Incidental Mutation 'R4781:Igf1r'
ID366498
Institutional Source Beutler Lab
Gene Symbol Igf1r
Ensembl Gene ENSMUSG00000005533
Gene Nameinsulin-like growth factor I receptor
Synonymsline 186, A330103N21Rik, CD221, hyft, IGF-1R
MMRRC Submission 042415-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R4781 (G1)
Quality Score206
Status Validated
Chromosome7
Chromosomal Location67952827-68233668 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 68165199 bp
ZygosityHeterozygous
Amino Acid Change Alanine to Threonine at position 283 (A283T)
Ref Sequence ENSEMBL: ENSMUSP00000005671 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000005671]
Predicted Effect possibly damaging
Transcript: ENSMUST00000005671
AA Change: A283T

PolyPhen 2 Score 0.753 (Sensitivity: 0.85; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000005671
Gene: ENSMUSG00000005533
AA Change: A283T

DomainStartEndE-ValueType
Pfam:Recep_L_domain 51 161 1.6e-29 PFAM
FU 227 270 2.98e-12 SMART
Pfam:Recep_L_domain 353 467 3.8e-32 PFAM
FN3 490 593 4.67e-2 SMART
FN3 612 815 1.95e-4 SMART
FN3 833 915 7.4e-5 SMART
low complexity region 937 954 N/A INTRINSIC
TyrKc 1000 1268 8.51e-141 SMART
low complexity region 1285 1303 N/A INTRINSIC
low complexity region 1306 1319 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000207621
Meta Mutation Damage Score 0.1001 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.0%
Validation Efficiency 100% (74/74)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This receptor binds insulin-like growth factor with a high affinity. It has tyrosine kinase activity. The insulin-like growth factor I receptor plays a critical role in transformation events. Cleavage of the precursor generates alpha and beta subunits. It is highly overexpressed in most malignant tissues where it functions as an anti-apoptotic agent by enhancing cell survival. Alternatively spliced transcript variants encoding distinct isoforms have been found for this gene. [provided by RefSeq, May 2014]
PHENOTYPE: Targeted null mutants die at birth of respiratory failure; fetuses exhibit retarded growth, organ hypoplasia, ossification delay and nervous system and epidermal abnormalities. hyft homozygous fetuses are growth retarded and exhibit hydrops fetalis and focal hepatic ischemia. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 66 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310022A10Rik T A 7: 27,571,651 I157N probably damaging Het
Adgrl3 T C 5: 81,760,724 Y1165H probably damaging Het
Adra2a A G 19: 54,046,495 D94G probably damaging Het
Akr1c20 T A 13: 4,508,175 K197* probably null Het
Ankrd65 C T 4: 155,793,036 H335Y possibly damaging Het
Axin2 T A 11: 108,943,856 L636Q probably damaging Het
BC147527 A C 13: 120,308,162 K6T possibly damaging Het
Camk1g G T 1: 193,356,344 T90N probably benign Het
Cd177 C A 7: 24,750,626 C528F probably damaging Het
Cntnap5a A T 1: 116,412,201 D730V possibly damaging Het
Crtap T C 9: 114,386,236 D195G probably benign Het
Csn1s2b A G 5: 87,819,093 S74G possibly damaging Het
Cyp3a16 T C 5: 145,456,112 R128G possibly damaging Het
Dnah7a A G 1: 53,425,208 F3675L probably benign Het
Dram2 T A 3: 106,571,676 W195R probably damaging Het
E130308A19Rik C T 4: 59,691,057 P297L probably benign Het
Eif3i T C 4: 129,595,273 S83G probably benign Het
Gabra1 G A 11: 42,133,661 P396S probably damaging Het
Gipr T A 7: 19,157,375 Y459F possibly damaging Het
Gm11677 C T 11: 111,724,711 noncoding transcript Het
Gm6981 T C 9: 52,002,756 noncoding transcript Het
Grin2d T C 7: 45,862,481 D180G probably damaging Het
Hectd4 T G 5: 121,306,107 probably null Het
Hhat T C 1: 192,686,979 probably benign Het
Hoxa6 A G 6: 52,206,420 L215P possibly damaging Het
Hsf4 G A 8: 105,274,752 probably null Het
Ighv15-2 A G 12: 114,564,856 S25P probably damaging Het
Inpp5a C T 7: 139,478,005 T43I probably benign Het
Kmt2c T A 5: 25,443,825 E82V probably damaging Het
Lrrc31 A G 3: 30,687,377 probably benign Het
Mdga2 A G 12: 66,797,622 probably null Het
Mefv G A 16: 3,715,334 P358S probably benign Het
Mrgpra9 A G 7: 47,235,047 F291L possibly damaging Het
Mtmr3 A G 11: 4,488,435 L673P probably benign Het
Muc19 T C 15: 91,903,166 noncoding transcript Het
Myo5b A T 18: 74,744,681 T1584S possibly damaging Het
Olfr1375 A T 11: 51,048,480 R124S probably damaging Het
Olfr1427 T C 19: 12,099,367 T91A probably benign Het
Palld G T 8: 61,877,028 R272S probably benign Het
Pcnx3 T A 19: 5,687,130 N144Y probably damaging Het
Prf1 A G 10: 61,300,424 K160E probably damaging Het
Rasgrp1 G A 2: 117,291,709 A400V probably benign Het
Rnf150 A G 8: 82,864,152 Y48C probably damaging Het
Rpl11 G T 4: 136,050,288 Q170K probably benign Het
Scin G A 12: 40,081,764 A257V possibly damaging Het
Scn7a C A 2: 66,703,760 A524S possibly damaging Het
Sim1 T C 10: 50,983,785 L581S probably benign Het
Skor1 T C 9: 63,144,459 T715A probably benign Het
Slc22a26 A G 19: 7,790,135 V301A probably benign Het
Sorcs1 T C 19: 50,182,681 Y923C probably damaging Het
Src T A 2: 157,467,485 M304K possibly damaging Het
Srgap3 A T 6: 112,757,425 probably benign Het
Stard3 G A 11: 98,372,334 E72K possibly damaging Het
Svep1 T A 4: 58,070,340 N2482I probably damaging Het
Tbc1d23 T C 16: 57,218,415 K20R possibly damaging Het
Tfip11 G A 5: 112,333,399 E414K probably damaging Het
Tinag G T 9: 76,996,950 T397K possibly damaging Het
Traf7 C G 17: 24,510,438 probably benign Het
Trmt10b T A 4: 45,305,817 I164N probably damaging Het
Trpm1 A G 7: 64,235,052 D827G probably benign Het
Ube2u A T 4: 100,486,658 T85S probably benign Het
Ulk4 T C 9: 121,103,576 D1066G probably benign Het
Vmn2r72 T A 7: 85,737,861 I832F probably benign Het
Yipf1 A C 4: 107,336,158 E80D probably benign Het
Zfp40 T A 17: 23,175,655 R653W probably damaging Het
Zxdc A G 6: 90,372,553 T308A probably damaging Het
Other mutations in Igf1r
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00742:Igf1r APN 7 68190023 missense probably benign
IGL00837:Igf1r APN 7 68201352 splice site probably benign
IGL01515:Igf1r APN 7 68207452 missense probably damaging 1.00
IGL01572:Igf1r APN 7 68193441 missense probably benign 0.01
IGL02100:Igf1r APN 7 68189958 missense probably benign 0.05
IGL02506:Igf1r APN 7 68193396 missense probably benign
IGL02672:Igf1r APN 7 68190033 missense probably benign 0.05
IGL02701:Igf1r APN 7 68201249 missense possibly damaging 0.93
IGL02742:Igf1r APN 7 68189991 missense possibly damaging 0.94
IGL03073:Igf1r APN 7 68215043 missense probably damaging 1.00
IGL03257:Igf1r APN 7 68214940 missense probably damaging 1.00
Frufru UTSW 7 68004163 missense probably damaging 1.00
Mimi UTSW 7 68195026 missense possibly damaging 0.67
Piroshka UTSW 7 68207336 nonsense probably null
Toy UTSW 7 68003972 missense probably damaging 1.00
FR4548:Igf1r UTSW 7 68226186 small insertion probably benign
FR4737:Igf1r UTSW 7 68226181 small insertion probably benign
FR4976:Igf1r UTSW 7 68226181 small insertion probably benign
FR4976:Igf1r UTSW 7 68226186 small insertion probably benign
PIT4445001:Igf1r UTSW 7 68207463 missense probably damaging 1.00
R0003:Igf1r UTSW 7 68165242 missense probably damaging 1.00
R0184:Igf1r UTSW 7 68226193 missense possibly damaging 0.84
R0538:Igf1r UTSW 7 68207826 missense probably damaging 1.00
R0632:Igf1r UTSW 7 68165155 missense probably damaging 1.00
R0727:Igf1r UTSW 7 68212158 critical splice donor site probably null
R0750:Igf1r UTSW 7 68212091 missense probably damaging 0.99
R1104:Igf1r UTSW 7 68195026 missense possibly damaging 0.67
R1169:Igf1r UTSW 7 68165127 missense probably benign 0.00
R1348:Igf1r UTSW 7 68218468 missense probably damaging 1.00
R1471:Igf1r UTSW 7 68003837 missense probably damaging 0.98
R1580:Igf1r UTSW 7 68207869 missense probably benign
R1745:Igf1r UTSW 7 68169913 missense probably damaging 1.00
R1772:Igf1r UTSW 7 68195074 missense probably benign 0.03
R1789:Igf1r UTSW 7 68214933 nonsense probably null
R1823:Igf1r UTSW 7 68194981 missense possibly damaging 0.77
R1902:Igf1r UTSW 7 68201249 missense possibly damaging 0.93
R1962:Igf1r UTSW 7 68207275 missense probably damaging 0.99
R2179:Igf1r UTSW 7 68003950 missense probably damaging 0.99
R2215:Igf1r UTSW 7 68165234 missense probably benign
R2221:Igf1r UTSW 7 68201962 missense probably damaging 1.00
R2233:Igf1r UTSW 7 68212080 missense probably damaging 1.00
R2234:Igf1r UTSW 7 68212080 missense probably damaging 1.00
R2235:Igf1r UTSW 7 68212080 missense probably damaging 1.00
R3023:Igf1r UTSW 7 68183399 missense probably benign 0.00
R4044:Igf1r UTSW 7 68190062 missense possibly damaging 0.83
R4226:Igf1r UTSW 7 68195078 nonsense probably null
R4387:Igf1r UTSW 7 68170009 missense probably benign
R4388:Igf1r UTSW 7 68170009 missense probably benign
R4728:Igf1r UTSW 7 68189624 missense probably damaging 1.00
R5254:Igf1r UTSW 7 68207319 missense probably damaging 0.99
R5278:Igf1r UTSW 7 68193418 missense possibly damaging 0.78
R5510:Igf1r UTSW 7 68193359 missense probably benign 0.19
R5522:Igf1r UTSW 7 68183510 missense probably damaging 0.96
R5527:Igf1r UTSW 7 68207821 missense probably damaging 1.00
R5761:Igf1r UTSW 7 68207253 missense probably damaging 1.00
R5849:Igf1r UTSW 7 68190033 missense probably benign
R6189:Igf1r UTSW 7 68207336 nonsense probably null
R6262:Igf1r UTSW 7 68003972 missense probably damaging 1.00
R6285:Igf1r UTSW 7 68004137 missense possibly damaging 0.94
R6318:Igf1r UTSW 7 68165233 missense probably benign 0.02
R6365:Igf1r UTSW 7 68190050 missense probably benign 0.26
R6377:Igf1r UTSW 7 68201250 missense probably benign 0.00
R6831:Igf1r UTSW 7 68207319 missense possibly damaging 0.75
R6848:Igf1r UTSW 7 68004179 missense probably damaging 1.00
R6902:Igf1r UTSW 7 68004163 missense probably damaging 1.00
R7193:Igf1r UTSW 7 68187157 missense probably damaging 1.00
R7373:Igf1r UTSW 7 68195078 nonsense probably null
R7442:Igf1r UTSW 7 68173278 missense probably damaging 1.00
R7903:Igf1r UTSW 7 68184752 missense probably damaging 1.00
R7986:Igf1r UTSW 7 68184752 missense probably damaging 1.00
RF025:Igf1r UTSW 7 68226179 small insertion probably benign
RF032:Igf1r UTSW 7 68226179 small insertion probably benign
RF034:Igf1r UTSW 7 68226176 small insertion probably benign
RF037:Igf1r UTSW 7 68226176 small insertion probably benign
RF039:Igf1r UTSW 7 68226176 small insertion probably benign
RF044:Igf1r UTSW 7 68226179 small insertion probably benign
Predicted Primers PCR Primer
(F):5'- ACCGAGAACAACGAGTGCTG -3'
(R):5'- TTCGCATTAAAACAAGCTCAGC -3'

Sequencing Primer
(F):5'- AACGAGTGCTGCCACCC -3'
(R):5'- TGAACCCCTGGGAGGTCCTAC -3'
Posted On2015-12-21