Incidental Mutation 'R4781:Rpl11'
ID366482
Institutional Source Beutler Lab
Gene Symbol Rpl11
Ensembl Gene ENSMUSG00000059291
Gene Nameribosomal protein L11
Synonyms
MMRRC Submission 042415-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.916) question?
Stock #R4781 (G1)
Quality Score211
Status Validated
Chromosome4
Chromosomal Location136028265-136053428 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 136050288 bp
ZygosityHeterozygous
Amino Acid Change Glutamine to Lysine at position 170 (Q170K)
Ref Sequence ENSEMBL: ENSMUSP00000121108 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000102536] [ENSMUST00000155873]
Predicted Effect probably benign
Transcript: ENSMUST00000102536
AA Change: Q167K

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000099595
Gene: ENSMUSG00000059291
AA Change: Q167K

DomainStartEndE-ValueType
Pfam:Ribosomal_L5 10 63 6.9e-23 PFAM
Pfam:Ribosomal_L5_C 67 166 9.5e-27 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000125726
Predicted Effect noncoding transcript
Transcript: ENSMUST00000128733
Predicted Effect noncoding transcript
Transcript: ENSMUST00000133613
Predicted Effect noncoding transcript
Transcript: ENSMUST00000137580
Predicted Effect noncoding transcript
Transcript: ENSMUST00000142440
Predicted Effect noncoding transcript
Transcript: ENSMUST00000147059
Predicted Effect noncoding transcript
Transcript: ENSMUST00000150565
Predicted Effect probably benign
Transcript: ENSMUST00000155873
AA Change: Q170K

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000121108
Gene: ENSMUSG00000059291
AA Change: Q170K

DomainStartEndE-ValueType
Pfam:Ribosomal_L5 13 66 8e-23 PFAM
Pfam:Ribosomal_L5_C 70 169 1.1e-26 PFAM
Meta Mutation Damage Score 0.0654 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.0%
Validation Efficiency 100% (74/74)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Ribosomes, the organelles that catalyze protein synthesis, consist of a small 40S subunit and a large 60S subunit. Together these subunits are composed of 4 RNA species and approximately 80 structurally distinct proteins. This gene encodes a ribosomal protein that is a component of the 60S subunit. The protein belongs to the L5P family of ribosomal proteins. It is located in the cytoplasm. The protein probably associates with the 5S rRNA. Alternatively spliced transcript variants encoding different isoforms have been found for this gene. As is typical for genes encoding ribosomal proteins, there are multiple processed pseudogenes of this gene dispersed through the genome. [provided by RefSeq, Dec 2010]
Allele List at MGI
Other mutations in this stock
Total: 66 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310022A10Rik T A 7: 27,571,651 I157N probably damaging Het
Adgrl3 T C 5: 81,760,724 Y1165H probably damaging Het
Adra2a A G 19: 54,046,495 D94G probably damaging Het
Akr1c20 T A 13: 4,508,175 K197* probably null Het
Ankrd65 C T 4: 155,793,036 H335Y possibly damaging Het
Axin2 T A 11: 108,943,856 L636Q probably damaging Het
BC147527 A C 13: 120,308,162 K6T possibly damaging Het
Camk1g G T 1: 193,356,344 T90N probably benign Het
Cd177 C A 7: 24,750,626 C528F probably damaging Het
Cntnap5a A T 1: 116,412,201 D730V possibly damaging Het
Crtap T C 9: 114,386,236 D195G probably benign Het
Csn1s2b A G 5: 87,819,093 S74G possibly damaging Het
Cyp3a16 T C 5: 145,456,112 R128G possibly damaging Het
Dnah7a A G 1: 53,425,208 F3675L probably benign Het
Dram2 T A 3: 106,571,676 W195R probably damaging Het
E130308A19Rik C T 4: 59,691,057 P297L probably benign Het
Eif3i T C 4: 129,595,273 S83G probably benign Het
Gabra1 G A 11: 42,133,661 P396S probably damaging Het
Gipr T A 7: 19,157,375 Y459F possibly damaging Het
Gm11677 C T 11: 111,724,711 noncoding transcript Het
Gm6981 T C 9: 52,002,756 noncoding transcript Het
Grin2d T C 7: 45,862,481 D180G probably damaging Het
Hectd4 T G 5: 121,306,107 probably null Het
Hhat T C 1: 192,686,979 probably benign Het
Hoxa6 A G 6: 52,206,420 L215P possibly damaging Het
Hsf4 G A 8: 105,274,752 probably null Het
Igf1r G A 7: 68,165,199 A283T possibly damaging Het
Ighv15-2 A G 12: 114,564,856 S25P probably damaging Het
Inpp5a C T 7: 139,478,005 T43I probably benign Het
Kmt2c T A 5: 25,443,825 E82V probably damaging Het
Lrrc31 A G 3: 30,687,377 probably benign Het
Mdga2 A G 12: 66,797,622 probably null Het
Mefv G A 16: 3,715,334 P358S probably benign Het
Mrgpra9 A G 7: 47,235,047 F291L possibly damaging Het
Mtmr3 A G 11: 4,488,435 L673P probably benign Het
Muc19 T C 15: 91,903,166 noncoding transcript Het
Myo5b A T 18: 74,744,681 T1584S possibly damaging Het
Olfr1375 A T 11: 51,048,480 R124S probably damaging Het
Olfr1427 T C 19: 12,099,367 T91A probably benign Het
Palld G T 8: 61,877,028 R272S probably benign Het
Pcnx3 T A 19: 5,687,130 N144Y probably damaging Het
Prf1 A G 10: 61,300,424 K160E probably damaging Het
Rasgrp1 G A 2: 117,291,709 A400V probably benign Het
Rnf150 A G 8: 82,864,152 Y48C probably damaging Het
Scin G A 12: 40,081,764 A257V possibly damaging Het
Scn7a C A 2: 66,703,760 A524S possibly damaging Het
Sim1 T C 10: 50,983,785 L581S probably benign Het
Skor1 T C 9: 63,144,459 T715A probably benign Het
Slc22a26 A G 19: 7,790,135 V301A probably benign Het
Sorcs1 T C 19: 50,182,681 Y923C probably damaging Het
Src T A 2: 157,467,485 M304K possibly damaging Het
Srgap3 A T 6: 112,757,425 probably benign Het
Stard3 G A 11: 98,372,334 E72K possibly damaging Het
Svep1 T A 4: 58,070,340 N2482I probably damaging Het
Tbc1d23 T C 16: 57,218,415 K20R possibly damaging Het
Tfip11 G A 5: 112,333,399 E414K probably damaging Het
Tinag G T 9: 76,996,950 T397K possibly damaging Het
Traf7 C G 17: 24,510,438 probably benign Het
Trmt10b T A 4: 45,305,817 I164N probably damaging Het
Trpm1 A G 7: 64,235,052 D827G probably benign Het
Ube2u A T 4: 100,486,658 T85S probably benign Het
Ulk4 T C 9: 121,103,576 D1066G probably benign Het
Vmn2r72 T A 7: 85,737,861 I832F probably benign Het
Yipf1 A C 4: 107,336,158 E80D probably benign Het
Zfp40 T A 17: 23,175,655 R653W probably damaging Het
Zxdc A G 6: 90,372,553 T308A probably damaging Het
Other mutations in Rpl11
AlleleSourceChrCoordTypePredicted EffectPPH Score
R4373:Rpl11 UTSW 4 136051143 intron probably benign
R4374:Rpl11 UTSW 4 136051143 intron probably benign
R4375:Rpl11 UTSW 4 136051143 intron probably benign
R4377:Rpl11 UTSW 4 136051143 intron probably benign
R4560:Rpl11 UTSW 4 136051211 missense probably damaging 1.00
R5541:Rpl11 UTSW 4 136052732 splice site probably benign
Predicted Primers PCR Primer
(F):5'- ACGTCTGAGAATTCTGACTCCAG -3'
(R):5'- GTTCTGTCCAGCTGAGGTAC -3'

Sequencing Primer
(F):5'- AGATACCTACACTCAAGACCTTTTC -3'
(R):5'- CCAGCTGAGGTACTAGTCTTGATGAC -3'
Posted On2015-12-21