Mutagenetix > Incidental Mutation

Incidental Mutation 'R4781:Rasgrp1'

366472

Institutional Source

Beutler Lab

Gene Symbol

Rasgrp1

Ensembl Gene

ENSMUSG00000027347

Gene Name

RAS guanyl releasing protein 1

Synonyms

MMRRC Submission

042415-MU

Accession Numbers

Essential gene?

Possibly non essential (E-score: 0.252) question?

Stock #

R4781 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

117279993-117343001 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

G to A at 117291709 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Alanine to Valine at position 400 (A400V)

Ref Sequence

ENSEMBL: ENSMUSP00000136423 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000102534] [ENSMUST00000172901] [ENSMUST00000173252] [ENSMUST00000173541] [ENSMUST00000174770] [ENSMUST00000178884]

AlphaFold

Q9Z1S3

Predicted Effect

probably benign
Transcript: ENSMUST00000102534
AA Change: A400V

PolyPhen 2 Score 0.041 (Sensitivity: 0.94; Specificity: 0.83)

SMART Domains

Protein: ENSMUSP00000099593
Gene: ENSMUSG00000027347
AA Change: A400V

Domain	Start	End	E-Value	Type
RasGEFN	52	176	1.65e-33	SMART
RasGEF	201	437	1.64e-96	SMART
Pfam:EF-hand_5	474	499	3.2e-6	PFAM
Pfam:EF-hand_6	474	502	5e-6	PFAM
C1	542	591	5.77e-16	SMART
PDB:4L9U\|B	740	791	2e-23	PDB

Predicted Effect

probably benign
Transcript: ENSMUST00000172901
AA Change: A400V

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)

SMART Domains

Protein: ENSMUSP00000133449
Gene: ENSMUSG00000027347
AA Change: A400V

Domain	Start	End	E-Value	Type
RasGEFN	52	176	1.65e-33	SMART
RasGEF	201	437	1.64e-96	SMART
Pfam:EF-hand_6	442	467	1.2e-5	PFAM
C1	507	556	5.77e-16	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000173252
AA Change: A400V

PolyPhen 2 Score 0.014 (Sensitivity: 0.96; Specificity: 0.79)

SMART Domains

Protein: ENSMUSP00000134592
Gene: ENSMUSG00000027347
AA Change: A400V

Domain	Start	End	E-Value	Type
RasGEFN	52	176	1.65e-33	SMART
RasGEF	201	437	1.64e-96	SMART
Pfam:EF-hand_6	442	467	1.1e-5	PFAM
Pfam:C1_1	507	539	3.4e-8	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000173541
AA Change: A400V

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)

SMART Domains

Protein: ENSMUSP00000134027
Gene: ENSMUSG00000027347
AA Change: A400V

Domain	Start	End	E-Value	Type
RasGEFN	52	176	1.65e-33	SMART
RasGEF	201	437	1.64e-96	SMART
Pfam:EF-hand_5	441	464	1.6e-5	PFAM
Pfam:EF-hand_6	442	467	1.6e-5	PFAM
C1	507	556	5.77e-16	SMART
PDB:4L9U\|B	705	756	2e-23	PDB

Predicted Effect

probably benign
Transcript: ENSMUST00000174770
AA Change: A400V

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)

SMART Domains

Protein: ENSMUSP00000134167
Gene: ENSMUSG00000027347
AA Change: A400V

Domain	Start	End	E-Value	Type
RasGEFN	52	176	1.65e-33	SMART
RasGEF	201	437	1.64e-96	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000178884
AA Change: A400V

PolyPhen 2 Score 0.041 (Sensitivity: 0.94; Specificity: 0.83)

SMART Domains

Protein: ENSMUSP00000136423
Gene: ENSMUSG00000027347
AA Change: A400V

Domain	Start	End	E-Value	Type
RasGEFN	52	176	1.65e-33	SMART
RasGEF	201	437	1.64e-96	SMART
Pfam:EF-hand_5	474	499	3.2e-6	PFAM
C1	542	591	5.77e-16	SMART
PDB:4L9U\|B	740	791	2e-23	PDB

Meta Mutation Damage Score

0.0580

Coding Region Coverage

1x: 99.2%
3x: 98.6%
10x: 97.2%
20x: 95.0%

Validation Efficiency

100% (74/74)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of a family of genes characterized by the presence of a Ras superfamily guanine nucleotide exchange factor (GEF) domain. It functions as a diacylglycerol (DAG)-regulated nucleotide exchange factor specifically activating Ras through the exchange of bound GDP for GTP. It activates the Erk/MAP kinase cascade and regulates T-cells and B-cells development, homeostasis and differentiation. Alternatively spliced transcript variants encoding different isoforms have been identified. Altered expression of the different isoforms of this protein may be a cause of susceptibility to systemic lupus erythematosus (SLE). [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for spontaneous and targeted null mutations exhibit a lymphoproliferative autoimmune syndrome in which T cells fail to activate Ras or proliferate after antigen exposure, defects in positive selection, and enlarged spleen and lymph nodes. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 66 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2310022A10Rik	T	A	7: 27,571,651	I157N	probably damaging	Het
Adgrl3	T	C	5: 81,760,724	Y1165H	probably damaging	Het
Adra2a	A	G	19: 54,046,495	D94G	probably damaging	Het
Akr1c20	T	A	13: 4,508,175	K197*	probably null	Het
Ankrd65	C	T	4: 155,793,036	H335Y	possibly damaging	Het
Axin2	T	A	11: 108,943,856	L636Q	probably damaging	Het
BC147527	A	C	13: 120,308,162	K6T	possibly damaging	Het
Camk1g	G	T	1: 193,356,344	T90N	probably benign	Het
Cd177	C	A	7: 24,750,626	C528F	probably damaging	Het
Cntnap5a	A	T	1: 116,412,201	D730V	possibly damaging	Het
Crtap	T	C	9: 114,386,236	D195G	probably benign	Het
Csn1s2b	A	G	5: 87,819,093	S74G	possibly damaging	Het
Cyp3a16	T	C	5: 145,456,112	R128G	possibly damaging	Het
Dnah7a	A	G	1: 53,425,208	F3675L	probably benign	Het
Dram2	T	A	3: 106,571,676	W195R	probably damaging	Het
E130308A19Rik	C	T	4: 59,691,057	P297L	probably benign	Het
Eif3i	T	C	4: 129,595,273	S83G	probably benign	Het
Gabra1	G	A	11: 42,133,661	P396S	probably damaging	Het
Gipr	T	A	7: 19,157,375	Y459F	possibly damaging	Het
Gm11677	C	T	11: 111,724,711		noncoding transcript	Het
Gm6981	T	C	9: 52,002,756		noncoding transcript	Het
Grin2d	T	C	7: 45,862,481	D180G	probably damaging	Het
Hectd4	T	G	5: 121,306,107		probably null	Het
Hhat	T	C	1: 192,686,979		probably benign	Het
Hoxa6	A	G	6: 52,206,420	L215P	possibly damaging	Het
Hsf4	G	A	8: 105,274,752		probably null	Het
Igf1r	G	A	7: 68,165,199	A283T	possibly damaging	Het
Ighv15-2	A	G	12: 114,564,856	S25P	probably damaging	Het
Inpp5a	C	T	7: 139,478,005	T43I	probably benign	Het
Kmt2c	T	A	5: 25,443,825	E82V	probably damaging	Het
Lrrc31	A	G	3: 30,687,377		probably benign	Het
Mdga2	A	G	12: 66,797,622		probably null	Het
Mefv	G	A	16: 3,715,334	P358S	probably benign	Het
Mrgpra9	A	G	7: 47,235,047	F291L	possibly damaging	Het
Mtmr3	A	G	11: 4,488,435	L673P	probably benign	Het
Muc19	T	C	15: 91,903,166		noncoding transcript	Het
Myo5b	A	T	18: 74,744,681	T1584S	possibly damaging	Het
Olfr1375	A	T	11: 51,048,480	R124S	probably damaging	Het
Olfr1427	T	C	19: 12,099,367	T91A	probably benign	Het
Palld	G	T	8: 61,877,028	R272S	probably benign	Het
Pcnx3	T	A	19: 5,687,130	N144Y	probably damaging	Het
Prf1	A	G	10: 61,300,424	K160E	probably damaging	Het
Rnf150	A	G	8: 82,864,152	Y48C	probably damaging	Het
Rpl11	G	T	4: 136,050,288	Q170K	probably benign	Het
Scin	G	A	12: 40,081,764	A257V	possibly damaging	Het
Scn7a	C	A	2: 66,703,760	A524S	possibly damaging	Het
Sim1	T	C	10: 50,983,785	L581S	probably benign	Het
Skor1	T	C	9: 63,144,459	T715A	probably benign	Het
Slc22a26	A	G	19: 7,790,135	V301A	probably benign	Het
Sorcs1	T	C	19: 50,182,681	Y923C	probably damaging	Het
Src	T	A	2: 157,467,485	M304K	possibly damaging	Het
Srgap3	A	T	6: 112,757,425		probably benign	Het
Stard3	G	A	11: 98,372,334	E72K	possibly damaging	Het
Svep1	T	A	4: 58,070,340	N2482I	probably damaging	Het
Tbc1d23	T	C	16: 57,218,415	K20R	possibly damaging	Het
Tfip11	G	A	5: 112,333,399	E414K	probably damaging	Het
Tinag	G	T	9: 76,996,950	T397K	possibly damaging	Het
Traf7	C	G	17: 24,510,438		probably benign	Het
Trmt10b	T	A	4: 45,305,817	I164N	probably damaging	Het
Trpm1	A	G	7: 64,235,052	D827G	probably benign	Het
Ube2u	A	T	4: 100,486,658	T85S	probably benign	Het
Ulk4	T	C	9: 121,103,576	D1066G	probably benign	Het
Vmn2r72	T	A	7: 85,737,861	I832F	probably benign	Het
Yipf1	A	C	4: 107,336,158	E80D	probably benign	Het
Zfp40	T	A	17: 23,175,655	R653W	probably damaging	Het
Zxdc	A	G	6: 90,372,553	T308A	probably damaging	Het

Other mutations in Rasgrp1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00504:Rasgrp1	APN	2	117305791	nonsense	probably null
IGL00901:Rasgrp1	APN	2	117285130	missense	probably damaging	0.96
IGL01083:Rasgrp1	APN	2	117285068	missense	probably benign	0.22
IGL01325:Rasgrp1	APN	2	117298529	missense	probably damaging	1.00
IGL01520:Rasgrp1	APN	2	117288663	missense	probably damaging	1.00
IGL01776:Rasgrp1	APN	2	117286840	critical splice donor site	probably null
IGL01780:Rasgrp1	APN	2	117284878	missense	probably benign	0.00
IGL01859:Rasgrp1	APN	2	117289418	missense	probably benign	0.00
IGL01892:Rasgrp1	APN	2	117293842	missense	probably damaging	1.00
IGL02068:Rasgrp1	APN	2	117300578	splice site	probably benign
IGL02684:Rasgrp1	APN	2	117282576	missense	probably benign	0.03
bukhansan	UTSW	2	117291697	missense	possibly damaging	0.78
Commendatore	UTSW	2	117282651	missense	probably benign	0.03
dragged	UTSW	2	117298545	missense	probably damaging	1.00
grouper	UTSW	2	117302004	nonsense	probably null
Gyeryandsan	UTSW	2	117287943	missense	probably damaging	1.00
Haddock	UTSW	2	117291895	missense	probably damaging	0.99
jovial	UTSW	2	117288677	missense	probably benign	0.01
mercurial	UTSW	2	117287833	nonsense	probably null
naejangsan	UTSW	2	117291792	nonsense	probably null
sea_bass	UTSW	2	117282654	missense	probably benign	0.02
venutian	UTSW	2	117284929	nonsense	probably null
R0067:Rasgrp1	UTSW	2	117294820	missense	probably damaging	1.00
R0067:Rasgrp1	UTSW	2	117294820	missense	probably damaging	1.00
R0538:Rasgrp1	UTSW	2	117284947	missense	probably benign	0.42
R0786:Rasgrp1	UTSW	2	117300499	missense	probably benign
R1068:Rasgrp1	UTSW	2	117282576	missense	probably benign	0.03
R1165:Rasgrp1	UTSW	2	117284939	missense	possibly damaging	0.49
R1491:Rasgrp1	UTSW	2	117282619	nonsense	probably null
R1707:Rasgrp1	UTSW	2	117298547	missense	probably damaging	1.00
R1869:Rasgrp1	UTSW	2	117290347	missense	probably damaging	1.00
R2214:Rasgrp1	UTSW	2	117285165	missense	probably damaging	0.98
R2425:Rasgrp1	UTSW	2	117289450	critical splice acceptor site	probably null
R3236:Rasgrp1	UTSW	2	117291812	missense	probably benign	0.00
R3915:Rasgrp1	UTSW	2	117288641	missense	probably damaging	1.00
R4079:Rasgrp1	UTSW	2	117285029	missense	probably benign	0.19
R4163:Rasgrp1	UTSW	2	117282654	missense	probably benign	0.02
R4782:Rasgrp1	UTSW	2	117284875	missense	probably benign	0.00
R5028:Rasgrp1	UTSW	2	117302004	nonsense	probably null
R6019:Rasgrp1	UTSW	2	117291895	missense	probably damaging	0.99
R6220:Rasgrp1	UTSW	2	117284929	nonsense	probably null
R6294:Rasgrp1	UTSW	2	117291792	nonsense	probably null
R6335:Rasgrp1	UTSW	2	117293870	missense	probably damaging	0.99
R6948:Rasgrp1	UTSW	2	117298604	missense	probably damaging	0.99
R7165:Rasgrp1	UTSW	2	117338404	missense	probably benign	0.02
R7246:Rasgrp1	UTSW	2	117338354	nonsense	probably null
R7372:Rasgrp1	UTSW	2	117285154	missense	probably benign	0.01
R7400:Rasgrp1	UTSW	2	117298545	missense	probably damaging	1.00
R7432:Rasgrp1	UTSW	2	117287943	missense	probably damaging	1.00
R7448:Rasgrp1	UTSW	2	117287943	missense	probably damaging	1.00
R7448:Rasgrp1	UTSW	2	117291697	missense	possibly damaging	0.78
R7449:Rasgrp1	UTSW	2	117287943	missense	probably damaging	1.00
R7450:Rasgrp1	UTSW	2	117287943	missense	probably damaging	1.00
R7475:Rasgrp1	UTSW	2	117286108	missense	probably benign
R7487:Rasgrp1	UTSW	2	117287943	missense	probably damaging	1.00
R7573:Rasgrp1	UTSW	2	117287943	missense	probably damaging	1.00
R7672:Rasgrp1	UTSW	2	117287943	missense	probably damaging	1.00
R8016:Rasgrp1	UTSW	2	117287833	nonsense	probably null
R8199:Rasgrp1	UTSW	2	117293812	missense	probably damaging	1.00
R8527:Rasgrp1	UTSW	2	117338304	missense	probably benign	0.07
R8692:Rasgrp1	UTSW	2	117284872	missense	probably damaging	0.97
R8725:Rasgrp1	UTSW	2	117288677	missense	probably benign	0.01
R8727:Rasgrp1	UTSW	2	117288677	missense	probably benign	0.01
R8880:Rasgrp1	UTSW	2	117284944	missense	probably benign	0.01
R9280:Rasgrp1	UTSW	2	117282651	missense	probably benign	0.03
R9675:Rasgrp1	UTSW	2	117342709	start codon destroyed	probably benign	0.00
R9792:Rasgrp1	UTSW	2	117287948	missense	probably benign	0.32
R9793:Rasgrp1	UTSW	2	117287948	missense	probably benign	0.32
R9795:Rasgrp1	UTSW	2	117287948	missense	probably benign	0.32
Z1176:Rasgrp1	UTSW	2	117301974	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- AGGAGATGGTGGCTCTACTCTG -3'
(R):5'- TCTGGGCGAGATGACTGAAC -3'

Sequencing Primer
(F):5'- GCTCTACTCTGTAGCTAGTATATGAG -3'
(R):5'- AGATGACTGAACTGCTGTCC -3'

Posted On

2015-12-21