Incidental Mutation 'R4780:Greb1l'
ID 366456
Institutional Source Beutler Lab
Gene Symbol Greb1l
Ensembl Gene ENSMUSG00000042942
Gene Name growth regulation by estrogen in breast cancer-like
Synonyms AK220484, mKIAA4095
MMRRC Submission 041993-MU
Accession Numbers

Genbank: NM_001083628; MGI: 3576497

Essential gene? Essential (E-score: 1.000) question?
Stock # R4780 (G1)
Quality Score 225
Status Validated
Chromosome 18
Chromosomal Location 10325177-10562934 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 10541792 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Serine to Proline at position 1180 (S1180P)
Ref Sequence ENSEMBL: ENSMUSP00000049003 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000048977] [ENSMUST00000172532] [ENSMUST00000172680]
AlphaFold B9EJV3
Predicted Effect probably benign
Transcript: ENSMUST00000048977
AA Change: S1180P

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000049003
Gene: ENSMUSG00000042942
AA Change: S1180P

DomainStartEndE-ValueType
Pfam:GREB1 1 1172 N/A PFAM
Pfam:GREB1 1154 1913 N/A PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000172532
SMART Domains Protein: ENSMUSP00000134090
Gene: ENSMUSG00000042942

DomainStartEndE-ValueType
low complexity region 83 100 N/A INTRINSIC
low complexity region 282 301 N/A INTRINSIC
low complexity region 606 617 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000172680
SMART Domains Protein: ENSMUSP00000134314
Gene: ENSMUSG00000042942

DomainStartEndE-ValueType
low complexity region 116 129 N/A INTRINSIC
Meta Mutation Damage Score 0.0894 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 94.6%
Validation Efficiency 98% (107/109)
Allele List at MGI

All alleles(5) : Targeted, other(2) Gene trapped(3)

Other mutations in this stock
Total: 105 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110002E22Rik A G 3: 138,065,370 (GRCm38) N107D probably benign Het
4833413E03Rik A C 17: 31,558,764 (GRCm38) noncoding transcript Het
4931429L15Rik G T 9: 46,308,846 (GRCm38) H129Q possibly damaging Het
A730018C14Rik A G 12: 112,415,635 (GRCm38) noncoding transcript Het
Abcc6 T A 7: 45,996,691 (GRCm38) K791N probably benign Het
Adcy4 T G 14: 55,775,036 (GRCm38) Q550P probably benign Het
Add3 C A 19: 53,234,792 (GRCm38) A325E possibly damaging Het
Agbl4 T A 4: 111,657,331 (GRCm38) I513N possibly damaging Het
Agfg1 C A 1: 82,886,387 (GRCm38) T392K probably damaging Het
Akna C A 4: 63,379,254 (GRCm38) M854I probably benign Het
Ankrd44 T C 1: 54,763,757 (GRCm38) N194S probably benign Het
Anks1b A G 10: 89,873,732 (GRCm38) K21E probably damaging Het
Ap1s3 A G 1: 79,609,172 (GRCm38) F154L probably benign Het
Apbb2 T A 5: 66,362,817 (GRCm38) N477I probably damaging Het
Apobec3 T C 15: 79,899,024 (GRCm38) C101R possibly damaging Het
Arnt G T 3: 95,488,385 (GRCm38) V410F probably damaging Het
Arsg G A 11: 109,534,013 (GRCm38) R270H possibly damaging Het
B3gnt7 T A 1: 86,305,270 (GRCm38) D79E probably damaging Het
BC067074 A G 13: 113,317,858 (GRCm38) Y146C probably damaging Het
Cd44 G T 2: 102,861,565 (GRCm38) A126D probably damaging Het
Cd69 A G 6: 129,271,355 (GRCm38) I56T probably damaging Het
Cep120 G A 18: 53,724,536 (GRCm38) P286S probably benign Het
Ces2a T C 8: 104,737,208 (GRCm38) F184S probably damaging Het
Chrng A G 1: 87,207,524 (GRCm38) N185S probably damaging Het
Cldn6 A T 17: 23,681,247 (GRCm38) M62L probably benign Het
Cntn6 T A 6: 104,845,784 (GRCm38) N765K probably damaging Het
Ctnnal1 T C 4: 56,847,857 (GRCm38) D94G probably damaging Het
Cyp2c69 T C 19: 39,877,594 (GRCm38) N185S probably benign Het
Depdc1a A G 3: 159,526,706 (GRCm38) N698S probably benign Het
Dnah2 A T 11: 69,473,871 (GRCm38) I1986N probably damaging Het
Dnah7b A G 1: 46,353,014 (GRCm38) E3845G probably benign Het
Dpysl3 C T 18: 43,354,802 (GRCm38) V159I probably benign Het
Dync1h1 T C 12: 110,661,196 (GRCm38) Y4047H probably damaging Het
E130308A19Rik C T 4: 59,691,057 (GRCm38) P297L probably benign Het
E2f5 A G 3: 14,587,319 (GRCm38) T72A probably benign Het
Ephb6 G T 6: 41,616,139 (GRCm38) R437L probably damaging Het
Erbb4 T C 1: 68,298,314 (GRCm38) H615R probably damaging Het
Erbin T C 13: 103,884,206 (GRCm38) T82A probably damaging Het
Eri2 T C 7: 119,785,680 (GRCm38) N533D probably benign Het
Fkbp9 A G 6: 56,850,716 (GRCm38) N174S probably damaging Het
Fsbp C T 4: 11,583,709 (GRCm38) T136I possibly damaging Het
Fubp3 C A 2: 31,583,211 (GRCm38) D47E probably damaging Het
Gm21850 G A 2: 154,056,499 (GRCm38) noncoding transcript Het
Gm5141 T A 13: 62,774,950 (GRCm38) Y135F unknown Het
Gm7353 T A 7: 3,110,725 (GRCm38) noncoding transcript Het
Gm8765 C A 13: 50,701,080 (GRCm38) S251R probably damaging Het
Gm9925 T C 18: 74,065,273 (GRCm38) probably benign Het
Hist1h2ag G A 13: 22,042,909 (GRCm38) Q7* probably null Het
Kiz A G 2: 146,889,246 (GRCm38) T192A possibly damaging Het
Klhl24 T A 16: 20,106,958 (GRCm38) C79S probably damaging Het
Map3k11 A G 19: 5,690,938 (GRCm38) H231R probably damaging Het
Mbd4 C A 6: 115,849,384 (GRCm38) R194S probably benign Het
Mettl21e A C 1: 44,211,143 (GRCm38) S34R probably benign Het
Mrps5 T C 2: 127,598,241 (GRCm38) V245A probably benign Het
Mtrf1 T C 14: 79,401,688 (GRCm38) Y87H probably benign Het
Myh15 T C 16: 49,120,057 (GRCm38) I790T probably benign Het
Necab1 T G 4: 14,989,248 (GRCm38) I176L probably benign Het
Nfkb2 T A 19: 46,309,922 (GRCm38) L555Q probably damaging Het
Nhlrc3 T A 3: 53,458,567 (GRCm38) E168D probably benign Het
Nlrp5 T A 7: 23,435,778 (GRCm38) C949S probably damaging Het
Nup155 C A 15: 8,157,703 (GRCm38) A1372E probably benign Het
Nynrin G T 14: 55,863,263 (GRCm38) R170L probably damaging Het
Ogfrl1 T A 1: 23,370,321 (GRCm38) N275Y probably damaging Het
Olfr1110 C T 2: 87,135,877 (GRCm38) S148N probably damaging Het
Olfr1302 A G 2: 111,780,845 (GRCm38) D175G probably damaging Het
Olfr1480 A G 19: 13,529,955 (GRCm38) N138S probably benign Het
Olfr912 A G 9: 38,581,969 (GRCm38) T231A possibly damaging Het
Olr1 A T 6: 129,488,876 (GRCm38) S56T probably damaging Het
Ovol2 A T 2: 144,331,283 (GRCm38) probably benign Het
Pcdha6 A T 18: 36,969,853 (GRCm38) I700F probably damaging Het
Prkcz C T 4: 155,289,702 (GRCm38) V86M probably damaging Het
Ptpn13 A G 5: 103,586,773 (GRCm38) T2124A probably benign Het
Ranbp3 G T 17: 56,673,346 (GRCm38) probably benign Het
Rapgef2 A G 3: 79,169,769 (GRCm38) probably benign Het
Rbl1 A G 2: 157,174,804 (GRCm38) V625A probably benign Het
Rbm38 G T 2: 173,022,151 (GRCm38) G38C probably damaging Het
Reg1 T G 6: 78,426,350 (GRCm38) F7C possibly damaging Het
Retnlg A T 16: 48,874,334 (GRCm38) Q115L possibly damaging Het
Rhobtb1 G A 10: 69,270,153 (GRCm38) V183I probably benign Het
Rims1 T C 1: 22,291,105 (GRCm38) Q1186R probably damaging Het
Ryr1 A G 7: 29,095,097 (GRCm38) F1246L possibly damaging Het
Samm50 A G 15: 84,210,610 (GRCm38) N401S possibly damaging Het
Scn3a T A 2: 65,506,193 (GRCm38) I690F probably damaging Het
Sdk1 A G 5: 141,959,238 (GRCm38) D304G probably damaging Het
Skint6 T C 4: 113,236,397 (GRCm38) Y183C probably damaging Het
Slamf1 A T 1: 171,777,261 (GRCm38) T200S probably benign Het
Slc34a2 C T 5: 53,069,451 (GRCm38) R639C probably damaging Het
Smap1 A T 1: 23,853,436 (GRCm38) M149K probably benign Het
Sorcs1 T C 19: 50,143,981 (GRCm38) probably benign Het
Sp140 T A 1: 85,610,828 (GRCm38) D95E possibly damaging Het
Spata13 G A 14: 60,753,907 (GRCm38) W366* probably null Het
Strip1 G A 3: 107,626,998 (GRCm38) T136I probably benign Het
Tacr1 A T 6: 82,557,072 (GRCm38) T360S probably benign Het
Tbc1d14 T A 5: 36,571,256 (GRCm38) probably benign Het
Tcaf2 T C 6: 42,628,062 (GRCm38) Y596C probably damaging Het
Tspoap1 C T 11: 87,778,443 (GRCm38) T1454I possibly damaging Het
Ttc30a2 A C 2: 75,977,576 (GRCm38) C197W probably benign Het
Ttn A T 2: 76,914,583 (GRCm38) M5374K probably benign Het
Uts2r G A 11: 121,160,879 (GRCm38) V190I possibly damaging Het
Vmn1r181 A G 7: 23,984,583 (GRCm38) T158A possibly damaging Het
Wdr35 A T 12: 9,018,150 (GRCm38) T778S probably benign Het
Xrn1 A T 9: 95,974,744 (GRCm38) probably benign Het
Zfp35 A T 18: 24,003,269 (GRCm38) K223N probably damaging Het
Zfp764 T C 7: 127,404,771 (GRCm38) Q396R probably benign Het
Zfyve1 T C 12: 83,558,647 (GRCm38) Y11C probably damaging Het
Other mutations in Greb1l
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00485:Greb1l APN 18 10,555,962 (GRCm38) missense possibly damaging 0.90
IGL01554:Greb1l APN 18 10,522,144 (GRCm38) missense probably benign 0.01
IGL01563:Greb1l APN 18 10,469,399 (GRCm38) missense probably damaging 0.99
IGL01944:Greb1l APN 18 10,557,280 (GRCm38) missense possibly damaging 0.91
IGL02110:Greb1l APN 18 10,515,271 (GRCm38) missense probably damaging 1.00
IGL02249:Greb1l APN 18 10,532,961 (GRCm38) missense probably damaging 1.00
IGL02318:Greb1l APN 18 10,469,388 (GRCm38) missense possibly damaging 0.91
IGL02340:Greb1l APN 18 10,515,200 (GRCm38) missense probably damaging 0.99
IGL02516:Greb1l APN 18 10,537,064 (GRCm38) missense probably benign 0.31
IGL02566:Greb1l APN 18 10,503,299 (GRCm38) missense probably damaging 0.99
IGL02583:Greb1l APN 18 10,542,362 (GRCm38) missense probably damaging 1.00
IGL02838:Greb1l APN 18 10,560,430 (GRCm38) missense probably damaging 1.00
A4554:Greb1l UTSW 18 10,532,862 (GRCm38) missense possibly damaging 0.58
PIT4453001:Greb1l UTSW 18 10,533,032 (GRCm38) missense probably benign 0.08
PIT4453001:Greb1l UTSW 18 10,533,031 (GRCm38) missense probably damaging 0.98
R0099:Greb1l UTSW 18 10,509,158 (GRCm38) missense probably damaging 1.00
R0226:Greb1l UTSW 18 10,522,076 (GRCm38) intron probably benign
R0234:Greb1l UTSW 18 10,560,331 (GRCm38) missense probably damaging 1.00
R0234:Greb1l UTSW 18 10,560,331 (GRCm38) missense probably damaging 1.00
R0239:Greb1l UTSW 18 10,458,567 (GRCm38) splice site probably benign
R0316:Greb1l UTSW 18 10,547,420 (GRCm38) missense probably damaging 1.00
R0369:Greb1l UTSW 18 10,469,375 (GRCm38) missense possibly damaging 0.80
R0394:Greb1l UTSW 18 10,523,374 (GRCm38) missense probably damaging 0.99
R0478:Greb1l UTSW 18 10,509,281 (GRCm38) missense probably damaging 1.00
R0555:Greb1l UTSW 18 10,458,781 (GRCm38) splice site probably benign
R0671:Greb1l UTSW 18 10,474,303 (GRCm38) missense probably damaging 1.00
R1282:Greb1l UTSW 18 10,547,289 (GRCm38) missense probably benign 0.13
R1574:Greb1l UTSW 18 10,554,997 (GRCm38) missense possibly damaging 0.95
R1574:Greb1l UTSW 18 10,554,997 (GRCm38) missense possibly damaging 0.95
R1607:Greb1l UTSW 18 10,529,703 (GRCm38) missense possibly damaging 0.85
R1666:Greb1l UTSW 18 10,529,708 (GRCm38) critical splice donor site probably null
R1666:Greb1l UTSW 18 10,501,080 (GRCm38) critical splice donor site probably null
R1720:Greb1l UTSW 18 10,553,848 (GRCm38) missense probably benign 0.19
R1808:Greb1l UTSW 18 10,542,143 (GRCm38) missense probably benign
R1829:Greb1l UTSW 18 10,509,314 (GRCm38) missense probably damaging 1.00
R1897:Greb1l UTSW 18 10,498,992 (GRCm38) missense probably benign 0.00
R1967:Greb1l UTSW 18 10,501,049 (GRCm38) missense possibly damaging 0.91
R2025:Greb1l UTSW 18 10,515,221 (GRCm38) missense possibly damaging 0.71
R2086:Greb1l UTSW 18 10,523,281 (GRCm38) missense probably damaging 1.00
R2125:Greb1l UTSW 18 10,511,422 (GRCm38) missense probably damaging 0.98
R2139:Greb1l UTSW 18 10,555,011 (GRCm38) missense probably damaging 1.00
R2255:Greb1l UTSW 18 10,554,857 (GRCm38) missense probably damaging 1.00
R2256:Greb1l UTSW 18 10,503,307 (GRCm38) missense possibly damaging 0.91
R2257:Greb1l UTSW 18 10,503,307 (GRCm38) missense possibly damaging 0.91
R2880:Greb1l UTSW 18 10,547,288 (GRCm38) missense possibly damaging 0.93
R3623:Greb1l UTSW 18 10,542,380 (GRCm38) missense probably damaging 0.99
R3778:Greb1l UTSW 18 10,469,444 (GRCm38) missense possibly damaging 0.60
R3975:Greb1l UTSW 18 10,522,247 (GRCm38) missense possibly damaging 0.71
R4038:Greb1l UTSW 18 10,515,209 (GRCm38) missense possibly damaging 0.93
R4062:Greb1l UTSW 18 10,522,150 (GRCm38) missense probably damaging 0.99
R4134:Greb1l UTSW 18 10,529,708 (GRCm38) critical splice donor site probably null
R4342:Greb1l UTSW 18 10,544,561 (GRCm38) missense probably benign 0.12
R4409:Greb1l UTSW 18 10,503,182 (GRCm38) missense possibly damaging 0.70
R4600:Greb1l UTSW 18 10,553,705 (GRCm38) missense probably damaging 1.00
R4618:Greb1l UTSW 18 10,498,965 (GRCm38) missense probably benign 0.00
R4683:Greb1l UTSW 18 10,529,563 (GRCm38) splice site probably null
R4686:Greb1l UTSW 18 10,522,112 (GRCm38) missense probably damaging 0.98
R4707:Greb1l UTSW 18 10,532,922 (GRCm38) missense probably benign 0.02
R4819:Greb1l UTSW 18 10,458,358 (GRCm38) missense probably damaging 1.00
R4925:Greb1l UTSW 18 10,547,447 (GRCm38) missense possibly damaging 0.79
R4960:Greb1l UTSW 18 10,547,306 (GRCm38) missense probably damaging 0.99
R5150:Greb1l UTSW 18 10,555,950 (GRCm38) frame shift probably null
R5154:Greb1l UTSW 18 10,458,312 (GRCm38) missense probably benign 0.02
R5269:Greb1l UTSW 18 10,511,409 (GRCm38) missense probably benign
R5290:Greb1l UTSW 18 10,542,427 (GRCm38) missense probably damaging 1.00
R5310:Greb1l UTSW 18 10,542,427 (GRCm38) missense probably damaging 1.00
R5328:Greb1l UTSW 18 10,553,720 (GRCm38) missense probably damaging 1.00
R5337:Greb1l UTSW 18 10,509,143 (GRCm38) missense probably damaging 1.00
R5393:Greb1l UTSW 18 10,458,312 (GRCm38) missense probably benign 0.02
R5402:Greb1l UTSW 18 10,537,169 (GRCm38) missense probably benign 0.26
R5718:Greb1l UTSW 18 10,542,427 (GRCm38) missense probably damaging 1.00
R5719:Greb1l UTSW 18 10,542,427 (GRCm38) missense probably damaging 1.00
R5720:Greb1l UTSW 18 10,542,427 (GRCm38) missense probably damaging 1.00
R5721:Greb1l UTSW 18 10,542,427 (GRCm38) missense probably damaging 1.00
R5902:Greb1l UTSW 18 10,538,302 (GRCm38) missense probably benign 0.00
R5993:Greb1l UTSW 18 10,544,455 (GRCm38) missense probably benign 0.10
R6035:Greb1l UTSW 18 10,501,025 (GRCm38) missense possibly damaging 0.91
R6035:Greb1l UTSW 18 10,501,025 (GRCm38) missense possibly damaging 0.91
R6045:Greb1l UTSW 18 10,547,068 (GRCm38) missense probably damaging 1.00
R6063:Greb1l UTSW 18 10,557,340 (GRCm38) missense probably damaging 1.00
R6297:Greb1l UTSW 18 10,469,494 (GRCm38) missense probably damaging 1.00
R6405:Greb1l UTSW 18 10,501,076 (GRCm38) missense probably benign 0.30
R6552:Greb1l UTSW 18 10,541,814 (GRCm38) missense probably benign 0.00
R6572:Greb1l UTSW 18 10,522,131 (GRCm38) missense probably benign 0.07
R6575:Greb1l UTSW 18 10,547,347 (GRCm38) missense possibly damaging 0.88
R6922:Greb1l UTSW 18 10,547,482 (GRCm38) missense possibly damaging 0.88
R6957:Greb1l UTSW 18 10,558,786 (GRCm38) missense probably benign 0.23
R6962:Greb1l UTSW 18 10,547,327 (GRCm38) missense probably damaging 1.00
R7012:Greb1l UTSW 18 10,529,707 (GRCm38) critical splice donor site probably null
R7179:Greb1l UTSW 18 10,544,576 (GRCm38) missense probably benign 0.00
R7251:Greb1l UTSW 18 10,515,319 (GRCm38) missense probably damaging 1.00
R7275:Greb1l UTSW 18 10,544,561 (GRCm38) missense probably benign 0.12
R7301:Greb1l UTSW 18 10,544,970 (GRCm38) missense probably damaging 1.00
R7307:Greb1l UTSW 18 10,538,142 (GRCm38) missense probably damaging 0.99
R7455:Greb1l UTSW 18 10,554,915 (GRCm38) missense probably damaging 1.00
R7832:Greb1l UTSW 18 10,542,056 (GRCm38) missense probably benign 0.38
R7934:Greb1l UTSW 18 10,474,371 (GRCm38) nonsense probably null
R8137:Greb1l UTSW 18 10,474,357 (GRCm38) missense possibly damaging 0.77
R8138:Greb1l UTSW 18 10,533,060 (GRCm38) missense probably benign 0.13
R8208:Greb1l UTSW 18 10,510,703 (GRCm38) missense probably damaging 1.00
R8227:Greb1l UTSW 18 10,515,371 (GRCm38) missense probably damaging 1.00
R8312:Greb1l UTSW 18 10,511,587 (GRCm38) intron probably benign
R8331:Greb1l UTSW 18 10,458,706 (GRCm38) missense possibly damaging 0.96
R8364:Greb1l UTSW 18 10,529,687 (GRCm38) missense possibly damaging 0.85
R8389:Greb1l UTSW 18 10,529,613 (GRCm38) missense probably benign 0.00
R8695:Greb1l UTSW 18 10,544,450 (GRCm38) missense probably benign 0.01
R8795:Greb1l UTSW 18 10,553,739 (GRCm38) missense probably damaging 0.98
R8836:Greb1l UTSW 18 10,509,257 (GRCm38) missense probably benign 0.30
R8862:Greb1l UTSW 18 10,555,042 (GRCm38) missense possibly damaging 0.90
R8872:Greb1l UTSW 18 10,529,684 (GRCm38) missense probably benign 0.18
R8874:Greb1l UTSW 18 10,544,896 (GRCm38) missense probably benign 0.01
R8886:Greb1l UTSW 18 10,553,843 (GRCm38) missense probably benign 0.21
R8921:Greb1l UTSW 18 10,541,825 (GRCm38) missense probably benign 0.01
R8997:Greb1l UTSW 18 10,510,747 (GRCm38) missense probably damaging 1.00
R9015:Greb1l UTSW 18 10,541,675 (GRCm38) missense probably benign 0.00
R9018:Greb1l UTSW 18 10,542,004 (GRCm38) missense possibly damaging 0.76
R9074:Greb1l UTSW 18 10,558,795 (GRCm38) missense probably damaging 1.00
R9074:Greb1l UTSW 18 10,532,797 (GRCm38) missense probably damaging 1.00
R9117:Greb1l UTSW 18 10,542,422 (GRCm38) missense probably benign 0.31
R9189:Greb1l UTSW 18 10,499,983 (GRCm38) missense probably benign
R9332:Greb1l UTSW 18 10,532,796 (GRCm38) missense possibly damaging 0.92
R9367:Greb1l UTSW 18 10,522,130 (GRCm38) missense probably benign 0.00
R9497:Greb1l UTSW 18 10,458,600 (GRCm38) missense probably benign 0.00
R9796:Greb1l UTSW 18 10,538,233 (GRCm38) missense possibly damaging 0.69
Z1176:Greb1l UTSW 18 10,515,305 (GRCm38) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GATGAGTTCCACTGTCCTCTTCTAG -3'
(R):5'- CTCATGTCTTTGTGCAGGCC -3'

Sequencing Primer
(F):5'- GTCCTCTTCTAGGTTCCATCATGGAG -3'
(R):5'- AGGCCACATCAGCATGGG -3'
Posted On 2015-12-21