Mutagenetix > Incidental Mutation

Incidental Mutation 'R4781:Hectd4'

366487

Institutional Source

Beutler Lab

Gene Symbol

Hectd4

Ensembl Gene

ENSMUSG00000042744

Gene Name

HECT domain E3 ubiquitin protein ligase 4

Synonyms

Gm15800

MMRRC Submission

042415-MU

Accession Numbers

Essential gene?

Probably essential (E-score: 0.923) question?

Stock #

R4781 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

121220219-121368577 bp(+) (GRCm38)

Type of Mutation

critical splice donor site (2 bp from exon)

DNA Base Change (assembly)

T to G at 121306107 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Gene Model

predicted gene model for transcript(s): [ENSMUST00000042614] [ENSMUST00000042614] [ENSMUST00000100769] [ENSMUST00000100769]

AlphaFold

no structure available at present

Predicted Effect

probably null
Transcript: ENSMUST00000042614

SMART Domains

Protein: ENSMUSP00000048345
Gene: ENSMUSG00000042744

Domain	Start	End	E-Value	Type
low complexity region	224	234	N/A	INTRINSIC
low complexity region	266	282	N/A	INTRINSIC
low complexity region	553	564	N/A	INTRINSIC
low complexity region	725	735	N/A	INTRINSIC
low complexity region	1252	1265	N/A	INTRINSIC
coiled coil region	1372	1398	N/A	INTRINSIC
low complexity region	1551	1562	N/A	INTRINSIC
low complexity region	1725	1741	N/A	INTRINSIC
low complexity region	1892	1904	N/A	INTRINSIC
low complexity region	2656	2666	N/A	INTRINSIC
low complexity region	2857	2872	N/A	INTRINSIC
low complexity region	2901	2917	N/A	INTRINSIC
low complexity region	2921	2933	N/A	INTRINSIC
low complexity region	3232	3246	N/A	INTRINSIC
low complexity region	3275	3335	N/A	INTRINSIC
low complexity region	3441	3448	N/A	INTRINSIC
low complexity region	3473	3506	N/A	INTRINSIC
low complexity region	3512	3533	N/A	INTRINSIC
low complexity region	3540	3554	N/A	INTRINSIC
low complexity region	3794	3822	N/A	INTRINSIC
HECTc	4048	4412	4.78e-11	SMART

Predicted Effect

probably null
Transcript: ENSMUST00000042614

SMART Domains

Protein: ENSMUSP00000048345
Gene: ENSMUSG00000042744

Domain	Start	End	E-Value	Type
low complexity region	224	234	N/A	INTRINSIC
low complexity region	266	282	N/A	INTRINSIC
low complexity region	553	564	N/A	INTRINSIC
low complexity region	725	735	N/A	INTRINSIC
low complexity region	1252	1265	N/A	INTRINSIC
coiled coil region	1372	1398	N/A	INTRINSIC
low complexity region	1551	1562	N/A	INTRINSIC
low complexity region	1725	1741	N/A	INTRINSIC
low complexity region	1892	1904	N/A	INTRINSIC
low complexity region	2656	2666	N/A	INTRINSIC
low complexity region	2857	2872	N/A	INTRINSIC
low complexity region	2901	2917	N/A	INTRINSIC
low complexity region	2921	2933	N/A	INTRINSIC
low complexity region	3232	3246	N/A	INTRINSIC
low complexity region	3275	3335	N/A	INTRINSIC
low complexity region	3441	3448	N/A	INTRINSIC
low complexity region	3473	3506	N/A	INTRINSIC
low complexity region	3512	3533	N/A	INTRINSIC
low complexity region	3540	3554	N/A	INTRINSIC
low complexity region	3794	3822	N/A	INTRINSIC
HECTc	4048	4412	4.78e-11	SMART

Predicted Effect

probably null
Transcript: ENSMUST00000100769

SMART Domains

Protein: ENSMUSP00000098332
Gene: ENSMUSG00000042744

Domain	Start	End	E-Value	Type
coiled coil region	35	61	N/A	INTRINSIC
low complexity region	214	225	N/A	INTRINSIC
low complexity region	388	404	N/A	INTRINSIC
low complexity region	555	567	N/A	INTRINSIC

Predicted Effect

probably null
Transcript: ENSMUST00000100769

SMART Domains

Protein: ENSMUSP00000098332
Gene: ENSMUSG00000042744

Domain	Start	End	E-Value	Type
coiled coil region	35	61	N/A	INTRINSIC
low complexity region	214	225	N/A	INTRINSIC
low complexity region	388	404	N/A	INTRINSIC
low complexity region	555	567	N/A	INTRINSIC

Predicted Effect

probably null
Transcript: ENSMUST00000119892

SMART Domains

Protein: ENSMUSP00000112647
Gene: ENSMUSG00000042744

Domain	Start	End	E-Value	Type
low complexity region	261	272	N/A	INTRINSIC
low complexity region	433	443	N/A	INTRINSIC
low complexity region	960	973	N/A	INTRINSIC
coiled coil region	1080	1106	N/A	INTRINSIC
low complexity region	1259	1270	N/A	INTRINSIC
low complexity region	1433	1449	N/A	INTRINSIC
low complexity region	1600	1612	N/A	INTRINSIC
low complexity region	2364	2374	N/A	INTRINSIC
low complexity region	2565	2580	N/A	INTRINSIC
low complexity region	2609	2625	N/A	INTRINSIC
low complexity region	2629	2641	N/A	INTRINSIC
low complexity region	2940	2954	N/A	INTRINSIC
low complexity region	2983	3043	N/A	INTRINSIC
low complexity region	3149	3156	N/A	INTRINSIC
low complexity region	3181	3214	N/A	INTRINSIC
low complexity region	3220	3241	N/A	INTRINSIC
low complexity region	3248	3262	N/A	INTRINSIC
low complexity region	3502	3530	N/A	INTRINSIC
HECTc	3756	4120	4.78e-11	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000128514

Predicted Effect

probably benign
Transcript: ENSMUST00000201669

Meta Mutation Damage Score

0.9492

Coding Region Coverage

1x: 99.2%
3x: 98.6%
10x: 97.2%
20x: 95.0%

Validation Efficiency

100% (74/74)

Allele List at MGI

Other mutations in this stock

Total: 66 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2310022A10Rik	T	A	7: 27,571,651	I157N	probably damaging	Het
Adgrl3	T	C	5: 81,760,724	Y1165H	probably damaging	Het
Adra2a	A	G	19: 54,046,495	D94G	probably damaging	Het
Akr1c20	T	A	13: 4,508,175	K197*	probably null	Het
Ankrd65	C	T	4: 155,793,036	H335Y	possibly damaging	Het
Axin2	T	A	11: 108,943,856	L636Q	probably damaging	Het
BC147527	A	C	13: 120,308,162	K6T	possibly damaging	Het
Camk1g	G	T	1: 193,356,344	T90N	probably benign	Het
Cd177	C	A	7: 24,750,626	C528F	probably damaging	Het
Cntnap5a	A	T	1: 116,412,201	D730V	possibly damaging	Het
Crtap	T	C	9: 114,386,236	D195G	probably benign	Het
Csn1s2b	A	G	5: 87,819,093	S74G	possibly damaging	Het
Cyp3a16	T	C	5: 145,456,112	R128G	possibly damaging	Het
Dnah7a	A	G	1: 53,425,208	F3675L	probably benign	Het
Dram2	T	A	3: 106,571,676	W195R	probably damaging	Het
E130308A19Rik	C	T	4: 59,691,057	P297L	probably benign	Het
Eif3i	T	C	4: 129,595,273	S83G	probably benign	Het
Gabra1	G	A	11: 42,133,661	P396S	probably damaging	Het
Gipr	T	A	7: 19,157,375	Y459F	possibly damaging	Het
Gm11677	C	T	11: 111,724,711		noncoding transcript	Het
Gm6981	T	C	9: 52,002,756		noncoding transcript	Het
Grin2d	T	C	7: 45,862,481	D180G	probably damaging	Het
Hhat	T	C	1: 192,686,979		probably benign	Het
Hoxa6	A	G	6: 52,206,420	L215P	possibly damaging	Het
Hsf4	G	A	8: 105,274,752		probably null	Het
Igf1r	G	A	7: 68,165,199	A283T	possibly damaging	Het
Ighv15-2	A	G	12: 114,564,856	S25P	probably damaging	Het
Inpp5a	C	T	7: 139,478,005	T43I	probably benign	Het
Kmt2c	T	A	5: 25,443,825	E82V	probably damaging	Het
Lrrc31	A	G	3: 30,687,377		probably benign	Het
Mdga2	A	G	12: 66,797,622		probably null	Het
Mefv	G	A	16: 3,715,334	P358S	probably benign	Het
Mrgpra9	A	G	7: 47,235,047	F291L	possibly damaging	Het
Mtmr3	A	G	11: 4,488,435	L673P	probably benign	Het
Muc19	T	C	15: 91,903,166		noncoding transcript	Het
Myo5b	A	T	18: 74,744,681	T1584S	possibly damaging	Het
Olfr1375	A	T	11: 51,048,480	R124S	probably damaging	Het
Olfr1427	T	C	19: 12,099,367	T91A	probably benign	Het
Palld	G	T	8: 61,877,028	R272S	probably benign	Het
Pcnx3	T	A	19: 5,687,130	N144Y	probably damaging	Het
Prf1	A	G	10: 61,300,424	K160E	probably damaging	Het
Rasgrp1	G	A	2: 117,291,709	A400V	probably benign	Het
Rnf150	A	G	8: 82,864,152	Y48C	probably damaging	Het
Rpl11	G	T	4: 136,050,288	Q170K	probably benign	Het
Scin	G	A	12: 40,081,764	A257V	possibly damaging	Het
Scn7a	C	A	2: 66,703,760	A524S	possibly damaging	Het
Sim1	T	C	10: 50,983,785	L581S	probably benign	Het
Skor1	T	C	9: 63,144,459	T715A	probably benign	Het
Slc22a26	A	G	19: 7,790,135	V301A	probably benign	Het
Sorcs1	T	C	19: 50,182,681	Y923C	probably damaging	Het
Src	T	A	2: 157,467,485	M304K	possibly damaging	Het
Srgap3	A	T	6: 112,757,425		probably benign	Het
Stard3	G	A	11: 98,372,334	E72K	possibly damaging	Het
Svep1	T	A	4: 58,070,340	N2482I	probably damaging	Het
Tbc1d23	T	C	16: 57,218,415	K20R	possibly damaging	Het
Tfip11	G	A	5: 112,333,399	E414K	probably damaging	Het
Tinag	G	T	9: 76,996,950	T397K	possibly damaging	Het
Traf7	C	G	17: 24,510,438		probably benign	Het
Trmt10b	T	A	4: 45,305,817	I164N	probably damaging	Het
Trpm1	A	G	7: 64,235,052	D827G	probably benign	Het
Ube2u	A	T	4: 100,486,658	T85S	probably benign	Het
Ulk4	T	C	9: 121,103,576	D1066G	probably benign	Het
Vmn2r72	T	A	7: 85,737,861	I832F	probably benign	Het
Yipf1	A	C	4: 107,336,158	E80D	probably benign	Het
Zfp40	T	A	17: 23,175,655	R653W	probably damaging	Het
Zxdc	A	G	6: 90,372,553	T308A	probably damaging	Het

Other mutations in Hectd4

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00156:Hectd4	APN	5	121363870	missense	possibly damaging	0.51
IGL00976:Hectd4	APN	5	121349106	missense	probably benign	0.18
IGL01085:Hectd4	APN	5	121331701	missense	probably damaging	1.00
IGL01112:Hectd4	APN	5	121306950	missense	probably benign	0.01
IGL01402:Hectd4	APN	5	121339417	splice site	probably benign
IGL01474:Hectd4	APN	5	121336649	missense	possibly damaging	0.53
IGL01503:Hectd4	APN	5	121318651	missense	probably benign	0.28
IGL01548:Hectd4	APN	5	121364660	missense	possibly damaging	0.71
IGL01656:Hectd4	APN	5	121322700	missense	probably damaging	0.99
IGL01756:Hectd4	APN	5	121344824	missense	probably benign	0.28
IGL01819:Hectd4	APN	5	121328418	missense	possibly damaging	0.85
IGL02080:Hectd4	APN	5	121366606	utr 3 prime	probably benign
IGL02488:Hectd4	APN	5	121292087	missense	probably benign	0.33
IGL02490:Hectd4	APN	5	121318613	missense	possibly damaging	0.82
IGL02558:Hectd4	APN	5	121344785	missense	probably benign	0.28
IGL02626:Hectd4	APN	5	121353881	missense	possibly damaging	0.86
IGL02649:Hectd4	APN	5	121349402	missense	possibly damaging	0.73
IGL02736:Hectd4	APN	5	121342719	missense	possibly damaging	0.73
IGL02861:Hectd4	APN	5	121307004	missense	possibly damaging	0.81
IGL02880:Hectd4	APN	5	121365053	missense	possibly damaging	0.93
IGL02889:Hectd4	APN	5	121365053	missense	possibly damaging	0.93
IGL02953:Hectd4	APN	5	121365053	missense	possibly damaging	0.93
IGL02969:Hectd4	APN	5	121365053	missense	possibly damaging	0.93
IGL03031:Hectd4	APN	5	121348794	missense	possibly damaging	0.96
IGL03066:Hectd4	APN	5	121365053	missense	possibly damaging	0.93
IGL03160:Hectd4	APN	5	121259879	missense	probably benign
IGL03181:Hectd4	APN	5	121353958	missense	possibly damaging	0.91
IGL03265:Hectd4	APN	5	121259939	splice site	probably benign
IGL03375:Hectd4	APN	5	121328382	missense	possibly damaging	0.72
Achilles	UTSW	5	121307381	nonsense	probably null
agamemnon	UTSW	5	121253858	splice site	probably benign
clymnestra	UTSW	5	121334375	missense	possibly damaging	0.86
hector	UTSW	5	121315437	missense	probably damaging	1.00
helen	UTSW	5	121310663	missense	probably damaging	0.97
Merriwether	UTSW	5	121353551	missense	possibly damaging	0.53
PIT4466001:Hectd4	UTSW	5	121333060	critical splice donor site	probably null
R0018:Hectd4	UTSW	5	121254179	missense	possibly damaging	0.53
R0024:Hectd4	UTSW	5	121308576	missense	possibly damaging	0.92
R0030:Hectd4	UTSW	5	121262588	nonsense	probably null
R0080:Hectd4	UTSW	5	121349372	missense	probably benign	0.18
R0110:Hectd4	UTSW	5	121281896	missense	possibly damaging	0.90
R0110:Hectd4	UTSW	5	121305673	missense	possibly damaging	0.53
R0115:Hectd4	UTSW	5	121295506	splice site	probably benign
R0128:Hectd4	UTSW	5	121349243	missense	possibly damaging	0.86
R0131:Hectd4	UTSW	5	121333024	missense	probably benign	0.44
R0131:Hectd4	UTSW	5	121333024	missense	probably benign	0.44
R0132:Hectd4	UTSW	5	121333024	missense	probably benign	0.44
R0244:Hectd4	UTSW	5	121329605	missense	probably benign	0.33
R0281:Hectd4	UTSW	5	121254251	missense	possibly damaging	0.85
R0329:Hectd4	UTSW	5	121259864	missense	probably benign
R0410:Hectd4	UTSW	5	121286266	missense	possibly damaging	0.86
R0422:Hectd4	UTSW	5	121343082	splice site	probably null
R0442:Hectd4	UTSW	5	121323982	missense	possibly damaging	0.66
R0449:Hectd4	UTSW	5	121364590	splice site	probably null
R0469:Hectd4	UTSW	5	121281896	missense	possibly damaging	0.90
R0469:Hectd4	UTSW	5	121305673	missense	possibly damaging	0.53
R0481:Hectd4	UTSW	5	121295506	splice site	probably benign
R0510:Hectd4	UTSW	5	121281896	missense	possibly damaging	0.90
R0510:Hectd4	UTSW	5	121305673	missense	possibly damaging	0.53
R0520:Hectd4	UTSW	5	121331707	missense	possibly damaging	0.53
R0534:Hectd4	UTSW	5	121348476	missense	possibly damaging	0.96
R0603:Hectd4	UTSW	5	121304337	missense	possibly damaging	0.46
R0617:Hectd4	UTSW	5	121343232	splice site	probably benign
R0622:Hectd4	UTSW	5	121348625	missense	possibly damaging	0.53
R0626:Hectd4	UTSW	5	121277824	missense	probably benign	0.18
R0708:Hectd4	UTSW	5	121286463	critical splice donor site	probably null
R0710:Hectd4	UTSW	5	121336628	missense	probably benign	0.08
R0763:Hectd4	UTSW	5	121307033	unclassified	probably benign
R0764:Hectd4	UTSW	5	121286769	missense	possibly damaging	0.46
R1123:Hectd4	UTSW	5	121286736	missense	probably damaging	0.96
R1129:Hectd4	UTSW	5	121310599	missense	possibly damaging	0.66
R1204:Hectd4	UTSW	5	121350485	missense	possibly damaging	0.85
R1237:Hectd4	UTSW	5	121321507	missense	possibly damaging	0.90
R1257:Hectd4	UTSW	5	121318624	nonsense	probably null
R1391:Hectd4	UTSW	5	121353695	missense	possibly damaging	0.96
R1395:Hectd4	UTSW	5	121328513	critical splice donor site	probably null
R1468:Hectd4	UTSW	5	121349172	missense	possibly damaging	0.65
R1468:Hectd4	UTSW	5	121349172	missense	possibly damaging	0.65
R1545:Hectd4	UTSW	5	121323956	missense	possibly damaging	0.87
R1553:Hectd4	UTSW	5	121349259	missense	probably benign	0.00
R1572:Hectd4	UTSW	5	121301878	missense	possibly damaging	0.85
R1662:Hectd4	UTSW	5	121317245	missense	probably benign	0.01
R1705:Hectd4	UTSW	5	121298104	missense	probably benign
R1715:Hectd4	UTSW	5	121344818	missense	possibly damaging	0.85
R1728:Hectd4	UTSW	5	121301839	missense	possibly damaging	0.51
R1736:Hectd4	UTSW	5	121349530	missense	possibly damaging	0.53
R1768:Hectd4	UTSW	5	121358303	missense	possibly damaging	0.70
R1775:Hectd4	UTSW	5	121291191	splice site	probably benign
R1784:Hectd4	UTSW	5	121301839	missense	possibly damaging	0.51
R1843:Hectd4	UTSW	5	121297180	missense	possibly damaging	0.53
R1914:Hectd4	UTSW	5	121322294	missense	probably benign	0.08
R1915:Hectd4	UTSW	5	121322294	missense	probably benign	0.08
R2024:Hectd4	UTSW	5	121281918	missense	possibly damaging	0.86
R2103:Hectd4	UTSW	5	121355629	missense	probably benign	0.04
R2108:Hectd4	UTSW	5	121333424	missense	possibly damaging	0.72
R2124:Hectd4	UTSW	5	121318639	missense	probably damaging	0.97
R2150:Hectd4	UTSW	5	121253858	splice site	probably benign
R2192:Hectd4	UTSW	5	121315143	missense	possibly damaging	0.46
R2301:Hectd4	UTSW	5	121353537	missense	probably benign	0.18
R2324:Hectd4	UTSW	5	121315437	missense	probably damaging	1.00
R2331:Hectd4	UTSW	5	121320026	missense	probably benign	0.05
R2504:Hectd4	UTSW	5	121220620	missense	unknown
R2504:Hectd4	UTSW	5	121263967	missense	possibly damaging	0.73
R2904:Hectd4	UTSW	5	121292724	splice site	probably benign
R3843:Hectd4	UTSW	5	121259873	missense	possibly damaging	0.72
R3934:Hectd4	UTSW	5	121320101	critical splice donor site	probably null
R3944:Hectd4	UTSW	5	121303525	splice site	probably benign
R4133:Hectd4	UTSW	5	121277834	critical splice donor site	probably null
R4271:Hectd4	UTSW	5	121220504	small deletion	probably benign
R4413:Hectd4	UTSW	5	121350481	missense	possibly damaging	0.53
R4456:Hectd4	UTSW	5	121308271	missense	possibly damaging	0.65
R4489:Hectd4	UTSW	5	121286257	missense	possibly damaging	0.73
R4539:Hectd4	UTSW	5	121314907	nonsense	probably null
R4564:Hectd4	UTSW	5	121350431	missense	probably benign	0.33
R4582:Hectd4	UTSW	5	121286419	missense	possibly damaging	0.53
R4629:Hectd4	UTSW	5	121297203	missense	probably benign	0.01
R4633:Hectd4	UTSW	5	121349216	missense	probably benign	0.33
R4643:Hectd4	UTSW	5	121349055	missense	possibly damaging	0.53
R4679:Hectd4	UTSW	5	121325251	missense	possibly damaging	0.72
R4681:Hectd4	UTSW	5	121303615	missense	possibly damaging	0.86
R4734:Hectd4	UTSW	5	121341977	missense	possibly damaging	0.53
R4739:Hectd4	UTSW	5	121348442	missense	probably benign
R4860:Hectd4	UTSW	5	121305818	missense	probably benign	0.04
R4860:Hectd4	UTSW	5	121305818	missense	probably benign	0.04
R4869:Hectd4	UTSW	5	121322672	missense	possibly damaging	0.46
R4909:Hectd4	UTSW	5	121263891	missense	probably benign	0.18
R4922:Hectd4	UTSW	5	121359315	missense	possibly damaging	0.86
R4925:Hectd4	UTSW	5	121322690	missense	possibly damaging	0.83
R5004:Hectd4	UTSW	5	121328199	splice site	probably null
R5004:Hectd4	UTSW	5	121329565	missense	possibly damaging	0.93
R5129:Hectd4	UTSW	5	121343510	missense	possibly damaging	0.87
R5217:Hectd4	UTSW	5	121353551	missense	possibly damaging	0.53
R5267:Hectd4	UTSW	5	121344824	missense	probably benign	0.28
R5344:Hectd4	UTSW	5	121343676	missense	probably benign	0.28
R5345:Hectd4	UTSW	5	121263974	missense	possibly damaging	0.85
R5347:Hectd4	UTSW	5	121304448	missense	probably benign	0.33
R5360:Hectd4	UTSW	5	121315401	missense	possibly damaging	0.90
R5363:Hectd4	UTSW	5	121310603	missense	probably benign	0.04
R5445:Hectd4	UTSW	5	121266274	missense	probably benign	0.00
R5479:Hectd4	UTSW	5	121306948	missense	probably benign
R5507:Hectd4	UTSW	5	121281101	missense	unknown
R5552:Hectd4	UTSW	5	121342851	missense	possibly damaging	0.96
R5691:Hectd4	UTSW	5	121348815	missense	possibly damaging	0.85
R5745:Hectd4	UTSW	5	121353502	missense	possibly damaging	0.96
R5757:Hectd4	UTSW	5	121348619	missense	possibly damaging	0.72
R5845:Hectd4	UTSW	5	121307524	critical splice donor site	probably null
R5869:Hectd4	UTSW	5	121343225	critical splice donor site	probably null
R5913:Hectd4	UTSW	5	121323974	missense	possibly damaging	0.83
R5920:Hectd4	UTSW	5	121308271	missense	possibly damaging	0.65
R5943:Hectd4	UTSW	5	121322294	missense	probably benign	0.01
R6219:Hectd4	UTSW	5	121308878	missense	possibly damaging	0.92
R6250:Hectd4	UTSW	5	121339498	missense	possibly damaging	0.85
R6301:Hectd4	UTSW	5	121254220	missense	possibly damaging	0.91
R6428:Hectd4	UTSW	5	121350445	missense	possibly damaging	0.53
R6446:Hectd4	UTSW	5	121334375	missense	possibly damaging	0.86
R6453:Hectd4	UTSW	5	121350592	missense	probably damaging	1.00
R6513:Hectd4	UTSW	5	121356196	splice site	probably null
R6540:Hectd4	UTSW	5	121303571	missense	probably benign	0.33
R6706:Hectd4	UTSW	5	121320084	missense	possibly damaging	0.92
R6720:Hectd4	UTSW	5	121307381	nonsense	probably null
R6736:Hectd4	UTSW	5	121277725	missense	possibly damaging	0.86
R6776:Hectd4	UTSW	5	121353511	missense	possibly damaging	0.85
R7033:Hectd4	UTSW	5	121364568	missense	possibly damaging	0.86
R7038:Hectd4	UTSW	5	121299597	missense	possibly damaging	0.90
R7175:Hectd4	UTSW	5	121273629	missense	possibly damaging	0.85
R7180:Hectd4	UTSW	5	121308342	missense	probably benign	0.01
R7234:Hectd4	UTSW	5	121329073	missense	possibly damaging	0.53
R7253:Hectd4	UTSW	5	121314881	missense	possibly damaging	0.66
R7349:Hectd4	UTSW	5	121310663	missense	probably damaging	0.97
R7450:Hectd4	UTSW	5	121281932	missense	probably benign	0.00
R7467:Hectd4	UTSW	5	121323961	missense	possibly damaging	0.66
R7475:Hectd4	UTSW	5	121358133	splice site	probably null
R7482:Hectd4	UTSW	5	121363878	missense	possibly damaging	0.71
R7512:Hectd4	UTSW	5	121297109	missense	possibly damaging	0.72
R7525:Hectd4	UTSW	5	121343665	missense	possibly damaging	0.70
R7559:Hectd4	UTSW	5	121315510	splice site	probably null
R7560:Hectd4	UTSW	5	121254342	missense	possibly damaging	0.53
R7561:Hectd4	UTSW	5	121291225	missense	possibly damaging	0.91
R7576:Hectd4	UTSW	5	121349459	missense	possibly damaging	0.91
R7584:Hectd4	UTSW	5	121318735	missense	possibly damaging	0.83
R7648:Hectd4	UTSW	5	121254371	missense	possibly damaging	0.73
R7663:Hectd4	UTSW	5	121324031	missense	probably benign	0.06
R7692:Hectd4	UTSW	5	121321564	missense	possibly damaging	0.46
R7725:Hectd4	UTSW	5	121220617	missense	unknown
R7731:Hectd4	UTSW	5	121307014	missense	probably benign	0.00
R7732:Hectd4	UTSW	5	121336629	missense	probably benign	0.14
R7782:Hectd4	UTSW	5	121305721	missense	possibly damaging	0.53
R7854:Hectd4	UTSW	5	121329568	missense	probably benign	0.27
R7898:Hectd4	UTSW	5	121331817	missense	probably benign	0.18
R7910:Hectd4	UTSW	5	121254228	missense	possibly damaging	0.86
R7962:Hectd4	UTSW	5	121310629	missense	probably damaging	0.98
R8003:Hectd4	UTSW	5	121339518	missense	possibly damaging	0.85
R8098:Hectd4	UTSW	5	121321398	missense	possibly damaging	0.46
R8110:Hectd4	UTSW	5	121332949	missense	possibly damaging	0.96
R8118:Hectd4	UTSW	5	121286376	missense	probably benign	0.33
R8171:Hectd4	UTSW	5	121318756	missense	possibly damaging	0.82
R8234:Hectd4	UTSW	5	121339544	missense	possibly damaging	0.72
R8289:Hectd4	UTSW	5	121266361	missense	possibly damaging	0.53
R8292:Hectd4	UTSW	5	121317225	missense	possibly damaging	0.66
R8348:Hectd4	UTSW	5	121220256	start gained	probably benign
R8397:Hectd4	UTSW	5	121259894	missense	probably damaging	0.98
R8436:Hectd4	UTSW	5	121308358	missense	possibly damaging	0.90
R8436:Hectd4	UTSW	5	121343147	missense	probably benign	0.00
R8443:Hectd4	UTSW	5	121329109	missense	possibly damaging	0.72
R8448:Hectd4	UTSW	5	121220256	start gained	probably benign
R8516:Hectd4	UTSW	5	121349010	missense	possibly damaging	0.53
R8519:Hectd4	UTSW	5	121304426	nonsense	probably null
R8553:Hectd4	UTSW	5	121353598	missense	possibly damaging	0.73
R8557:Hectd4	UTSW	5	121310651	missense	possibly damaging	0.66
R8725:Hectd4	UTSW	5	121350494	missense	probably damaging	1.00
R8751:Hectd4	UTSW	5	121363775	nonsense	probably null
R8769:Hectd4	UTSW	5	121281873	missense	possibly damaging	0.53
R8803:Hectd4	UTSW	5	121323931	missense	probably benign	0.01
R8887:Hectd4	UTSW	5	121295478	missense	probably benign	0.44
R8982:Hectd4	UTSW	5	121328242	missense	probably benign	0.02
R8988:Hectd4	UTSW	5	121277756	missense	possibly damaging	0.86
R8991:Hectd4	UTSW	5	121358284	missense	probably benign	0.33
R8994:Hectd4	UTSW	5	121303566	missense	probably benign	0.33
R8995:Hectd4	UTSW	5	121254359	missense	possibly damaging	0.96
R9049:Hectd4	UTSW	5	121313892	missense	possibly damaging	0.92
R9093:Hectd4	UTSW	5	121273614	missense	probably benign	0.14
R9106:Hectd4	UTSW	5	121329556	missense	possibly damaging	0.53
R9137:Hectd4	UTSW	5	121358175	missense	possibly damaging	0.53
R9146:Hectd4	UTSW	5	121349034	missense	probably benign	0.33
R9154:Hectd4	UTSW	5	121253904	missense
R9162:Hectd4	UTSW	5	121306979	missense	possibly damaging	0.66
R9166:Hectd4	UTSW	5	121308627	missense	probably damaging	0.96
R9183:Hectd4	UTSW	5	121299488	missense	possibly damaging	0.51
R9207:Hectd4	UTSW	5	121295433	missense	possibly damaging	0.86
R9291:Hectd4	UTSW	5	121348965	missense	probably benign	0.14
R9300:Hectd4	UTSW	5	121348889	missense	probably benign	0.33
R9314:Hectd4	UTSW	5	121299645	critical splice donor site	probably null
R9381:Hectd4	UTSW	5	121334429	missense	possibly damaging	0.53
R9432:Hectd4	UTSW	5	121322801	missense	probably benign	0.01
R9491:Hectd4	UTSW	5	121314918	missense	probably damaging	0.97
R9532:Hectd4	UTSW	5	121364553	missense	probably benign	0.00
R9557:Hectd4	UTSW	5	121321554	missense	possibly damaging	0.66
R9561:Hectd4	UTSW	5	121334469	missense	possibly damaging	0.53
R9593:Hectd4	UTSW	5	121286781	nonsense	probably null
R9704:Hectd4	UTSW	5	121310681	missense	probably benign	0.00
R9705:Hectd4	UTSW	5	121310681	missense	probably benign	0.00
R9712:Hectd4	UTSW	5	121310681	missense	probably benign	0.00
R9713:Hectd4	UTSW	5	121310681	missense	probably benign	0.00
R9726:Hectd4	UTSW	5	121310681	missense	probably benign	0.00
R9732:Hectd4	UTSW	5	121254191	nonsense	probably null
R9750:Hectd4	UTSW	5	121310681	missense	probably benign	0.00
R9752:Hectd4	UTSW	5	121310681	missense	probably benign	0.00
R9752:Hectd4	UTSW	5	121334352	missense	possibly damaging	0.85
R9772:Hectd4	UTSW	5	121310681	missense	probably benign	0.00
X0026:Hectd4	UTSW	5	121349637	missense	probably benign	0.04
X0027:Hectd4	UTSW	5	121321404	missense	probably benign	0.27
Z1088:Hectd4	UTSW	5	121295503	splice site	probably null
Z1177:Hectd4	UTSW	5	121358320	missense	probably benign

Predicted Primers

PCR Primer
(F):5'- TCAATCTGCTGTCGGGAACTG -3'
(R):5'- CCTAACGCATCAATCTAGCTGC -3'

Sequencing Primer
(F):5'- AGTAAGCAGTCACTGGCTGTCAC -3'
(R):5'- ATGGGTGTGTCACACAGT -3'

Posted On

2015-12-21