Mutagenetix > Incidental Mutation

Incidental Mutation 'R4781:Grin2d'

366495

Institutional Source

Beutler Lab

Gene Symbol

Grin2d

Ensembl Gene

ENSMUSG00000002771

Gene Name

glutamate receptor, ionotropic, NMDA2D (epsilon 4)

Synonyms

NR2D, GluRepsilon4, NMDAR2D, GluN2D

MMRRC Submission

042415-MU

Accession Numbers

Essential gene?

Possibly essential (E-score: 0.587) question?

Stock #

R4781 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

45831883-45878378 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 45862481 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Aspartic acid to Glycine at position 180 (D180G)

Ref Sequence

ENSEMBL: ENSMUSP00000147663 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000002848] [ENSMUST00000211250] [ENSMUST00000211713]

AlphaFold

Q03391

Predicted Effect

probably damaging
Transcript: ENSMUST00000002848
AA Change: D180G

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000002848
Gene: ENSMUSG00000002771
AA Change: D180G

Domain	Start	End	E-Value	Type
signal peptide	1	25	N/A	INTRINSIC
low complexity region	33	47	N/A	INTRINSIC
low complexity region	60	73	N/A	INTRINSIC
Pfam:ANF_receptor	89	330	1.7e-12	PFAM
PBPe	428	823	4.11e-65	SMART
Lig_chan-Glu_bd	471	527	7.88e-18	SMART
transmembrane domain	843	862	N/A	INTRINSIC
low complexity region	896	931	N/A	INTRINSIC
low complexity region	932	943	N/A	INTRINSIC
low complexity region	969	1001	N/A	INTRINSIC
low complexity region	1011	1039	N/A	INTRINSIC
low complexity region	1065	1091	N/A	INTRINSIC
low complexity region	1095	1120	N/A	INTRINSIC
low complexity region	1192	1247	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000211250

Predicted Effect

probably damaging
Transcript: ENSMUST00000211713
AA Change: D180G

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

Meta Mutation Damage Score

0.1751

Coding Region Coverage

1x: 99.2%
3x: 98.6%
10x: 97.2%
20x: 95.0%

Validation Efficiency

100% (74/74)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] N-methyl-D-aspartate (NMDA) receptors are a class of ionotropic glutamate receptors. NMDA channel has been shown to be involved in long-term potentiation, an activity-dependent increase in the efficiency of synaptic transmission thought to underlie certain kinds of memory and learning. NMDA receptor channels are heteromers composed of the key receptor subunit NMDAR1 (GRIN1) and 1 or more of the 4 NMDAR2 subunits: NMDAR2A (GRIN2A), NMDAR2B (GRIN2B), NMDAR2C (GRIN2C), and NMDAR2D (GRIN2D). [provided by RefSeq, Mar 2010]
PHENOTYPE: Homozygotes for a targeted null mutation exhibit reduced spontaneous activity and an elevated auditory brainstem response threshold. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 66 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2310022A10Rik	T	A	7: 27,571,651	I157N	probably damaging	Het
Adgrl3	T	C	5: 81,760,724	Y1165H	probably damaging	Het
Adra2a	A	G	19: 54,046,495	D94G	probably damaging	Het
Akr1c20	T	A	13: 4,508,175	K197*	probably null	Het
Ankrd65	C	T	4: 155,793,036	H335Y	possibly damaging	Het
Axin2	T	A	11: 108,943,856	L636Q	probably damaging	Het
BC147527	A	C	13: 120,308,162	K6T	possibly damaging	Het
Camk1g	G	T	1: 193,356,344	T90N	probably benign	Het
Cd177	C	A	7: 24,750,626	C528F	probably damaging	Het
Cntnap5a	A	T	1: 116,412,201	D730V	possibly damaging	Het
Crtap	T	C	9: 114,386,236	D195G	probably benign	Het
Csn1s2b	A	G	5: 87,819,093	S74G	possibly damaging	Het
Cyp3a16	T	C	5: 145,456,112	R128G	possibly damaging	Het
Dnah7a	A	G	1: 53,425,208	F3675L	probably benign	Het
Dram2	T	A	3: 106,571,676	W195R	probably damaging	Het
E130308A19Rik	C	T	4: 59,691,057	P297L	probably benign	Het
Eif3i	T	C	4: 129,595,273	S83G	probably benign	Het
Gabra1	G	A	11: 42,133,661	P396S	probably damaging	Het
Gipr	T	A	7: 19,157,375	Y459F	possibly damaging	Het
Gm11677	C	T	11: 111,724,711		noncoding transcript	Het
Gm6981	T	C	9: 52,002,756		noncoding transcript	Het
Hectd4	T	G	5: 121,306,107		probably null	Het
Hhat	T	C	1: 192,686,979		probably benign	Het
Hoxa6	A	G	6: 52,206,420	L215P	possibly damaging	Het
Hsf4	G	A	8: 105,274,752		probably null	Het
Igf1r	G	A	7: 68,165,199	A283T	possibly damaging	Het
Ighv15-2	A	G	12: 114,564,856	S25P	probably damaging	Het
Inpp5a	C	T	7: 139,478,005	T43I	probably benign	Het
Kmt2c	T	A	5: 25,443,825	E82V	probably damaging	Het
Lrrc31	A	G	3: 30,687,377		probably benign	Het
Mdga2	A	G	12: 66,797,622		probably null	Het
Mefv	G	A	16: 3,715,334	P358S	probably benign	Het
Mrgpra9	A	G	7: 47,235,047	F291L	possibly damaging	Het
Mtmr3	A	G	11: 4,488,435	L673P	probably benign	Het
Muc19	T	C	15: 91,903,166		noncoding transcript	Het
Myo5b	A	T	18: 74,744,681	T1584S	possibly damaging	Het
Olfr1375	A	T	11: 51,048,480	R124S	probably damaging	Het
Olfr1427	T	C	19: 12,099,367	T91A	probably benign	Het
Palld	G	T	8: 61,877,028	R272S	probably benign	Het
Pcnx3	T	A	19: 5,687,130	N144Y	probably damaging	Het
Prf1	A	G	10: 61,300,424	K160E	probably damaging	Het
Rasgrp1	G	A	2: 117,291,709	A400V	probably benign	Het
Rnf150	A	G	8: 82,864,152	Y48C	probably damaging	Het
Rpl11	G	T	4: 136,050,288	Q170K	probably benign	Het
Scin	G	A	12: 40,081,764	A257V	possibly damaging	Het
Scn7a	C	A	2: 66,703,760	A524S	possibly damaging	Het
Sim1	T	C	10: 50,983,785	L581S	probably benign	Het
Skor1	T	C	9: 63,144,459	T715A	probably benign	Het
Slc22a26	A	G	19: 7,790,135	V301A	probably benign	Het
Sorcs1	T	C	19: 50,182,681	Y923C	probably damaging	Het
Src	T	A	2: 157,467,485	M304K	possibly damaging	Het
Srgap3	A	T	6: 112,757,425		probably benign	Het
Stard3	G	A	11: 98,372,334	E72K	possibly damaging	Het
Svep1	T	A	4: 58,070,340	N2482I	probably damaging	Het
Tbc1d23	T	C	16: 57,218,415	K20R	possibly damaging	Het
Tfip11	G	A	5: 112,333,399	E414K	probably damaging	Het
Tinag	G	T	9: 76,996,950	T397K	possibly damaging	Het
Traf7	C	G	17: 24,510,438		probably benign	Het
Trmt10b	T	A	4: 45,305,817	I164N	probably damaging	Het
Trpm1	A	G	7: 64,235,052	D827G	probably benign	Het
Ube2u	A	T	4: 100,486,658	T85S	probably benign	Het
Ulk4	T	C	9: 121,103,576	D1066G	probably benign	Het
Vmn2r72	T	A	7: 85,737,861	I832F	probably benign	Het
Yipf1	A	C	4: 107,336,158	E80D	probably benign	Het
Zfp40	T	A	17: 23,175,655	R653W	probably damaging	Het
Zxdc	A	G	6: 90,372,553	T308A	probably damaging	Het

Other mutations in Grin2d

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01097:Grin2d	APN	7	45853292	missense	probably damaging	0.99
IGL01772:Grin2d	APN	7	45858466	missense	probably benign	0.00
IGL01952:Grin2d	APN	7	45862280	missense	probably benign	0.23
IGL01994:Grin2d	APN	7	45857972	missense	probably damaging	1.00
IGL02161:Grin2d	APN	7	45854422	missense	possibly damaging	0.82
IGL03180:Grin2d	APN	7	45853329	missense	probably damaging	1.00
R1121:Grin2d	UTSW	7	45854347	missense	probably damaging	1.00
R1934:Grin2d	UTSW	7	45856827	missense	probably damaging	1.00
R2915:Grin2d	UTSW	7	45833357	unclassified	probably benign
R4162:Grin2d	UTSW	7	45857618	missense	probably damaging	0.98
R4753:Grin2d	UTSW	7	45833906	missense	probably damaging	0.98
R4785:Grin2d	UTSW	7	45856781	missense	probably damaging	0.96
R4820:Grin2d	UTSW	7	45857939	missense	probably damaging	1.00
R4877:Grin2d	UTSW	7	45854615	missense	probably damaging	1.00
R4979:Grin2d	UTSW	7	45857933	missense	probably benign	0.03
R5092:Grin2d	UTSW	7	45854268	missense	probably damaging	1.00
R6364:Grin2d	UTSW	7	45858454	missense	possibly damaging	0.54
R6565:Grin2d	UTSW	7	45834755	missense	probably damaging	1.00
R6747:Grin2d	UTSW	7	45862268	missense	probably damaging	0.99
R6816:Grin2d	UTSW	7	45833682	unclassified	probably benign
R7072:Grin2d	UTSW	7	45857498	missense	probably damaging	1.00
R7237:Grin2d	UTSW	7	45866176	nonsense	probably null
R7243:Grin2d	UTSW	7	45866128	missense	probably damaging	1.00
R7385:Grin2d	UTSW	7	45857536	missense	probably damaging	1.00
R7577:Grin2d	UTSW	7	45862379	missense	probably benign	0.01
R8100:Grin2d	UTSW	7	45833747	missense	unknown
R8179:Grin2d	UTSW	7	45858028	nonsense	probably null
R8877:Grin2d	UTSW	7	45854275	missense	probably damaging	1.00
R8988:Grin2d	UTSW	7	45834001	nonsense	probably null
R9179:Grin2d	UTSW	7	45856752	missense	probably damaging	1.00
R9643:Grin2d	UTSW	7	45857524	missense	possibly damaging	0.62
Z1177:Grin2d	UTSW	7	45833177	missense	unknown

Predicted Primers

PCR Primer
(F):5'- ATCTGCGCACTGACACTACG -3'
(R):5'- ATGTGGCTAAACATGACCTAGAG -3'

Sequencing Primer
(F):5'- ACTGACACTACGGAGCTGTG -3'
(R):5'- TGACCTAGAGGAAGCCAGTACC -3'

Posted On

2015-12-21