Mutagenetix > Incidental Mutation

Incidental Mutation 'R4781:Cntnap5a'

366468

Institutional Source

Beutler Lab

Gene Symbol

Cntnap5a

Ensembl Gene

ENSMUSG00000070695

Gene Name

contactin associated protein-like 5A

Synonyms

Caspr5-1

MMRRC Submission

042415-MU

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R4781 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

115684756-116587323 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to T at 116412201 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Aspartic acid to Valine at position 730 (D730V)

Ref Sequence

ENSEMBL: ENSMUSP00000035732 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000043725]

AlphaFold

Q0V8T9

Predicted Effect

possibly damaging
Transcript: ENSMUST00000043725
AA Change: D730V

PolyPhen 2 Score 0.884 (Sensitivity: 0.82; Specificity: 0.94)

SMART Domains

Protein: ENSMUSP00000035732
Gene: ENSMUSG00000070695
AA Change: D730V

Domain	Start	End	E-Value	Type
signal peptide	1	24	N/A	INTRINSIC
FA58C	33	174	1.63e-13	SMART
LamG	201	338	1.4e-26	SMART
LamG	388	522	1.5e-26	SMART
EGF	550	584	2.16e-1	SMART
Blast:FBG	587	772	2e-81	BLAST
LamG	812	939	1.54e-28	SMART
EGF	960	996	2.28e0	SMART
LamG	1037	1173	4.73e-15	SMART
transmembrane domain	1241	1263	N/A	INTRINSIC

Meta Mutation Damage Score

0.7498

Coding Region Coverage

1x: 99.2%
3x: 98.6%
10x: 97.2%
20x: 95.0%

Validation Efficiency

100% (74/74)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene product belongs to the neurexin family, members of which function in the vertebrate nervous system as cell adhesion molecules and receptors. This protein, like other neurexin proteins, contains epidermal growth factor repeats and laminin G domains. In addition, it includes an F5/8 type C domain, discoidin/neuropilin- and fibrinogen-like domains, and thrombospondin N-terminal-like domains. [provided by RefSeq, Jul 2008]

Allele List at MGI

Other mutations in this stock

Total: 66 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2310022A10Rik	T	A	7: 27,571,651	I157N	probably damaging	Het
Adgrl3	T	C	5: 81,760,724	Y1165H	probably damaging	Het
Adra2a	A	G	19: 54,046,495	D94G	probably damaging	Het
Akr1c20	T	A	13: 4,508,175	K197*	probably null	Het
Ankrd65	C	T	4: 155,793,036	H335Y	possibly damaging	Het
Axin2	T	A	11: 108,943,856	L636Q	probably damaging	Het
BC147527	A	C	13: 120,308,162	K6T	possibly damaging	Het
Camk1g	G	T	1: 193,356,344	T90N	probably benign	Het
Cd177	C	A	7: 24,750,626	C528F	probably damaging	Het
Crtap	T	C	9: 114,386,236	D195G	probably benign	Het
Csn1s2b	A	G	5: 87,819,093	S74G	possibly damaging	Het
Cyp3a16	T	C	5: 145,456,112	R128G	possibly damaging	Het
Dnah7a	A	G	1: 53,425,208	F3675L	probably benign	Het
Dram2	T	A	3: 106,571,676	W195R	probably damaging	Het
E130308A19Rik	C	T	4: 59,691,057	P297L	probably benign	Het
Eif3i	T	C	4: 129,595,273	S83G	probably benign	Het
Gabra1	G	A	11: 42,133,661	P396S	probably damaging	Het
Gipr	T	A	7: 19,157,375	Y459F	possibly damaging	Het
Gm11677	C	T	11: 111,724,711		noncoding transcript	Het
Gm6981	T	C	9: 52,002,756		noncoding transcript	Het
Grin2d	T	C	7: 45,862,481	D180G	probably damaging	Het
Hectd4	T	G	5: 121,306,107		probably null	Het
Hhat	T	C	1: 192,686,979		probably benign	Het
Hoxa6	A	G	6: 52,206,420	L215P	possibly damaging	Het
Hsf4	G	A	8: 105,274,752		probably null	Het
Igf1r	G	A	7: 68,165,199	A283T	possibly damaging	Het
Ighv15-2	A	G	12: 114,564,856	S25P	probably damaging	Het
Inpp5a	C	T	7: 139,478,005	T43I	probably benign	Het
Kmt2c	T	A	5: 25,443,825	E82V	probably damaging	Het
Lrrc31	A	G	3: 30,687,377		probably benign	Het
Mdga2	A	G	12: 66,797,622		probably null	Het
Mefv	G	A	16: 3,715,334	P358S	probably benign	Het
Mrgpra9	A	G	7: 47,235,047	F291L	possibly damaging	Het
Mtmr3	A	G	11: 4,488,435	L673P	probably benign	Het
Muc19	T	C	15: 91,903,166		noncoding transcript	Het
Myo5b	A	T	18: 74,744,681	T1584S	possibly damaging	Het
Olfr1375	A	T	11: 51,048,480	R124S	probably damaging	Het
Olfr1427	T	C	19: 12,099,367	T91A	probably benign	Het
Palld	G	T	8: 61,877,028	R272S	probably benign	Het
Pcnx3	T	A	19: 5,687,130	N144Y	probably damaging	Het
Prf1	A	G	10: 61,300,424	K160E	probably damaging	Het
Rasgrp1	G	A	2: 117,291,709	A400V	probably benign	Het
Rnf150	A	G	8: 82,864,152	Y48C	probably damaging	Het
Rpl11	G	T	4: 136,050,288	Q170K	probably benign	Het
Scin	G	A	12: 40,081,764	A257V	possibly damaging	Het
Scn7a	C	A	2: 66,703,760	A524S	possibly damaging	Het
Sim1	T	C	10: 50,983,785	L581S	probably benign	Het
Skor1	T	C	9: 63,144,459	T715A	probably benign	Het
Slc22a26	A	G	19: 7,790,135	V301A	probably benign	Het
Sorcs1	T	C	19: 50,182,681	Y923C	probably damaging	Het
Src	T	A	2: 157,467,485	M304K	possibly damaging	Het
Srgap3	A	T	6: 112,757,425		probably benign	Het
Stard3	G	A	11: 98,372,334	E72K	possibly damaging	Het
Svep1	T	A	4: 58,070,340	N2482I	probably damaging	Het
Tbc1d23	T	C	16: 57,218,415	K20R	possibly damaging	Het
Tfip11	G	A	5: 112,333,399	E414K	probably damaging	Het
Tinag	G	T	9: 76,996,950	T397K	possibly damaging	Het
Traf7	C	G	17: 24,510,438		probably benign	Het
Trmt10b	T	A	4: 45,305,817	I164N	probably damaging	Het
Trpm1	A	G	7: 64,235,052	D827G	probably benign	Het
Ube2u	A	T	4: 100,486,658	T85S	probably benign	Het
Ulk4	T	C	9: 121,103,576	D1066G	probably benign	Het
Vmn2r72	T	A	7: 85,737,861	I832F	probably benign	Het
Yipf1	A	C	4: 107,336,158	E80D	probably benign	Het
Zfp40	T	A	17: 23,175,655	R653W	probably damaging	Het
Zxdc	A	G	6: 90,372,553	T308A	probably damaging	Het

Other mutations in Cntnap5a

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00763:Cntnap5a	APN	1	116117677	missense	possibly damaging	0.48
IGL00929:Cntnap5a	APN	1	116060274	splice site	probably null
IGL00959:Cntnap5a	APN	1	116184327	missense	probably benign	0.00
IGL01721:Cntnap5a	APN	1	116157637	missense	probably benign
IGL02009:Cntnap5a	APN	1	116157494	missense	probably benign	0.15
IGL02111:Cntnap5a	APN	1	116089352	missense	probably benign	0.00
IGL02198:Cntnap5a	APN	1	116580532	missense	probably benign
IGL02751:Cntnap5a	APN	1	116184457	critical splice donor site	probably null
IGL02752:Cntnap5a	APN	1	116580531	missense	probably benign	0.00
IGL02989:Cntnap5a	APN	1	116412083	splice site	probably benign
IGL03195:Cntnap5a	APN	1	116157448	missense	probably benign	0.00
PIT4142001:Cntnap5a	UTSW	1	115684956	start gained	probably benign
R0294:Cntnap5a	UTSW	1	115915316	missense	probably benign
R0377:Cntnap5a	UTSW	1	116292529	missense	probably benign	0.04
R0597:Cntnap5a	UTSW	1	116184461	splice site	probably benign
R0616:Cntnap5a	UTSW	1	116580549	missense	possibly damaging	0.80
R0725:Cntnap5a	UTSW	1	116292476	missense	probably benign	0.25
R0842:Cntnap5a	UTSW	1	116442223	missense	probably damaging	0.96
R1103:Cntnap5a	UTSW	1	116580669	missense	possibly damaging	0.81
R1265:Cntnap5a	UTSW	1	116428518	missense	possibly damaging	0.49
R1467:Cntnap5a	UTSW	1	115685168	nonsense	probably null
R1467:Cntnap5a	UTSW	1	115685168	nonsense	probably null
R1470:Cntnap5a	UTSW	1	116259519	missense	probably damaging	1.00
R1470:Cntnap5a	UTSW	1	116259519	missense	probably damaging	1.00
R1474:Cntnap5a	UTSW	1	116442373	nonsense	probably null
R1476:Cntnap5a	UTSW	1	115901020	missense	probably damaging	1.00
R1481:Cntnap5a	UTSW	1	116117663	missense	probably damaging	1.00
R1512:Cntnap5a	UTSW	1	115900950	missense	probably benign
R1526:Cntnap5a	UTSW	1	116428477	missense	probably benign
R1589:Cntnap5a	UTSW	1	116060200	missense	possibly damaging	0.77
R1603:Cntnap5a	UTSW	1	116412101	missense	possibly damaging	0.80
R1728:Cntnap5a	UTSW	1	116455004	missense	probably benign	0.00
R1728:Cntnap5a	UTSW	1	116455101	missense	probably benign	0.00
R1728:Cntnap5a	UTSW	1	116455143	missense	probably benign	0.01
R1729:Cntnap5a	UTSW	1	116455004	missense	probably benign	0.00
R1729:Cntnap5a	UTSW	1	116455101	missense	probably benign	0.00
R1729:Cntnap5a	UTSW	1	116455143	missense	probably benign	0.01
R1730:Cntnap5a	UTSW	1	116455004	missense	probably benign	0.00
R1730:Cntnap5a	UTSW	1	116455101	missense	probably benign	0.00
R1730:Cntnap5a	UTSW	1	116455143	missense	probably benign	0.01
R1739:Cntnap5a	UTSW	1	116455004	missense	probably benign	0.00
R1739:Cntnap5a	UTSW	1	116455101	missense	probably benign	0.00
R1739:Cntnap5a	UTSW	1	116455143	missense	probably benign	0.01
R1762:Cntnap5a	UTSW	1	116455004	missense	probably benign	0.00
R1762:Cntnap5a	UTSW	1	116455101	missense	probably benign	0.00
R1762:Cntnap5a	UTSW	1	116455143	missense	probably benign	0.01
R1783:Cntnap5a	UTSW	1	116455004	missense	probably benign	0.00
R1783:Cntnap5a	UTSW	1	116455101	missense	probably benign	0.00
R1783:Cntnap5a	UTSW	1	116455143	missense	probably benign	0.01
R1785:Cntnap5a	UTSW	1	116455004	missense	probably benign	0.00
R1785:Cntnap5a	UTSW	1	116455101	missense	probably benign	0.00
R1785:Cntnap5a	UTSW	1	116455143	missense	probably benign	0.01
R1816:Cntnap5a	UTSW	1	116428888	missense	probably benign	0.19
R1872:Cntnap5a	UTSW	1	116089210	missense	probably benign	0.02
R2095:Cntnap5a	UTSW	1	116442260	missense	probably damaging	1.00
R2113:Cntnap5a	UTSW	1	116188365	missense	probably damaging	0.98
R2144:Cntnap5a	UTSW	1	116101710	missense	probably benign	0.14
R2171:Cntnap5a	UTSW	1	116188402	missense	possibly damaging	0.95
R2219:Cntnap5a	UTSW	1	116580639	missense	possibly damaging	0.83
R2220:Cntnap5a	UTSW	1	116580639	missense	possibly damaging	0.83
R2571:Cntnap5a	UTSW	1	116184362	missense	probably damaging	1.00
R3019:Cntnap5a	UTSW	1	116101569	missense	probably benign
R3827:Cntnap5a	UTSW	1	116117679	missense	probably benign	0.14
R3870:Cntnap5a	UTSW	1	116060249	missense	probably damaging	1.00
R3871:Cntnap5a	UTSW	1	116060249	missense	probably damaging	1.00
R4041:Cntnap5a	UTSW	1	116184399	missense	probably benign	0.00
R4080:Cntnap5a	UTSW	1	116101574	missense	probably benign	0.01
R4260:Cntnap5a	UTSW	1	116446595	missense	probably benign	0.31
R4685:Cntnap5a	UTSW	1	116446680	missense	possibly damaging	0.69
R4785:Cntnap5a	UTSW	1	116101565	missense	probably benign	0.00
R5057:Cntnap5a	UTSW	1	115685213	missense	probably benign	0.10
R5059:Cntnap5a	UTSW	1	116428494	missense	probably benign	0.44
R5101:Cntnap5a	UTSW	1	116442296	missense	probably benign	0.00
R5302:Cntnap5a	UTSW	1	116157570	missense	probably benign	0.15
R5451:Cntnap5a	UTSW	1	115685143	missense	probably benign
R5473:Cntnap5a	UTSW	1	116089256	missense	probably benign	0.12
R5886:Cntnap5a	UTSW	1	116571672	critical splice donor site	probably null
R6311:Cntnap5a	UTSW	1	116412106	nonsense	probably null
R6464:Cntnap5a	UTSW	1	116184408	missense	probably benign
R6497:Cntnap5a	UTSW	1	116577897	missense	probably damaging	1.00
R6781:Cntnap5a	UTSW	1	116292397	missense	probably benign	0.05
R7137:Cntnap5a	UTSW	1	116089376	missense	probably damaging	1.00
R7290:Cntnap5a	UTSW	1	116221889	missense	probably damaging	1.00
R7342:Cntnap5a	UTSW	1	116060122	missense	probably benign	0.00
R7367:Cntnap5a	UTSW	1	116442295	missense	probably benign	0.00
R7373:Cntnap5a	UTSW	1	116580637	missense	probably benign	0.20
R7426:Cntnap5a	UTSW	1	116442380	missense	probably benign	0.03
R7444:Cntnap5a	UTSW	1	116292349	missense	probably benign
R7582:Cntnap5a	UTSW	1	116446632	missense	probably damaging	1.00
R7745:Cntnap5a	UTSW	1	116442283	missense	probably benign
R7948:Cntnap5a	UTSW	1	116580528	missense	probably benign	0.01
R7995:Cntnap5a	UTSW	1	116571547	missense	probably damaging	0.99
R8041:Cntnap5a	UTSW	1	116259479	missense	probably damaging	0.99
R8262:Cntnap5a	UTSW	1	116188410	missense	possibly damaging	0.66
R8273:Cntnap5a	UTSW	1	116571541	missense	probably damaging	1.00
R8320:Cntnap5a	UTSW	1	116446736	missense	possibly damaging	0.62
R9242:Cntnap5a	UTSW	1	116292379	missense	probably benign	0.06
R9470:Cntnap5a	UTSW	1	116446614	missense	probably damaging	1.00
R9601:Cntnap5a	UTSW	1	116580487	missense	probably damaging	0.96
R9616:Cntnap5a	UTSW	1	116101593	missense	probably benign
R9623:Cntnap5a	UTSW	1	116442255	nonsense	probably null
Z1088:Cntnap5a	UTSW	1	116060251	missense	probably benign	0.08
Z1176:Cntnap5a	UTSW	1	116428516	missense	probably damaging	1.00
Z1177:Cntnap5a	UTSW	1	116412168	missense	probably benign	0.03
Z1188:Cntnap5a	UTSW	1	116518205	missense	possibly damaging	0.70

Predicted Primers

PCR Primer
(F):5'- GAGCTCCTCTGTAGCCTTTCAG -3'
(R):5'- TCATGTTCAGAACTCATGAGCC -3'

Sequencing Primer
(F):5'- CAGCTTGTACTTCTGACTCATGAAAC -3'
(R):5'- CAGAACTCATGAGCCATGTATTATG -3'

Posted On

2015-12-21