Mutagenetix > Incidental Mutation

Incidental Mutation 'R4781:Srgap3'

366491

Institutional Source

Beutler Lab

Gene Symbol

Srgap3

Ensembl Gene

ENSMUSG00000030257

Gene Name

SLIT-ROBO Rho GTPase activating protein 3

Synonyms

D130026O08Rik, Arhgap14

MMRRC Submission

042415-MU

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.183) question?

Stock #

R4781 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

112717971-112947266 bp(-) (GRCm38)

Type of Mutation

intron

DNA Base Change (assembly)

A to T at 112757425 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Ref Sequence

ENSEMBL: ENSMUSP00000108794 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000088373] [ENSMUST00000113169] [ENSMUST00000131835]

AlphaFold

no structure available at present

Predicted Effect

probably benign
Transcript: ENSMUST00000088373

SMART Domains

Protein: ENSMUSP00000085712
Gene: ENSMUSG00000030257

Domain	Start	End	E-Value	Type
FCH	22	120	3.81e-16	SMART
low complexity region	172	190	N/A	INTRINSIC
coiled coil region	353	392	N/A	INTRINSIC
low complexity region	484	495	N/A	INTRINSIC
RhoGAP	517	691	7.43e-66	SMART
SH3	747	802	9.69e-15	SMART
coiled coil region	955	985	N/A	INTRINSIC
low complexity region	1025	1038	N/A	INTRINSIC
low complexity region	1053	1064	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000113169

SMART Domains

Protein: ENSMUSP00000108794
Gene: ENSMUSG00000030257

Domain	Start	End	E-Value	Type
FCH	22	120	3.81e-16	SMART
low complexity region	172	190	N/A	INTRINSIC
coiled coil region	353	392	N/A	INTRINSIC
Blast:RhoGAP	434	474	4e-11	BLAST
low complexity region	476	488	N/A	INTRINSIC
RhoGAP	493	667	7.43e-66	SMART
SH3	723	778	9.69e-15	SMART
coiled coil region	931	961	N/A	INTRINSIC
low complexity region	1001	1014	N/A	INTRINSIC
low complexity region	1029	1040	N/A	INTRINSIC

Predicted Effect

unknown
Transcript: ENSMUST00000131835
AA Change: I35N

SMART Domains

Protein: ENSMUSP00000130063
Gene: ENSMUSG00000030257
AA Change: I35N

Domain	Start	End	E-Value	Type
Blast:RhoGAP	1	33	2e-14	BLAST
transmembrane domain	69	91	N/A	INTRINSIC

Meta Mutation Damage Score

0.0898

Coding Region Coverage

1x: 99.2%
3x: 98.6%
10x: 97.2%
20x: 95.0%

Validation Efficiency

100% (74/74)

MGI Phenotype

PHENOTYPE: Mice homozygous for a knock-out allele exhibit a reduction in spine density in the brain CA1 and cortical layers IV/V. Mice homozygous for a different knock-out allele exhibit a neurodevelopment disorder with schizophrenia-related intermediate phenotypes. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 66 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2310022A10Rik	T	A	7: 27,571,651	I157N	probably damaging	Het
Adgrl3	T	C	5: 81,760,724	Y1165H	probably damaging	Het
Adra2a	A	G	19: 54,046,495	D94G	probably damaging	Het
Akr1c20	T	A	13: 4,508,175	K197*	probably null	Het
Ankrd65	C	T	4: 155,793,036	H335Y	possibly damaging	Het
Axin2	T	A	11: 108,943,856	L636Q	probably damaging	Het
BC147527	A	C	13: 120,308,162	K6T	possibly damaging	Het
Camk1g	G	T	1: 193,356,344	T90N	probably benign	Het
Cd177	C	A	7: 24,750,626	C528F	probably damaging	Het
Cntnap5a	A	T	1: 116,412,201	D730V	possibly damaging	Het
Crtap	T	C	9: 114,386,236	D195G	probably benign	Het
Csn1s2b	A	G	5: 87,819,093	S74G	possibly damaging	Het
Cyp3a16	T	C	5: 145,456,112	R128G	possibly damaging	Het
Dnah7a	A	G	1: 53,425,208	F3675L	probably benign	Het
Dram2	T	A	3: 106,571,676	W195R	probably damaging	Het
E130308A19Rik	C	T	4: 59,691,057	P297L	probably benign	Het
Eif3i	T	C	4: 129,595,273	S83G	probably benign	Het
Gabra1	G	A	11: 42,133,661	P396S	probably damaging	Het
Gipr	T	A	7: 19,157,375	Y459F	possibly damaging	Het
Gm11677	C	T	11: 111,724,711		noncoding transcript	Het
Gm6981	T	C	9: 52,002,756		noncoding transcript	Het
Grin2d	T	C	7: 45,862,481	D180G	probably damaging	Het
Hectd4	T	G	5: 121,306,107		probably null	Het
Hhat	T	C	1: 192,686,979		probably benign	Het
Hoxa6	A	G	6: 52,206,420	L215P	possibly damaging	Het
Hsf4	G	A	8: 105,274,752		probably null	Het
Igf1r	G	A	7: 68,165,199	A283T	possibly damaging	Het
Ighv15-2	A	G	12: 114,564,856	S25P	probably damaging	Het
Inpp5a	C	T	7: 139,478,005	T43I	probably benign	Het
Kmt2c	T	A	5: 25,443,825	E82V	probably damaging	Het
Lrrc31	A	G	3: 30,687,377		probably benign	Het
Mdga2	A	G	12: 66,797,622		probably null	Het
Mefv	G	A	16: 3,715,334	P358S	probably benign	Het
Mrgpra9	A	G	7: 47,235,047	F291L	possibly damaging	Het
Mtmr3	A	G	11: 4,488,435	L673P	probably benign	Het
Muc19	T	C	15: 91,903,166		noncoding transcript	Het
Myo5b	A	T	18: 74,744,681	T1584S	possibly damaging	Het
Olfr1375	A	T	11: 51,048,480	R124S	probably damaging	Het
Olfr1427	T	C	19: 12,099,367	T91A	probably benign	Het
Palld	G	T	8: 61,877,028	R272S	probably benign	Het
Pcnx3	T	A	19: 5,687,130	N144Y	probably damaging	Het
Prf1	A	G	10: 61,300,424	K160E	probably damaging	Het
Rasgrp1	G	A	2: 117,291,709	A400V	probably benign	Het
Rnf150	A	G	8: 82,864,152	Y48C	probably damaging	Het
Rpl11	G	T	4: 136,050,288	Q170K	probably benign	Het
Scin	G	A	12: 40,081,764	A257V	possibly damaging	Het
Scn7a	C	A	2: 66,703,760	A524S	possibly damaging	Het
Sim1	T	C	10: 50,983,785	L581S	probably benign	Het
Skor1	T	C	9: 63,144,459	T715A	probably benign	Het
Slc22a26	A	G	19: 7,790,135	V301A	probably benign	Het
Sorcs1	T	C	19: 50,182,681	Y923C	probably damaging	Het
Src	T	A	2: 157,467,485	M304K	possibly damaging	Het
Stard3	G	A	11: 98,372,334	E72K	possibly damaging	Het
Svep1	T	A	4: 58,070,340	N2482I	probably damaging	Het
Tbc1d23	T	C	16: 57,218,415	K20R	possibly damaging	Het
Tfip11	G	A	5: 112,333,399	E414K	probably damaging	Het
Tinag	G	T	9: 76,996,950	T397K	possibly damaging	Het
Traf7	C	G	17: 24,510,438		probably benign	Het
Trmt10b	T	A	4: 45,305,817	I164N	probably damaging	Het
Trpm1	A	G	7: 64,235,052	D827G	probably benign	Het
Ube2u	A	T	4: 100,486,658	T85S	probably benign	Het
Ulk4	T	C	9: 121,103,576	D1066G	probably benign	Het
Vmn2r72	T	A	7: 85,737,861	I832F	probably benign	Het
Yipf1	A	C	4: 107,336,158	E80D	probably benign	Het
Zfp40	T	A	17: 23,175,655	R653W	probably damaging	Het
Zxdc	A	G	6: 90,372,553	T308A	probably damaging	Het

Other mutations in Srgap3

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01324:Srgap3	APN	6	112739397	missense	probably damaging	0.98
IGL01325:Srgap3	APN	6	112775686	missense	probably damaging	1.00
IGL01608:Srgap3	APN	6	112946478	missense	probably benign	0.00
IGL01626:Srgap3	APN	6	112773648	missense	probably damaging	0.98
IGL01787:Srgap3	APN	6	112723022	missense	probably benign	0.00
IGL02698:Srgap3	APN	6	112746928	missense	probably damaging	0.98
IGL02805:Srgap3	APN	6	112727263	missense	probably damaging	0.99
IGL02813:Srgap3	APN	6	112731480	missense	probably damaging	1.00
IGL02876:Srgap3	APN	6	112771453	missense	probably damaging	1.00
IGL03264:Srgap3	APN	6	112816675	missense	probably damaging	1.00
IGL03342:Srgap3	APN	6	112775687	missense	probably damaging	1.00
R0007:Srgap3	UTSW	6	112829512	missense	probably damaging	1.00
R0371:Srgap3	UTSW	6	112771471	missense	probably damaging	0.99
R0607:Srgap3	UTSW	6	112723119	missense	probably damaging	1.00
R1628:Srgap3	UTSW	6	112739370	missense	probably damaging	0.99
R1669:Srgap3	UTSW	6	112722904	missense	probably benign	0.36
R1858:Srgap3	UTSW	6	112771518	missense	probably damaging	1.00
R1876:Srgap3	UTSW	6	112775566	missense	probably damaging	0.98
R1896:Srgap3	UTSW	6	112738997	missense	probably benign	0.11
R2159:Srgap3	UTSW	6	112771378	missense	probably damaging	0.99
R2221:Srgap3	UTSW	6	112946493	missense	probably damaging	0.98
R2862:Srgap3	UTSW	6	112722972	missense	probably damaging	0.99
R3160:Srgap3	UTSW	6	112729658	missense	probably benign	0.00
R3162:Srgap3	UTSW	6	112729658	missense	probably benign	0.00
R4092:Srgap3	UTSW	6	112723084	missense	probably benign	0.00
R4561:Srgap3	UTSW	6	112781054	missense	probably damaging	0.98
R4825:Srgap3	UTSW	6	112727310	missense	probably benign
R4887:Srgap3	UTSW	6	112746934	missense	probably damaging	1.00
R5304:Srgap3	UTSW	6	112766939	missense	probably damaging	1.00
R5556:Srgap3	UTSW	6	112739078	missense	probably damaging	0.99
R5672:Srgap3	UTSW	6	112775561	missense	probably benign
R5879:Srgap3	UTSW	6	112722846	missense	possibly damaging	0.67
R5944:Srgap3	UTSW	6	112795814	missense	possibly damaging	0.89
R6277:Srgap3	UTSW	6	112739383	missense	probably benign	0.02
R6298:Srgap3	UTSW	6	112816610	missense	probably damaging	0.98
R6407:Srgap3	UTSW	6	112723006	missense	probably damaging	0.99
R6408:Srgap3	UTSW	6	112723006	missense	probably damaging	0.99
R6797:Srgap3	UTSW	6	112829542	missense	probably damaging	1.00
R6852:Srgap3	UTSW	6	112816661	missense	probably damaging	1.00
R6965:Srgap3	UTSW	6	112723129	missense	probably damaging	1.00
R7055:Srgap3	UTSW	6	112746963	missense	probably damaging	0.97
R7067:Srgap3	UTSW	6	112757305	intron	probably benign
R7361:Srgap3	UTSW	6	112746921	missense	probably damaging	0.99
R7479:Srgap3	UTSW	6	112735833	critical splice donor site	probably null
R7606:Srgap3	UTSW	6	112739376	missense	probably benign	0.00
R7731:Srgap3	UTSW	6	112766897	missense	probably benign	0.36
R7787:Srgap3	UTSW	6	112775559	missense	probably benign	0.02
R7934:Srgap3	UTSW	6	112731489	missense	probably damaging	1.00
R8026:Srgap3	UTSW	6	112739364	missense	probably benign	0.00
R8040:Srgap3	UTSW	6	112739364	missense	probably benign	0.00
R8066:Srgap3	UTSW	6	112771378	missense	probably damaging	0.99
R8067:Srgap3	UTSW	6	112739364	missense	probably benign	0.00
R8090:Srgap3	UTSW	6	112781035	nonsense	probably null
R8151:Srgap3	UTSW	6	112816667	missense	probably damaging	1.00
R8248:Srgap3	UTSW	6	112723143	missense	probably damaging	1.00
R8365:Srgap3	UTSW	6	112816734	missense	probably damaging	1.00
R8369:Srgap3	UTSW	6	112722818	missense	probably benign
R8444:Srgap3	UTSW	6	112775548	missense	possibly damaging	0.56
R8509:Srgap3	UTSW	6	112731336	nonsense	probably null
R8772:Srgap3	UTSW	6	112766945	missense	probably damaging	1.00
R8827:Srgap3	UTSW	6	112739341	missense	probably damaging	1.00
R8881:Srgap3	UTSW	6	112723137	missense	probably benign
R9002:Srgap3	UTSW	6	112780893	missense	possibly damaging	0.76
R9041:Srgap3	UTSW	6	112777093	missense	probably damaging	0.99
R9198:Srgap3	UTSW	6	112766904	missense	probably damaging	1.00
R9404:Srgap3	UTSW	6	112729655	missense	probably benign	0.04
R9616:Srgap3	UTSW	6	112771563	missense	probably damaging	1.00
X0062:Srgap3	UTSW	6	112795786	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- CAGCTCAGCCAAGGAAAGTG -3'
(R):5'- GGGAGATGTCACGACCTATCAG -3'

Sequencing Primer
(F):5'- GCAGCCTAAGCCTTCCATC -3'
(R):5'- GATGTCACGACCTATCAGATGCAG -3'

Posted On

2015-12-21