Mutagenetix > Incidental Mutation

Incidental Mutation 'R4781:Cd177'

366493

Institutional Source

Beutler Lab

Gene Symbol

Cd177

Ensembl Gene

ENSMUSG00000052212

Gene Name

CD177 antigen

Synonyms

Pdp3, 1190003K14Rik

MMRRC Submission

042415-MU

Accession Numbers

Essential gene?

Possibly essential (E-score: 0.501) question?

Stock #

R4781 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

24743983-24760311 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

C to A at 24750626 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Cysteine to Phenylalanine at position 528 (C528F)

Ref Sequence

ENSEMBL: ENSMUSP00000064934 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000063956]

AlphaFold

Q8R2S8

Predicted Effect

probably damaging
Transcript: ENSMUST00000063956
AA Change: C528F

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000064934
Gene: ENSMUSG00000052212
AA Change: C528F

Domain	Start	End	E-Value	Type
Pfam:UPAR_LY6	134	214	3.7e-11	PFAM
Pfam:UPAR_LY6	226	300	1.2e-4	PFAM
low complexity region	301	317	N/A	INTRINSIC
Pfam:UPAR_LY6	322	400	1.5e-9	PFAM
Pfam:UPAR_LY6	511	586	9.1e-12	PFAM
Pfam:UPAR_LY6	705	782	1.4e-11	PFAM
low complexity region	795	811	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000206160

Meta Mutation Damage Score

0.6467

Coding Region Coverage

1x: 99.2%
3x: 98.6%
10x: 97.2%
20x: 95.0%

Validation Efficiency

100% (74/74)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a glycosyl-phosphatidylinositol (GPI)-linked cell surface glycoprotein that plays a role in neutrophil activation. The protein can bind platelet endothelial cell adhesion molecule-1 and function in neutrophil transmigration. Mutations in this gene are associated with myeloproliferative diseases. Over-expression of this gene has been found in patients with polycythemia rubra vera. Autoantibodies against the protein may result in pulmonary transfusion reactions, and it may be involved in Wegener's granulomatosis. A related pseudogene, which is adjacent to this gene on chromosome 19, has been identified. [provided by RefSeq, Apr 2014]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit decreased circulating neutrophils, increased neutrophil cell death and decreased neutrophils and monocytes early after S. aureus infection. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 66 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2310022A10Rik	T	A	7: 27,571,651	I157N	probably damaging	Het
Adgrl3	T	C	5: 81,760,724	Y1165H	probably damaging	Het
Adra2a	A	G	19: 54,046,495	D94G	probably damaging	Het
Akr1c20	T	A	13: 4,508,175	K197*	probably null	Het
Ankrd65	C	T	4: 155,793,036	H335Y	possibly damaging	Het
Axin2	T	A	11: 108,943,856	L636Q	probably damaging	Het
BC147527	A	C	13: 120,308,162	K6T	possibly damaging	Het
Camk1g	G	T	1: 193,356,344	T90N	probably benign	Het
Cntnap5a	A	T	1: 116,412,201	D730V	possibly damaging	Het
Crtap	T	C	9: 114,386,236	D195G	probably benign	Het
Csn1s2b	A	G	5: 87,819,093	S74G	possibly damaging	Het
Cyp3a16	T	C	5: 145,456,112	R128G	possibly damaging	Het
Dnah7a	A	G	1: 53,425,208	F3675L	probably benign	Het
Dram2	T	A	3: 106,571,676	W195R	probably damaging	Het
E130308A19Rik	C	T	4: 59,691,057	P297L	probably benign	Het
Eif3i	T	C	4: 129,595,273	S83G	probably benign	Het
Gabra1	G	A	11: 42,133,661	P396S	probably damaging	Het
Gipr	T	A	7: 19,157,375	Y459F	possibly damaging	Het
Gm11677	C	T	11: 111,724,711		noncoding transcript	Het
Gm6981	T	C	9: 52,002,756		noncoding transcript	Het
Grin2d	T	C	7: 45,862,481	D180G	probably damaging	Het
Hectd4	T	G	5: 121,306,107		probably null	Het
Hhat	T	C	1: 192,686,979		probably benign	Het
Hoxa6	A	G	6: 52,206,420	L215P	possibly damaging	Het
Hsf4	G	A	8: 105,274,752		probably null	Het
Igf1r	G	A	7: 68,165,199	A283T	possibly damaging	Het
Ighv15-2	A	G	12: 114,564,856	S25P	probably damaging	Het
Inpp5a	C	T	7: 139,478,005	T43I	probably benign	Het
Kmt2c	T	A	5: 25,443,825	E82V	probably damaging	Het
Lrrc31	A	G	3: 30,687,377		probably benign	Het
Mdga2	A	G	12: 66,797,622		probably null	Het
Mefv	G	A	16: 3,715,334	P358S	probably benign	Het
Mrgpra9	A	G	7: 47,235,047	F291L	possibly damaging	Het
Mtmr3	A	G	11: 4,488,435	L673P	probably benign	Het
Muc19	T	C	15: 91,903,166		noncoding transcript	Het
Myo5b	A	T	18: 74,744,681	T1584S	possibly damaging	Het
Olfr1375	A	T	11: 51,048,480	R124S	probably damaging	Het
Olfr1427	T	C	19: 12,099,367	T91A	probably benign	Het
Palld	G	T	8: 61,877,028	R272S	probably benign	Het
Pcnx3	T	A	19: 5,687,130	N144Y	probably damaging	Het
Prf1	A	G	10: 61,300,424	K160E	probably damaging	Het
Rasgrp1	G	A	2: 117,291,709	A400V	probably benign	Het
Rnf150	A	G	8: 82,864,152	Y48C	probably damaging	Het
Rpl11	G	T	4: 136,050,288	Q170K	probably benign	Het
Scin	G	A	12: 40,081,764	A257V	possibly damaging	Het
Scn7a	C	A	2: 66,703,760	A524S	possibly damaging	Het
Sim1	T	C	10: 50,983,785	L581S	probably benign	Het
Skor1	T	C	9: 63,144,459	T715A	probably benign	Het
Slc22a26	A	G	19: 7,790,135	V301A	probably benign	Het
Sorcs1	T	C	19: 50,182,681	Y923C	probably damaging	Het
Src	T	A	2: 157,467,485	M304K	possibly damaging	Het
Srgap3	A	T	6: 112,757,425		probably benign	Het
Stard3	G	A	11: 98,372,334	E72K	possibly damaging	Het
Svep1	T	A	4: 58,070,340	N2482I	probably damaging	Het
Tbc1d23	T	C	16: 57,218,415	K20R	possibly damaging	Het
Tfip11	G	A	5: 112,333,399	E414K	probably damaging	Het
Tinag	G	T	9: 76,996,950	T397K	possibly damaging	Het
Traf7	C	G	17: 24,510,438		probably benign	Het
Trmt10b	T	A	4: 45,305,817	I164N	probably damaging	Het
Trpm1	A	G	7: 64,235,052	D827G	probably benign	Het
Ube2u	A	T	4: 100,486,658	T85S	probably benign	Het
Ulk4	T	C	9: 121,103,576	D1066G	probably benign	Het
Vmn2r72	T	A	7: 85,737,861	I832F	probably benign	Het
Yipf1	A	C	4: 107,336,158	E80D	probably benign	Het
Zfp40	T	A	17: 23,175,655	R653W	probably damaging	Het
Zxdc	A	G	6: 90,372,553	T308A	probably damaging	Het

Other mutations in Cd177

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00425:Cd177	APN	7	24759751	missense	possibly damaging	0.59
IGL00479:Cd177	APN	7	24758015	missense	probably benign	0.05
IGL00673:Cd177	APN	7	24752017	missense	possibly damaging	0.78
IGL00913:Cd177	APN	7	24756195	missense	probably damaging	1.00
IGL01445:Cd177	APN	7	24752071	missense	possibly damaging	0.95
IGL02021:Cd177	APN	7	24745206	missense	probably benign	0.16
IGL02134:Cd177	APN	7	24752352	missense	probably benign	0.01
IGL02532:Cd177	APN	7	24745249	missense	probably benign	0.30
IGL02821:Cd177	APN	7	24744393	missense	probably damaging	1.00
IGL02821:Cd177	APN	7	24744394	missense	probably damaging	1.00
IGL02888:Cd177	APN	7	24758437	missense	probably damaging	0.99
R0506:Cd177	UTSW	7	24758356	missense	probably damaging	1.00
R0601:Cd177	UTSW	7	24752313	missense	probably benign	0.00
R0631:Cd177	UTSW	7	24756686	missense	probably benign	0.03
R0713:Cd177	UTSW	7	24744430	missense	probably benign	0.25
R1595:Cd177	UTSW	7	24744964	missense	probably benign
R1659:Cd177	UTSW	7	24746137	missense	probably damaging	1.00
R2258:Cd177	UTSW	7	24756236	missense	possibly damaging	0.73
R2260:Cd177	UTSW	7	24756236	missense	possibly damaging	0.73
R2379:Cd177	UTSW	7	24758043	missense	possibly damaging	0.80
R2763:Cd177	UTSW	7	24758037	missense	probably benign	0.05
R2929:Cd177	UTSW	7	24754279	nonsense	probably null
R3815:Cd177	UTSW	7	24754392	missense	probably benign	0.00
R3818:Cd177	UTSW	7	24754392	missense	probably benign	0.00
R3919:Cd177	UTSW	7	24744433	missense	probably benign	0.15
R4300:Cd177	UTSW	7	24750420	missense	possibly damaging	0.48
R4494:Cd177	UTSW	7	24752003	missense	probably benign	0.06
R4819:Cd177	UTSW	7	24752271	missense	probably damaging	1.00
R5062:Cd177	UTSW	7	24744316	missense	probably benign	0.03
R5186:Cd177	UTSW	7	24744923	missense	probably benign	0.31
R5285:Cd177	UTSW	7	24746249	missense	probably benign	0.00
R5415:Cd177	UTSW	7	24752391	missense	probably damaging	1.00
R5577:Cd177	UTSW	7	24745137	missense	probably damaging	1.00
R5637:Cd177	UTSW	7	24756323	missense	probably benign	0.01
R5673:Cd177	UTSW	7	24750362	missense	probably damaging	1.00
R5731:Cd177	UTSW	7	24744421	missense	probably damaging	1.00
R5775:Cd177	UTSW	7	24752268	missense	probably damaging	1.00
R5840:Cd177	UTSW	7	24758070	missense	probably damaging	0.99
R5870:Cd177	UTSW	7	24756332	missense	probably benign	0.00
R5872:Cd177	UTSW	7	24752263	missense	probably null	1.00
R6148:Cd177	UTSW	7	24744273	nonsense	probably null
R6505:Cd177	UTSW	7	24744246	missense	probably benign	0.00
R6897:Cd177	UTSW	7	24745074	missense	probably benign	0.31
R7023:Cd177	UTSW	7	24759762	missense	probably benign	0.44
R7088:Cd177	UTSW	7	24745133	nonsense	probably null
R7188:Cd177	UTSW	7	24756647	missense	probably damaging	1.00
R7366:Cd177	UTSW	7	24756722	missense	probably damaging	1.00
R7744:Cd177	UTSW	7	24750375	missense	probably damaging	1.00
R8008:Cd177	UTSW	7	24752349	missense	not run
R8029:Cd177	UTSW	7	24756169	nonsense	probably null
R8030:Cd177	UTSW	7	24756169	nonsense	probably null
R8032:Cd177	UTSW	7	24756169	nonsense	probably null
R8094:Cd177	UTSW	7	24744417	missense	probably damaging	0.99
R8121:Cd177	UTSW	7	24759642	missense	probably benign
R8192:Cd177	UTSW	7	24754302	missense	probably benign	0.00
R8314:Cd177	UTSW	7	24750588	missense	probably benign	0.15
R8682:Cd177	UTSW	7	24760013	missense	possibly damaging	0.92
R8730:Cd177	UTSW	7	24758076	missense	possibly damaging	0.89
R9185:Cd177	UTSW	7	24744243	missense	probably benign	0.00
R9217:Cd177	UTSW	7	24746125	missense	possibly damaging	0.93
R9335:Cd177	UTSW	7	24744286	missense	probably benign	0.04
R9595:Cd177	UTSW	7	24752337	missense	probably damaging	1.00
R9796:Cd177	UTSW	7	24759744	missense	probably benign
Z1176:Cd177	UTSW	7	24746171	missense	probably benign	0.01
Z1177:Cd177	UTSW	7	24760256	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- TGCACCTTCAGATCAGAGATGATC -3'
(R):5'- GGCTCCTTAGAGAGACTGAAGC -3'

Sequencing Primer
(F):5'- GATCAGAGATGATCCCTCCTAGG -3'
(R):5'- CCTTAGAGAGACTGAAGCGTGTTG -3'

Posted On

2015-12-21