653 missense probably damaging 1.00
R6785:Dync1h1 UTSW 12 110629679 missense probably damaging 1.00
R6857:Dync1h1 UTSW 12 110658547 missense possibly damaging 0.94
R6863:Dync1h1 UTSW 12 110652180 missense probably benign 0.07
R6881:Dync1h1 UTSW 12 110624561 missense probably damaging 1.00
R6892:Dync1h1 UTSW 12 110638901 missense probably benign 0.00
R7015:Dync1h1 UTSW 12 110666087 nonsense probably null
R7096:Dync1h1 UTSW 12 110657078 missense probably damaging 0.99
R7173:Dync1h1 UTSW 12 110601739 missense probably benign
R7224:Dync1h1 UTSW 12 110617762 missense possibly damaging 0.93
R7295:Dync1h1 UTSW 12 110664749 critical splice donor site probably null
R7308:Dync1h1 UTSW 12 110665162 missense possibly damaging 0.91
R7346:Dync1h1 UTSW 12 110635642 missense probably damaging 1.00
R7359:Dync1h1 UTSW 12 110624602 missense probably benign 0.00
R7405:Dync1h1 UTSW 12 110634220 missense probably damaging 1.00
R7439:Dync1h1 UTSW 12 110636453 missense probably damaging 1.00
R7441:Dync1h1 UTSW 12 110636453 missense probably damaging 1.00
R7472:Dync1h1 UTSW 12 110665675 missense probably damaging 0.99
R7532:Dync1h1 UTSW 12 110651577 missense probably benign 0.00
R7543:Dync1h1 UTSW 12 110614107 missense probably benign 0.04
R7555:Dync1h1 UTSW 12 110630625 missense probably benign 0.03
R7632:Dync1h1 UTSW 12 110660893 missense probably benign 0.10
R7701:Dync1h1 UTSW 12 110618646 missense probably damaging 1.00
R7704:Dync1h1 UTSW 12 110665766 missense probably damaging 1.00
Z1088:Dync1h1 UTSW 12 110629917 frame shift probably null
Predicted Primers PCR Primer
(F):5'- CCCTGTGATATAGCCCAGACAC -3'
(R):5'- GCACGTTCTTCAACATCACC -3'

Sequencing Primer
(F):5'- AGACACACTGCTTCTTGGCTG -3'
(R):5'- ACCTGCCTGACTTCACGG -3'
Posted On2015-12-21