Incidental Mutation 'R4780:Olfr1480'
ID366462
Institutional Source Beutler Lab
Gene Symbol Olfr1480
Ensembl Gene ENSMUSG00000095484
Gene Nameolfactory receptor 1480
SynonymsMOR202-44, GA_x6K02T2RE5P-3862389-3863336
MMRRC Submission 041993-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.057) question?
Stock #R4780 (G1)
Quality Score225
Status Validated
Chromosome19
Chromosomal Location13527913-13531275 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 13529955 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Serine at position 138 (N138S)
Ref Sequence ENSEMBL: ENSMUSP00000146931 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000072219] [ENSMUST00000207093] [ENSMUST00000207904] [ENSMUST00000207987]
Predicted Effect probably benign
Transcript: ENSMUST00000072219
AA Change: N94S

PolyPhen 2 Score 0.113 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000072076
Gene: ENSMUSG00000095484
AA Change: N94S

DomainStartEndE-ValueType
Pfam:7tm_4 30 306 8.2e-54 PFAM
Pfam:7TM_GPCR_Srsx 34 304 1.6e-6 PFAM
Pfam:7tm_1 40 289 4.5e-19 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000207093
AA Change: N94S

PolyPhen 2 Score 0.113 (Sensitivity: 0.93; Specificity: 0.86)
Predicted Effect probably benign
Transcript: ENSMUST00000207904
AA Change: N94S

PolyPhen 2 Score 0.113 (Sensitivity: 0.93; Specificity: 0.86)
Predicted Effect probably benign
Transcript: ENSMUST00000207987
AA Change: N138S

PolyPhen 2 Score 0.297 (Sensitivity: 0.91; Specificity: 0.89)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000216709
Meta Mutation Damage Score 0.0719 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 94.6%
Validation Efficiency 98% (107/109)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 105 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110002E22Rik A G 3: 138,065,370 N107D probably benign Het
4833413E03Rik A C 17: 31,558,764 noncoding transcript Het
4931429L15Rik G T 9: 46,308,846 H129Q possibly damaging Het
A730018C14Rik A G 12: 112,415,635 noncoding transcript Het
Abcc6 T A 7: 45,996,691 K791N probably benign Het
Adcy4 T G 14: 55,775,036 Q550P probably benign Het
Add3 C A 19: 53,234,792 A325E possibly damaging Het
Agbl4 T A 4: 111,657,331 I513N possibly damaging Het
Agfg1 C A 1: 82,886,387 T392K probably damaging Het
Akna C A 4: 63,379,254 M854I probably benign Het
Ankrd44 T C 1: 54,763,757 N194S probably benign Het
Anks1b A G 10: 89,873,732 K21E probably damaging Het
Ap1s3 A G 1: 79,609,172 F154L probably benign Het
Apbb2 T A 5: 66,362,817 N477I probably damaging Het
Apobec3 T C 15: 79,899,024 C101R possibly damaging Het
Arnt G T 3: 95,488,385 V410F probably damaging Het
Arsg G A 11: 109,534,013 R270H possibly damaging Het
B3gnt7 T A 1: 86,305,270 D79E probably damaging Het
BC067074 A G 13: 113,317,858 Y146C probably damaging Het
Cd44 G T 2: 102,861,565 A126D probably damaging Het
Cd69 A G 6: 129,271,355 I56T probably damaging Het
Cep120 G A 18: 53,724,536 P286S probably benign Het
Ces2a T C 8: 104,737,208 F184S probably damaging Het
Chrng A G 1: 87,207,524 N185S probably damaging Het
Cldn6 A T 17: 23,681,247 M62L probably benign Het
Cntn6 T A 6: 104,845,784 N765K probably damaging Het
Ctnnal1 T C 4: 56,847,857 D94G probably damaging Het
Cyp2c69 T C 19: 39,877,594 N185S probably benign Het
Depdc1a A G 3: 159,526,706 N698S probably benign Het
Dnah2 A T 11: 69,473,871 I1986N probably damaging Het
Dnah7b A G 1: 46,353,014 E3845G probably benign Het
Dpysl3 C T 18: 43,354,802 V159I probably benign Het
Dync1h1 T C 12: 110,661,196 Y4047H probably damaging Het
E130308A19Rik C T 4: 59,691,057 P297L probably benign Het
E2f5 A G 3: 14,587,319 T72A probably benign Het
Ephb6 G T 6: 41,616,139 R437L probably damaging Het
Erbb4 T C 1: 68,298,314 H615R probably damaging Het
Erbin T C 13: 103,884,206 T82A probably damaging Het
Eri2 T C 7: 119,785,680 N533D probably benign Het
Fkbp9 A G 6: 56,850,716 N174S probably damaging Het
Fsbp C T 4: 11,583,709 T136I possibly damaging Het
Fubp3 C A 2: 31,583,211 D47E probably damaging Het
Gm21850 G A 2: 154,056,499 noncoding transcript Het
Gm5141 T A 13: 62,774,950 Y135F unknown Het
Gm7353 T A 7: 3,110,725 noncoding transcript Het
Gm8765 C A 13: 50,701,080 S251R probably damaging Het
Gm9925 T C 18: 74,065,273 probably benign Het
Greb1l T C 18: 10,541,792 S1180P probably benign Het
Hist1h2ag G A 13: 22,042,909 Q7* probably null Het
Kiz A G 2: 146,889,246 T192A possibly damaging Het
Klhl24 T A 16: 20,106,958 C79S probably damaging Het
Map3k11 A G 19: 5,690,938 H231R probably damaging Het
Mbd4 C A 6: 115,849,384 R194S probably benign Het
Mettl21e A C 1: 44,211,143 S34R probably benign Het
Mrps5 T C 2: 127,598,241 V245A probably benign Het
Mtrf1 T C 14: 79,401,688 Y87H probably benign Het
Myh15 T C 16: 49,120,057 I790T probably benign Het
Necab1 T G 4: 14,989,248 I176L probably benign Het
Nfkb2 T A 19: 46,309,922 L555Q probably damaging Het
Nhlrc3 T A 3: 53,458,567 E168D probably benign Het
Nlrp5 T A 7: 23,435,778 C949S probably damaging Het
Nup155 C A 15: 8,157,703 A1372E probably benign Het
Nynrin G T 14: 55,863,263 R170L probably damaging Het
Ogfrl1 T A 1: 23,370,321 N275Y probably damaging Het
Olfr1110 C T 2: 87,135,877 S148N probably damaging Het
Olfr1302 A G 2: 111,780,845 D175G probably damaging Het
Olfr912 A G 9: 38,581,969 T231A possibly damaging Het
Olr1 A T 6: 129,488,876 S56T probably damaging Het
Ovol2 A T 2: 144,331,283 probably benign Het
Pcdha6 A T 18: 36,969,853 I700F probably damaging Het
Prkcz C T 4: 155,289,702 V86M probably damaging Het
Ptpn13 A G 5: 103,586,773 T2124A probably benign Het
Ranbp3 G T 17: 56,673,346 probably benign Het
Rapgef2 A G 3: 79,169,769 probably benign Het
Rbl1 A G 2: 157,174,804 V625A probably benign Het
Rbm38 G T 2: 173,022,151 G38C probably damaging Het
Reg1 T G 6: 78,426,350 F7C possibly damaging Het
Retnlg A T 16: 48,874,334 Q115L possibly damaging Het
Rhobtb1 G A 10: 69,270,153 V183I probably benign Het
Rims1 T C 1: 22,291,105 Q1186R probably damaging Het
Ryr1 A G 7: 29,095,097 F1246L possibly damaging Het
Samm50 A G 15: 84,210,610 N401S possibly damaging Het
Scn3a T A 2: 65,506,193 I690F probably damaging Het
Sdk1 A G 5: 141,959,238 D304G probably damaging Het
Skint6 T C 4: 113,236,397 Y183C probably damaging Het
Slamf1 A T 1: 171,777,261 T200S probably benign Het
Slc34a2 C T 5: 53,069,451 R639C probably damaging Het
Smap1 A T 1: 23,853,436 M149K probably benign Het
Sorcs1 T C 19: 50,143,981 probably benign Het
Sp140 T A 1: 85,610,828 D95E possibly damaging Het
Spata13 G A 14: 60,753,907 W366* probably null Het
Strip1 G A 3: 107,626,998 T136I probably benign Het
Tacr1 A T 6: 82,557,072 T360S probably benign Het
Tbc1d14 T A 5: 36,571,256 probably benign Het
Tcaf2 T C 6: 42,628,062 Y596C probably damaging Het
Tspoap1 C T 11: 87,778,443 T1454I possibly damaging Het
Ttc30a2 A C 2: 75,977,576 C197W probably benign Het
Ttn A T 2: 76,914,583 M5374K probably benign Het
Uts2r G A 11: 121,160,879 V190I possibly damaging Het
Vmn1r181 A G 7: 23,984,583 T158A possibly damaging Het
Wdr35 A T 12: 9,018,150 T778S probably benign Het
Xrn1 A T 9: 95,974,744 probably benign Het
Zfp35 A T 18: 24,003,269 K223N probably damaging Het
Zfp764 T C 7: 127,404,771 Q396R probably benign Het
Zfyve1 T C 12: 83,558,647 Y11C probably damaging Het
Other mutations in Olfr1480
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00264:Olfr1480 APN 19 13529850 missense probably damaging 1.00
IGL01446:Olfr1480 APN 19 13530252 missense probably benign 0.00
IGL02300:Olfr1480 APN 19 13529880 missense probably damaging 1.00
IGL02689:Olfr1480 APN 19 13529807 missense probably benign 0.34
IGL03119:Olfr1480 APN 19 13530435 missense probably benign 0.11
R0636:Olfr1480 UTSW 19 13530249 missense possibly damaging 0.89
R1665:Olfr1480 UTSW 19 13529838 missense probably damaging 1.00
R1708:Olfr1480 UTSW 19 13529913 missense probably damaging 1.00
R2100:Olfr1480 UTSW 19 13530434 missense probably benign 0.02
R2137:Olfr1480 UTSW 19 13530438 missense probably damaging 0.98
R3879:Olfr1480 UTSW 19 13530249 missense probably damaging 1.00
R3949:Olfr1480 UTSW 19 13530020 missense probably damaging 0.99
R4953:Olfr1480 UTSW 19 13529814 missense probably null 1.00
R5075:Olfr1480 UTSW 19 13530273 missense probably benign 0.17
R5133:Olfr1480 UTSW 19 13530078 missense probably damaging 1.00
R5656:Olfr1480 UTSW 19 13530380 missense probably benign
R6853:Olfr1480 UTSW 19 13529931 missense possibly damaging 0.48
R6890:Olfr1480 UTSW 19 13530081 missense probably damaging 1.00
R7481:Olfr1480 UTSW 19 13530453 missense probably damaging 1.00
R7663:Olfr1480 UTSW 19 13530445 missense probably damaging 0.96
R8869:Olfr1480 UTSW 19 13530528 missense probably damaging 1.00
Z1088:Olfr1480 UTSW 19 13529852 missense possibly damaging 0.64
Z1177:Olfr1480 UTSW 19 13530215 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TAACAGATGCACCACTCCTG -3'
(R):5'- GAGTCCACTGACATAAGATCCAG -3'

Sequencing Primer
(F):5'- CACTTACTTGACAACATTGTTTGGG -3'
(R):5'- TGACATAAGATCCAGCAAGAAGC -3'
Posted On2015-12-21