Incidental Mutation 'R4781:Gipr'
ID366492
Institutional Source Beutler Lab
Gene Symbol Gipr
Ensembl Gene ENSMUSG00000030406
Gene Namegastric inhibitory polypeptide receptor
SynonymsLOC232937, glucose-dependent insulinotropic polypeptide receptor, LOC381853
MMRRC Submission 042415-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.071) question?
Stock #R4781 (G1)
Quality Score225
Status Validated
Chromosome7
Chromosomal Location19156061-19166127 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 19157375 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Phenylalanine at position 459 (Y459F)
Ref Sequence ENSEMBL: ENSMUSP00000092384 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000049294] [ENSMUST00000094790] [ENSMUST00000206971]
Predicted Effect probably benign
Transcript: ENSMUST00000049294
SMART Domains Protein: ENSMUSP00000037597
Gene: ENSMUSG00000040824

DomainStartEndE-ValueType
Sm 32 111 3.94e-19 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000094790
AA Change: Y459F

PolyPhen 2 Score 0.950 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000092384
Gene: ENSMUSG00000030406
AA Change: Y459F

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
HormR 53 123 6.14e-23 SMART
Pfam:7tm_2 130 384 1.3e-81 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000206857
Predicted Effect probably benign
Transcript: ENSMUST00000206971
Meta Mutation Damage Score 0.0722 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.0%
Validation Efficiency 100% (74/74)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a G-protein coupled receptor for gastric inhibitory polypeptide (GIP), which was originally identified as an activity in gut extracts that inhibited gastric acid secretion and gastrin release, but subsequently was demonstrated to stimulate insulin release in the presence of elevated glucose. Mice lacking this gene exhibit higher blood glucose levels with impaired initial insulin response after oral glucose load. Defect in this gene thus may contribute to the pathogenesis of diabetes. [provided by RefSeq, Oct 2011]
PHENOTYPE: Homozygous inactivation of this gene results in mild glucose intolerance due to impaired glucose-stimulated insulin secretion. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 66 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310022A10Rik T A 7: 27,571,651 I157N probably damaging Het
Adgrl3 T C 5: 81,760,724 Y1165H probably damaging Het
Adra2a A G 19: 54,046,495 D94G probably damaging Het
Akr1c20 T A 13: 4,508,175 K197* probably null Het
Ankrd65 C T 4: 155,793,036 H335Y possibly damaging Het
Axin2 T A 11: 108,943,856 L636Q probably damaging Het
BC147527 A C 13: 120,308,162 K6T possibly damaging Het
Camk1g G T 1: 193,356,344 T90N probably benign Het
Cd177 C A 7: 24,750,626 C528F probably damaging Het
Cntnap5a A T 1: 116,412,201 D730V possibly damaging Het
Crtap T C 9: 114,386,236 D195G probably benign Het
Csn1s2b A G 5: 87,819,093 S74G possibly damaging Het
Cyp3a16 T C 5: 145,456,112 R128G possibly damaging Het
Dnah7a A G 1: 53,425,208 F3675L probably benign Het
Dram2 T A 3: 106,571,676 W195R probably damaging Het
E130308A19Rik C T 4: 59,691,057 P297L probably benign Het
Eif3i T C 4: 129,595,273 S83G probably benign Het
Gabra1 G A 11: 42,133,661 P396S probably damaging Het
Gm11677 C T 11: 111,724,711 noncoding transcript Het
Gm6981 T C 9: 52,002,756 noncoding transcript Het
Grin2d T C 7: 45,862,481 D180G probably damaging Het
Hectd4 T G 5: 121,306,107 probably null Het
Hhat T C 1: 192,686,979 probably benign Het
Hoxa6 A G 6: 52,206,420 L215P possibly damaging Het
Hsf4 G A 8: 105,274,752 probably null Het
Igf1r G A 7: 68,165,199 A283T possibly damaging Het
Ighv15-2 A G 12: 114,564,856 S25P probably damaging Het
Inpp5a C T 7: 139,478,005 T43I probably benign Het
Kmt2c T A 5: 25,443,825 E82V probably damaging Het
Lrrc31 A G 3: 30,687,377 probably benign Het
Mdga2 A G 12: 66,797,622 probably null Het
Mefv G A 16: 3,715,334 P358S probably benign Het
Mrgpra9 A G 7: 47,235,047 F291L possibly damaging Het
Mtmr3 A G 11: 4,488,435 L673P probably benign Het
Muc19 T C 15: 91,903,166 noncoding transcript Het
Myo5b A T 18: 74,744,681 T1584S possibly damaging Het
Olfr1375 A T 11: 51,048,480 R124S probably damaging Het
Olfr1427 T C 19: 12,099,367 T91A probably benign Het
Palld G T 8: 61,877,028 R272S probably benign Het
Pcnx3 T A 19: 5,687,130 N144Y probably damaging Het
Prf1 A G 10: 61,300,424 K160E probably damaging Het
Rasgrp1 G A 2: 117,291,709 A400V probably benign Het
Rnf150 A G 8: 82,864,152 Y48C probably damaging Het
Rpl11 G T 4: 136,050,288 Q170K probably benign Het
Scin G A 12: 40,081,764 A257V possibly damaging Het
Scn7a C A 2: 66,703,760 A524S possibly damaging Het
Sim1 T C 10: 50,983,785 L581S probably benign Het
Skor1 T C 9: 63,144,459 T715A probably benign Het
Slc22a26 A G 19: 7,790,135 V301A probably benign Het
Sorcs1 T C 19: 50,182,681 Y923C probably damaging Het
Src T A 2: 157,467,485 M304K possibly damaging Het
Srgap3 A T 6: 112,757,425 probably benign Het
Stard3 G A 11: 98,372,334 E72K possibly damaging Het
Svep1 T A 4: 58,070,340 N2482I probably damaging Het
Tbc1d23 T C 16: 57,218,415 K20R possibly damaging Het
Tfip11 G A 5: 112,333,399 E414K probably damaging Het
Tinag G T 9: 76,996,950 T397K possibly damaging Het
Traf7 C G 17: 24,510,438 probably benign Het
Trmt10b T A 4: 45,305,817 I164N probably damaging Het
Trpm1 A G 7: 64,235,052 D827G probably benign Het
Ube2u A T 4: 100,486,658 T85S probably benign Het
Ulk4 T C 9: 121,103,576 D1066G probably benign Het
Vmn2r72 T A 7: 85,737,861 I832F probably benign Het
Yipf1 A C 4: 107,336,158 E80D probably benign Het
Zfp40 T A 17: 23,175,655 R653W probably damaging Het
Zxdc A G 6: 90,372,553 T308A probably damaging Het
Other mutations in Gipr
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01481:Gipr APN 7 19159506 unclassified probably benign
IGL02214:Gipr APN 7 19157546 missense possibly damaging 0.46
IGL02525:Gipr APN 7 19159765 missense possibly damaging 0.64
IGL03163:Gipr APN 7 19162556 nonsense probably null
PIT4449001:Gipr UTSW 7 19160618 missense probably benign 0.05
PIT4480001:Gipr UTSW 7 19162934 missense probably damaging 1.00
R1813:Gipr UTSW 7 19164071 missense probably benign 0.02
R1896:Gipr UTSW 7 19164071 missense probably benign 0.02
R3409:Gipr UTSW 7 19159794 missense possibly damaging 0.74
R3949:Gipr UTSW 7 19157429 missense probably benign 0.00
R4841:Gipr UTSW 7 19162676 missense probably damaging 1.00
R4842:Gipr UTSW 7 19162676 missense probably damaging 1.00
R5087:Gipr UTSW 7 19159764 missense probably damaging 1.00
R5297:Gipr UTSW 7 19157544 missense probably damaging 1.00
R5480:Gipr UTSW 7 19160654 missense probably damaging 1.00
R5763:Gipr UTSW 7 19163550 missense probably damaging 0.99
R6957:Gipr UTSW 7 19164604 missense probably benign 0.01
R7035:Gipr UTSW 7 19162884 missense probably damaging 1.00
R7254:Gipr UTSW 7 19163613 missense probably damaging 1.00
R7720:Gipr UTSW 7 19162959 missense probably benign 0.02
Predicted Primers PCR Primer
(F):5'- TGATTGTCCTAGACACCTCAATTC -3'
(R):5'- TGAGCGTGCTCTACTGCTTC -3'

Sequencing Primer
(F):5'- GACACCTCAATTCTTTTCATAAACG -3'
(R):5'- GTGCTCTACTGCTTCATCAACAAAG -3'
Posted On2015-12-21