Incidental Mutation 'R4781:Grin2d'
ID366495
Institutional Source Beutler Lab
Gene Symbol Grin2d
Ensembl Gene ENSMUSG00000002771
Gene Nameglutamate receptor, ionotropic, NMDA2D (epsilon 4)
SynonymsNR2D, GluRepsilon4, NMDAR2D, GluN2D
MMRRC Submission 042415-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.612) question?
Stock #R4781 (G1)
Quality Score225
Status Validated
Chromosome7
Chromosomal Location45831883-45878378 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 45862481 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 180 (D180G)
Ref Sequence ENSEMBL: ENSMUSP00000147663 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000002848] [ENSMUST00000211250] [ENSMUST00000211713]
Predicted Effect probably damaging
Transcript: ENSMUST00000002848
AA Change: D180G

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000002848
Gene: ENSMUSG00000002771
AA Change: D180G

DomainStartEndE-ValueType
signal peptide 1 25 N/A INTRINSIC
low complexity region 33 47 N/A INTRINSIC
low complexity region 60 73 N/A INTRINSIC
Pfam:ANF_receptor 89 330 1.7e-12 PFAM
PBPe 428 823 4.11e-65 SMART
Lig_chan-Glu_bd 471 527 7.88e-18 SMART
transmembrane domain 843 862 N/A INTRINSIC
low complexity region 896 931 N/A INTRINSIC
low complexity region 932 943 N/A INTRINSIC
low complexity region 969 1001 N/A INTRINSIC
low complexity region 1011 1039 N/A INTRINSIC
low complexity region 1065 1091 N/A INTRINSIC
low complexity region 1095 1120 N/A INTRINSIC
low complexity region 1192 1247 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000211250
Predicted Effect probably damaging
Transcript: ENSMUST00000211713
AA Change: D180G

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
Meta Mutation Damage Score 0.1751 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.0%
Validation Efficiency 100% (74/74)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] N-methyl-D-aspartate (NMDA) receptors are a class of ionotropic glutamate receptors. NMDA channel has been shown to be involved in long-term potentiation, an activity-dependent increase in the efficiency of synaptic transmission thought to underlie certain kinds of memory and learning. NMDA receptor channels are heteromers composed of the key receptor subunit NMDAR1 (GRIN1) and 1 or more of the 4 NMDAR2 subunits: NMDAR2A (GRIN2A), NMDAR2B (GRIN2B), NMDAR2C (GRIN2C), and NMDAR2D (GRIN2D). [provided by RefSeq, Mar 2010]
PHENOTYPE: Homozygotes for a targeted null mutation exhibit reduced spontaneous activity and an elevated auditory brainstem response threshold. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 66 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310022A10Rik T A 7: 27,571,651 I157N probably damaging Het
Adgrl3 T C 5: 81,760,724 Y1165H probably damaging Het
Adra2a A G 19: 54,046,495 D94G probably damaging Het
Akr1c20 T A 13: 4,508,175 K197* probably null Het
Ankrd65 C T 4: 155,793,036 H335Y possibly damaging Het
Axin2 T A 11: 108,943,856 L636Q probably damaging Het
BC147527 A C 13: 120,308,162 K6T possibly damaging Het
Camk1g G T 1: 193,356,344 T90N probably benign Het
Cd177 C A 7: 24,750,626 C528F probably damaging Het
Cntnap5a A T 1: 116,412,201 D730V possibly damaging Het
Crtap T C 9: 114,386,236 D195G probably benign Het
Csn1s2b A G 5: 87,819,093 S74G possibly damaging Het
Cyp3a16 T C 5: 145,456,112 R128G possibly damaging Het
Dnah7a A G 1: 53,425,208 F3675L probably benign Het
Dram2 T A 3: 106,571,676 W195R probably damaging Het
E130308A19Rik C T 4: 59,691,057 P297L probably benign Het
Eif3i T C 4: 129,595,273 S83G probably benign Het
Gabra1 G A 11: 42,133,661 P396S probably damaging Het
Gipr T A 7: 19,157,375 Y459F possibly damaging Het
Gm11677 C T 11: 111,724,711 noncoding transcript Het
Gm6981 T C 9: 52,002,756 noncoding transcript Het
Hectd4 T G 5: 121,306,107 probably null Het
Hhat T C 1: 192,686,979 probably benign Het
Hoxa6 A G 6: 52,206,420 L215P possibly damaging Het
Hsf4 G A 8: 105,274,752 probably null Het
Igf1r G A 7: 68,165,199 A283T possibly damaging Het
Ighv15-2 A G 12: 114,564,856 S25P probably damaging Het
Inpp5a C T 7: 139,478,005 T43I probably benign Het
Kmt2c T A 5: 25,443,825 E82V probably damaging Het
Lrrc31 A G 3: 30,687,377 probably benign Het
Mdga2 A G 12: 66,797,622 probably null Het
Mefv G A 16: 3,715,334 P358S probably benign Het
Mrgpra9 A G 7: 47,235,047 F291L possibly damaging Het
Mtmr3 A G 11: 4,488,435 L673P probably benign Het
Muc19 T C 15: 91,903,166 noncoding transcript Het
Myo5b A T 18: 74,744,681 T1584S possibly damaging Het
Olfr1375 A T 11: 51,048,480 R124S probably damaging Het
Olfr1427 T C 19: 12,099,367 T91A probably benign Het
Palld G T 8: 61,877,028 R272S probably benign Het
Pcnx3 T A 19: 5,687,130 N144Y probably damaging Het
Prf1 A G 10: 61,300,424 K160E probably damaging Het
Rasgrp1 G A 2: 117,291,709 A400V probably benign Het
Rnf150 A G 8: 82,864,152 Y48C probably damaging Het
Rpl11 G T 4: 136,050,288 Q170K probably benign Het
Scin G A 12: 40,081,764 A257V possibly damaging Het
Scn7a C A 2: 66,703,760 A524S possibly damaging Het
Sim1 T C 10: 50,983,785 L581S probably benign Het
Skor1 T C 9: 63,144,459 T715A probably benign Het
Slc22a26 A G 19: 7,790,135 V301A probably benign Het
Sorcs1 T C 19: 50,182,681 Y923C probably damaging Het
Src T A 2: 157,467,485 M304K possibly damaging Het
Srgap3 A T 6: 112,757,425 probably benign Het
Stard3 G A 11: 98,372,334 E72K possibly damaging Het
Svep1 T A 4: 58,070,340 N2482I probably damaging Het
Tbc1d23 T C 16: 57,218,415 K20R possibly damaging Het
Tfip11 G A 5: 112,333,399 E414K probably damaging Het
Tinag G T 9: 76,996,950 T397K possibly damaging Het
Traf7 C G 17: 24,510,438 probably benign Het
Trmt10b T A 4: 45,305,817 I164N probably damaging Het
Trpm1 A G 7: 64,235,052 D827G probably benign Het
Ube2u A T 4: 100,486,658 T85S probably benign Het
Ulk4 T C 9: 121,103,576 D1066G probably benign Het
Vmn2r72 T A 7: 85,737,861 I832F probably benign Het
Yipf1 A C 4: 107,336,158 E80D probably benign Het
Zfp40 T A 17: 23,175,655 R653W probably damaging Het
Zxdc A G 6: 90,372,553 T308A probably damaging Het
Other mutations in Grin2d
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01097:Grin2d APN 7 45853292 missense probably damaging 0.99
IGL01772:Grin2d APN 7 45858466 missense probably benign 0.00
IGL01952:Grin2d APN 7 45862280 missense probably benign 0.23
IGL01994:Grin2d APN 7 45857972 missense probably damaging 1.00
IGL02161:Grin2d APN 7 45854422 missense possibly damaging 0.82
IGL03180:Grin2d APN 7 45853329 missense probably damaging 1.00
R1121:Grin2d UTSW 7 45854347 missense probably damaging 1.00
R1934:Grin2d UTSW 7 45856827 missense probably damaging 1.00
R2915:Grin2d UTSW 7 45833357 unclassified probably benign
R4162:Grin2d UTSW 7 45857618 missense probably damaging 0.98
R4753:Grin2d UTSW 7 45833906 missense probably damaging 0.98
R4785:Grin2d UTSW 7 45856781 missense probably damaging 0.96
R4820:Grin2d UTSW 7 45857939 missense probably damaging 1.00
R4877:Grin2d UTSW 7 45854615 missense probably damaging 1.00
R4979:Grin2d UTSW 7 45857933 missense probably benign 0.03
R5092:Grin2d UTSW 7 45854268 missense probably damaging 1.00
R6364:Grin2d UTSW 7 45858454 missense possibly damaging 0.54
R6565:Grin2d UTSW 7 45834755 missense probably damaging 1.00
R6747:Grin2d UTSW 7 45862268 missense probably damaging 0.99
R6816:Grin2d UTSW 7 45833682 unclassified probably benign
R7072:Grin2d UTSW 7 45857498 missense probably damaging 1.00
R7237:Grin2d UTSW 7 45866176 nonsense probably null
R7243:Grin2d UTSW 7 45866128 missense probably damaging 1.00
R7385:Grin2d UTSW 7 45857536 missense probably damaging 1.00
R7577:Grin2d UTSW 7 45862379 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- ATCTGCGCACTGACACTACG -3'
(R):5'- ATGTGGCTAAACATGACCTAGAG -3'

Sequencing Primer
(F):5'- ACTGACACTACGGAGCTGTG -3'
(R):5'- TGACCTAGAGGAAGCCAGTACC -3'
Posted On2015-12-21