Incidental Mutation 'R4780:Greb1l'
ID366456
Institutional Source Beutler Lab
Gene Symbol Greb1l
Ensembl Gene ENSMUSG00000042942
Gene Namegrowth regulation by estrogen in breast cancer-like
SynonymsAK220484, mKIAA4095
MMRRC Submission 041993-MU
Accession Numbers

Genbank: NM_001083628; MGI: 3576497

Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R4780 (G1)
Quality Score225
Status Validated
Chromosome18
Chromosomal Location10325177-10562934 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 10541792 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 1180 (S1180P)
Ref Sequence ENSEMBL: ENSMUSP00000049003 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000048977] [ENSMUST00000172532] [ENSMUST00000172680]
Predicted Effect probably benign
Transcript: ENSMUST00000048977
AA Change: S1180P

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000049003
Gene: ENSMUSG00000042942
AA Change: S1180P

DomainStartEndE-ValueType
Pfam:GREB1 1 1172 N/A PFAM
Pfam:GREB1 1154 1913 N/A PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000172532
SMART Domains Protein: ENSMUSP00000134090
Gene: ENSMUSG00000042942

DomainStartEndE-ValueType
low complexity region 83 100 N/A INTRINSIC
low complexity region 282 301 N/A INTRINSIC
low complexity region 606 617 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000172680
SMART Domains Protein: ENSMUSP00000134314
Gene: ENSMUSG00000042942

DomainStartEndE-ValueType
low complexity region 116 129 N/A INTRINSIC
Meta Mutation Damage Score 0.0894 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 94.6%
Validation Efficiency 98% (107/109)
Allele List at MGI

All alleles(5) : Targeted, other(2) Gene trapped(3)

Other mutations in this stock
Total: 105 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110002E22Rik A G 3: 138,065,370 N107D probably benign Het
4833413E03Rik A C 17: 31,558,764 noncoding transcript Het
4931429L15Rik G T 9: 46,308,846 H129Q possibly damaging Het
A730018C14Rik A G 12: 112,415,635 noncoding transcript Het
Abcc6 T A 7: 45,996,691 K791N probably benign Het
Adcy4 T G 14: 55,775,036 Q550P probably benign Het
Add3 C A 19: 53,234,792 A325E possibly damaging Het
Agbl4 T A 4: 111,657,331 I513N possibly damaging Het
Agfg1 C A 1: 82,886,387 T392K probably damaging Het
Akna C A 4: 63,379,254 M854I probably benign Het
Ankrd44 T C 1: 54,763,757 N194S probably benign Het
Anks1b A G 10: 89,873,732 K21E probably damaging Het
Ap1s3 A G 1: 79,609,172 F154L probably benign Het
Apbb2 T A 5: 66,362,817 N477I probably damaging Het
Apobec3 T C 15: 79,899,024 C101R possibly damaging Het
Arnt G T 3: 95,488,385 V410F probably damaging Het
Arsg G A 11: 109,534,013 R270H possibly damaging Het
B3gnt7 T A 1: 86,305,270 D79E probably damaging Het
BC067074 A G 13: 113,317,858 Y146C probably damaging Het
Cd44 G T 2: 102,861,565 A126D probably damaging Het
Cd69 A G 6: 129,271,355 I56T probably damaging Het
Cep120 G A 18: 53,724,536 P286S probably benign Het
Ces2a T C 8: 104,737,208 F184S probably damaging Het
Chrng A G 1: 87,207,524 N185S probably damaging Het
Cldn6 A T 17: 23,681,247 M62L probably benign Het
Cntn6 T A 6: 104,845,784 N765K probably damaging Het
Ctnnal1 T C 4: 56,847,857 D94G probably damaging Het
Cyp2c69 T C 19: 39,877,594 N185S probably benign Het
Depdc1a A G 3: 159,526,706 N698S probably benign Het
Dnah2 A T 11: 69,473,871 I1986N probably damaging Het
Dnah7b A G 1: 46,353,014 E3845G probably benign Het
Dpysl3 C T 18: 43,354,802 V159I probably benign Het
Dync1h1 T C 12: 110,661,196 Y4047H probably damaging Het
E130308A19Rik C T 4: 59,691,057 P297L probably benign Het
E2f5 A G 3: 14,587,319 T72A probably benign Het
Ephb6 G T 6: 41,616,139 R437L probably damaging Het
Erbb4 T C 1: 68,298,314 H615R probably damaging Het
Erbin T C 13: 103,884,206 T82A probably damaging Het
Eri2 T C 7: 119,785,680 N533D probably benign Het
Fkbp9 A G 6: 56,850,716 N174S probably damaging Het
Fsbp C T 4: 11,583,709 T136I possibly damaging Het
Fubp3 C A 2: 31,583,211 D47E probably damaging Het
Gm21850 G A 2: 154,056,499 noncoding transcript Het
Gm5141 T A 13: 62,774,950 Y135F unknown Het
Gm7353 T A 7: 3,110,725 noncoding transcript Het
Gm8765 C A 13: 50,701,080 S251R probably damaging Het
Gm9925 T C 18: 74,065,273 probably benign Het
Hist1h2ag G A 13: 22,042,909 Q7* probably null Het
Kiz A G 2: 146,889,246 T192A possibly damaging Het
Klhl24 T A 16: 20,106,958 C79S probably damaging Het
Map3k11 A G 19: 5,690,938 H231R probably damaging Het
Mbd4 C A 6: 115,849,384 R194S probably benign Het
Mettl21e A C 1: 44,211,143 S34R probably benign Het
Mrps5 T C 2: 127,598,241 V245A probably benign Het
Mtrf1 T C 14: 79,401,688 Y87H probably benign Het
Myh15 T C 16: 49,120,057 I790T probably benign Het
Necab1 T G 4: 14,989,248 I176L probably benign Het
Nfkb2 T A 19: 46,309,922 L555Q probably damaging Het
Nhlrc3 T A 3: 53,458,567 E168D probably benign Het
Nlrp5 T A 7: 23,435,778 C949S probably damaging Het
Nup155 C A 15: 8,157,703 A1372E probably benign Het
Nynrin G T 14: 55,863,263 R170L probably damaging Het
Ogfrl1 T A 1: 23,370,321 N275Y probably damaging Het
Olfr1110 C T 2: 87,135,877 S148N probably damaging Het
Olfr1302 A G 2: 111,780,845 D175G probably damaging Het
Olfr1480 A G 19: 13,529,955 N138S probably benign Het
Olfr912 A G 9: 38,581,969 T231A possibly damaging Het
Olr1 A T 6: 129,488,876 S56T probably damaging Het
Ovol2 A T 2: 144,331,283 probably benign Het
Pcdha6 A T 18: 36,969,853 I700F probably damaging Het
Prkcz C T 4: 155,289,702 V86M probably damaging Het
Ptpn13 A G 5: 103,586,773 T2124A probably benign Het
Ranbp3 G T 17: 56,673,346 probably benign Het
Rapgef2 A G 3: 79,169,769 probably benign Het
Rbl1 A G 2: 157,174,804 V625A probably benign Het
Rbm38 G T 2: 173,022,151 G38C probably damaging Het
Reg1 T G 6: 78,426,350 F7C possibly damaging Het
Retnlg A T 16: 48,874,334 Q115L possibly damaging Het
Rhobtb1 G A 10: 69,270,153 V183I probably benign Het
Rims1 T C 1: 22,291,105 Q1186R probably damaging Het
Ryr1 A G 7: 29,095,097 F1246L possibly damaging Het
Samm50 A G 15: 84,210,610 N401S possibly damaging Het
Scn3a T A 2: 65,506,193 I690F probably damaging Het
Sdk1 A G 5: 141,959,238 D304G probably damaging Het
Skint6 T C 4: 113,236,397 Y183C probably damaging Het
Slamf1 A T 1: 171,777,261 T200S probably benign Het
Slc34a2 C T 5: 53,069,451 R639C probably damaging Het
Smap1 A T 1: 23,853,436 M149K probably benign Het
Sorcs1 T C 19: 50,143,981 probably benign Het
Sp140 T A 1: 85,610,828 D95E possibly damaging Het
Spata13 G A 14: 60,753,907 W366* probably null Het
Strip1 G A 3: 107,626,998 T136I probably benign Het
Tacr1 A T 6: 82,557,072 T360S probably benign Het
Tbc1d14 T A 5: 36,571,256 probably benign Het
Tcaf2 T C 6: 42,628,062 Y596C probably damaging Het
Tspoap1 C T 11: 87,778,443 T1454I possibly damaging Het
Ttc30a2 A C 2: 75,977,576 C197W probably benign Het
Ttn A T 2: 76,914,583 M5374K probably benign Het
Uts2r G A 11: 121,160,879 V190I possibly damaging Het
Vmn1r181 A G 7: 23,984,583 T158A possibly damaging Het
Wdr35 A T 12: 9,018,150 T778S probably benign Het
Xrn1 A T 9: 95,974,744 probably benign Het
Zfp35 A T 18: 24,003,269 K223N probably damaging Het
Zfp764 T C 7: 127,404,771 Q396R probably benign Het
Zfyve1 T C 12: 83,558,647 Y11C probably damaging Het
Other mutations in Greb1l
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00485:Greb1l APN 18 10555962 missense possibly damaging 0.90
IGL01554:Greb1l APN 18 10522144 missense probably benign 0.01
IGL01563:Greb1l APN 18 10469399 missense probably damaging 0.99
IGL01944:Greb1l APN 18 10557280 missense possibly damaging 0.91
IGL02110:Greb1l APN 18 10515271 missense probably damaging 1.00
IGL02249:Greb1l APN 18 10532961 missense probably damaging 1.00
IGL02318:Greb1l APN 18 10469388 missense possibly damaging 0.91
IGL02340:Greb1l APN 18 10515200 missense probably damaging 0.99
IGL02516:Greb1l APN 18 10537064 missense probably benign 0.31
IGL02566:Greb1l APN 18 10503299 missense probably damaging 0.99
IGL02583:Greb1l APN 18 10542362 missense probably damaging 1.00
IGL02838:Greb1l APN 18 10560430 missense probably damaging 1.00
A4554:Greb1l UTSW 18 10532862 missense possibly damaging 0.58
PIT4453001:Greb1l UTSW 18 10533031 missense probably damaging 0.98
PIT4453001:Greb1l UTSW 18 10533032 missense probably benign 0.08
R0099:Greb1l UTSW 18 10509158 missense probably damaging 1.00
R0226:Greb1l UTSW 18 10522076 intron probably benign
R0234:Greb1l UTSW 18 10560331 missense probably damaging 1.00
R0234:Greb1l UTSW 18 10560331 missense probably damaging 1.00
R0239:Greb1l UTSW 18 10458567 splice site probably benign
R0316:Greb1l UTSW 18 10547420 missense probably damaging 1.00
R0369:Greb1l UTSW 18 10469375 missense possibly damaging 0.80
R0394:Greb1l UTSW 18 10523374 missense probably damaging 0.99
R0478:Greb1l UTSW 18 10509281 missense probably damaging 1.00
R0555:Greb1l UTSW 18 10458781 splice site probably benign
R0671:Greb1l UTSW 18 10474303 missense probably damaging 1.00
R1282:Greb1l UTSW 18 10547289 missense probably benign 0.13
R1574:Greb1l UTSW 18 10554997 missense possibly damaging 0.95
R1574:Greb1l UTSW 18 10554997 missense possibly damaging 0.95
R1607:Greb1l UTSW 18 10529703 missense possibly damaging 0.85
R1666:Greb1l UTSW 18 10501080 critical splice donor site probably null
R1666:Greb1l UTSW 18 10529708 critical splice donor site probably null
R1720:Greb1l UTSW 18 10553848 missense probably benign 0.19
R1808:Greb1l UTSW 18 10542143 missense probably benign
R1829:Greb1l UTSW 18 10509314 missense probably damaging 1.00
R1897:Greb1l UTSW 18 10498992 missense probably benign 0.00
R1967:Greb1l UTSW 18 10501049 missense possibly damaging 0.91
R2025:Greb1l UTSW 18 10515221 missense possibly damaging 0.71
R2086:Greb1l UTSW 18 10523281 missense probably damaging 1.00
R2125:Greb1l UTSW 18 10511422 missense probably damaging 0.98
R2139:Greb1l UTSW 18 10555011 missense probably damaging 1.00
R2255:Greb1l UTSW 18 10554857 missense probably damaging 1.00
R2256:Greb1l UTSW 18 10503307 missense possibly damaging 0.91
R2257:Greb1l UTSW 18 10503307 missense possibly damaging 0.91
R2880:Greb1l UTSW 18 10547288 missense possibly damaging 0.93
R3623:Greb1l UTSW 18 10542380 missense probably damaging 0.99
R3778:Greb1l UTSW 18 10469444 missense possibly damaging 0.60
R3975:Greb1l UTSW 18 10522247 missense possibly damaging 0.71
R4038:Greb1l UTSW 18 10515209 missense possibly damaging 0.93
R4062:Greb1l UTSW 18 10522150 missense probably damaging 0.99
R4134:Greb1l UTSW 18 10529708 critical splice donor site probably null
R4342:Greb1l UTSW 18 10544561 missense probably benign 0.12
R4409:Greb1l UTSW 18 10503182 missense possibly damaging 0.70
R4600:Greb1l UTSW 18 10553705 missense probably damaging 1.00
R4618:Greb1l UTSW 18 10498965 missense probably benign 0.00
R4683:Greb1l UTSW 18 10529563 splice site probably null
R4686:Greb1l UTSW 18 10522112 missense probably damaging 0.98
R4707:Greb1l UTSW 18 10532922 missense probably benign 0.02
R4819:Greb1l UTSW 18 10458358 missense probably damaging 1.00
R4925:Greb1l UTSW 18 10547447 missense possibly damaging 0.79
R4960:Greb1l UTSW 18 10547306 missense probably damaging 0.99
R5150:Greb1l UTSW 18 10555950 frame shift probably null
R5154:Greb1l UTSW 18 10458312 missense probably benign 0.02
R5269:Greb1l UTSW 18 10511409 missense probably benign
R5290:Greb1l UTSW 18 10542427 missense probably damaging 1.00
R5310:Greb1l UTSW 18 10542427 missense probably damaging 1.00
R5328:Greb1l UTSW 18 10553720 missense probably damaging 1.00
R5337:Greb1l UTSW 18 10509143 missense probably damaging 1.00
R5393:Greb1l UTSW 18 10458312 missense probably benign 0.02
R5402:Greb1l UTSW 18 10537169 missense probably benign 0.26
R5718:Greb1l UTSW 18 10542427 missense probably damaging 1.00
R5719:Greb1l UTSW 18 10542427 missense probably damaging 1.00
R5720:Greb1l UTSW 18 10542427 missense probably damaging 1.00
R5721:Greb1l UTSW 18 10542427 missense probably damaging 1.00
R5902:Greb1l UTSW 18 10538302 missense probably benign 0.00
R5993:Greb1l UTSW 18 10544455 missense probably benign 0.10
R6035:Greb1l UTSW 18 10501025 missense possibly damaging 0.91
R6035:Greb1l UTSW 18 10501025 missense possibly damaging 0.91
R6045:Greb1l UTSW 18 10547068 missense probably damaging 1.00
R6063:Greb1l UTSW 18 10557340 missense probably damaging 1.00
R6297:Greb1l UTSW 18 10469494 missense probably damaging 1.00
R6405:Greb1l UTSW 18 10501076 missense probably benign 0.30
R6552:Greb1l UTSW 18 10541814 missense probably benign 0.00
R6572:Greb1l UTSW 18 10522131 missense probably benign 0.07
R6575:Greb1l UTSW 18 10547347 missense possibly damaging 0.88
R6922:Greb1l UTSW 18 10547482 missense possibly damaging 0.88
R6957:Greb1l UTSW 18 10558786 missense probably benign 0.23
R6962:Greb1l UTSW 18 10547327 missense probably damaging 1.00
R7012:Greb1l UTSW 18 10529707 critical splice donor site probably null
R7179:Greb1l UTSW 18 10544576 missense probably benign 0.00
R7251:Greb1l UTSW 18 10515319 missense probably damaging 1.00
R7275:Greb1l UTSW 18 10544561 missense probably benign 0.12
R7301:Greb1l UTSW 18 10544970 missense probably damaging 1.00
R7307:Greb1l UTSW 18 10538142 missense probably damaging 0.99
R7455:Greb1l UTSW 18 10554915 missense probably damaging 1.00
R7832:Greb1l UTSW 18 10542056 missense probably benign 0.38
R7915:Greb1l UTSW 18 10542056 missense probably benign 0.38
Z1176:Greb1l UTSW 18 10515305 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GATGAGTTCCACTGTCCTCTTCTAG -3'
(R):5'- CTCATGTCTTTGTGCAGGCC -3'

Sequencing Primer
(F):5'- GTCCTCTTCTAGGTTCCATCATGGAG -3'
(R):5'- AGGCCACATCAGCATGGG -3'
Posted On2015-12-21