Mutagenetix > Incidental Mutation

Incidental Mutation 'R4781:Rnf150'

366502

Institutional Source

Beutler Lab

Gene Symbol

Rnf150

Ensembl Gene

ENSMUSG00000047747

Gene Name

ring finger protein 150

Synonyms

Greul5, A630007N06Rik, C030044C12Rik

MMRRC Submission

042415-MU

Accession Numbers

Essential gene?

Possibly non essential (E-score: 0.433) question?

Stock #

R4781 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

82863356-83091268 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 82864152 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Tyrosine to Cysteine at position 48 (Y48C)

Ref Sequence

ENSEMBL: ENSMUSP00000077610 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000078525]

AlphaFold

Q5DTZ6

Predicted Effect

probably damaging
Transcript: ENSMUST00000078525
AA Change: Y48C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000077610
Gene: ENSMUSG00000047747
AA Change: Y48C

Domain	Start	End	E-Value	Type
signal peptide	1	34	N/A	INTRINSIC
low complexity region	54	64	N/A	INTRINSIC
Pfam:PA	84	180	2.1e-12	PFAM
transmembrane domain	207	229	N/A	INTRINSIC
RING	277	317	1.29e-7	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000211020

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000211714

Meta Mutation Damage Score

0.8185

Coding Region Coverage

1x: 99.2%
3x: 98.6%
10x: 97.2%
20x: 95.0%

Validation Efficiency

100% (74/74)

Allele List at MGI

Other mutations in this stock

Total: 66 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2310022A10Rik	T	A	7: 27,571,651	I157N	probably damaging	Het
Adgrl3	T	C	5: 81,760,724	Y1165H	probably damaging	Het
Adra2a	A	G	19: 54,046,495	D94G	probably damaging	Het
Akr1c20	T	A	13: 4,508,175	K197*	probably null	Het
Ankrd65	C	T	4: 155,793,036	H335Y	possibly damaging	Het
Axin2	T	A	11: 108,943,856	L636Q	probably damaging	Het
BC147527	A	C	13: 120,308,162	K6T	possibly damaging	Het
Camk1g	G	T	1: 193,356,344	T90N	probably benign	Het
Cd177	C	A	7: 24,750,626	C528F	probably damaging	Het
Cntnap5a	A	T	1: 116,412,201	D730V	possibly damaging	Het
Crtap	T	C	9: 114,386,236	D195G	probably benign	Het
Csn1s2b	A	G	5: 87,819,093	S74G	possibly damaging	Het
Cyp3a16	T	C	5: 145,456,112	R128G	possibly damaging	Het
Dnah7a	A	G	1: 53,425,208	F3675L	probably benign	Het
Dram2	T	A	3: 106,571,676	W195R	probably damaging	Het
E130308A19Rik	C	T	4: 59,691,057	P297L	probably benign	Het
Eif3i	T	C	4: 129,595,273	S83G	probably benign	Het
Gabra1	G	A	11: 42,133,661	P396S	probably damaging	Het
Gipr	T	A	7: 19,157,375	Y459F	possibly damaging	Het
Gm11677	C	T	11: 111,724,711		noncoding transcript	Het
Gm6981	T	C	9: 52,002,756		noncoding transcript	Het
Grin2d	T	C	7: 45,862,481	D180G	probably damaging	Het
Hectd4	T	G	5: 121,306,107		probably null	Het
Hhat	T	C	1: 192,686,979		probably benign	Het
Hoxa6	A	G	6: 52,206,420	L215P	possibly damaging	Het
Hsf4	G	A	8: 105,274,752		probably null	Het
Igf1r	G	A	7: 68,165,199	A283T	possibly damaging	Het
Ighv15-2	A	G	12: 114,564,856	S25P	probably damaging	Het
Inpp5a	C	T	7: 139,478,005	T43I	probably benign	Het
Kmt2c	T	A	5: 25,443,825	E82V	probably damaging	Het
Lrrc31	A	G	3: 30,687,377		probably benign	Het
Mdga2	A	G	12: 66,797,622		probably null	Het
Mefv	G	A	16: 3,715,334	P358S	probably benign	Het
Mrgpra9	A	G	7: 47,235,047	F291L	possibly damaging	Het
Mtmr3	A	G	11: 4,488,435	L673P	probably benign	Het
Muc19	T	C	15: 91,903,166		noncoding transcript	Het
Myo5b	A	T	18: 74,744,681	T1584S	possibly damaging	Het
Olfr1375	A	T	11: 51,048,480	R124S	probably damaging	Het
Olfr1427	T	C	19: 12,099,367	T91A	probably benign	Het
Palld	G	T	8: 61,877,028	R272S	probably benign	Het
Pcnx3	T	A	19: 5,687,130	N144Y	probably damaging	Het
Prf1	A	G	10: 61,300,424	K160E	probably damaging	Het
Rasgrp1	G	A	2: 117,291,709	A400V	probably benign	Het
Rpl11	G	T	4: 136,050,288	Q170K	probably benign	Het
Scin	G	A	12: 40,081,764	A257V	possibly damaging	Het
Scn7a	C	A	2: 66,703,760	A524S	possibly damaging	Het
Sim1	T	C	10: 50,983,785	L581S	probably benign	Het
Skor1	T	C	9: 63,144,459	T715A	probably benign	Het
Slc22a26	A	G	19: 7,790,135	V301A	probably benign	Het
Sorcs1	T	C	19: 50,182,681	Y923C	probably damaging	Het
Src	T	A	2: 157,467,485	M304K	possibly damaging	Het
Srgap3	A	T	6: 112,757,425		probably benign	Het
Stard3	G	A	11: 98,372,334	E72K	possibly damaging	Het
Svep1	T	A	4: 58,070,340	N2482I	probably damaging	Het
Tbc1d23	T	C	16: 57,218,415	K20R	possibly damaging	Het
Tfip11	G	A	5: 112,333,399	E414K	probably damaging	Het
Tinag	G	T	9: 76,996,950	T397K	possibly damaging	Het
Traf7	C	G	17: 24,510,438		probably benign	Het
Trmt10b	T	A	4: 45,305,817	I164N	probably damaging	Het
Trpm1	A	G	7: 64,235,052	D827G	probably benign	Het
Ube2u	A	T	4: 100,486,658	T85S	probably benign	Het
Ulk4	T	C	9: 121,103,576	D1066G	probably benign	Het
Vmn2r72	T	A	7: 85,737,861	I832F	probably benign	Het
Yipf1	A	C	4: 107,336,158	E80D	probably benign	Het
Zfp40	T	A	17: 23,175,655	R653W	probably damaging	Het
Zxdc	A	G	6: 90,372,553	T308A	probably damaging	Het

Other mutations in Rnf150

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL02183:Rnf150	APN	8	83003605	missense	probably damaging	0.96
R0512:Rnf150	UTSW	8	82864178	missense	probably benign	0.01
R1848:Rnf150	UTSW	8	82864010	start codon destroyed	possibly damaging	0.67
R2078:Rnf150	UTSW	8	83003605	missense	probably damaging	0.96
R2192:Rnf150	UTSW	8	82864391	missense	probably damaging	0.98
R3918:Rnf150	UTSW	8	82864461	missense	probably benign	0.25
R4365:Rnf150	UTSW	8	82864115	missense	probably benign	0.05
R4810:Rnf150	UTSW	8	82990362	missense	possibly damaging	0.66
R4859:Rnf150	UTSW	8	82864083	missense	probably damaging	1.00
R5677:Rnf150	UTSW	8	83003599	nonsense	probably null
R6022:Rnf150	UTSW	8	83042729	missense	probably benign	0.00
R6241:Rnf150	UTSW	8	82864464	missense	possibly damaging	0.82
R6283:Rnf150	UTSW	8	82990554	missense	probably damaging	1.00
R6306:Rnf150	UTSW	8	83083502	missense	possibly damaging	0.90
R7014:Rnf150	UTSW	8	83042663	missense	probably benign
R7023:Rnf150	UTSW	8	82864077	missense	probably damaging	0.97
R7394:Rnf150	UTSW	8	82990471	nonsense	probably null
R7710:Rnf150	UTSW	8	82864152	missense	probably damaging	1.00
R7771:Rnf150	UTSW	8	82864203	missense	probably benign	0.00
R8073:Rnf150	UTSW	8	82863917	start gained	probably benign
R8856:Rnf150	UTSW	8	83036086	missense	probably damaging	1.00
R8980:Rnf150	UTSW	8	82990458	missense	probably benign	0.19
R9139:Rnf150	UTSW	8	82863959	start gained	probably benign
R9289:Rnf150	UTSW	8	82990353	missense	probably benign
R9410:Rnf150	UTSW	8	83036093	missense	possibly damaging	0.91
R9594:Rnf150	UTSW	8	82990515	missense	probably damaging	1.00
R9603:Rnf150	UTSW	8	82990579	missense	possibly damaging	0.64
R9763:Rnf150	UTSW	8	83006339	missense	probably benign

Predicted Primers

PCR Primer
(F):5'- ATAGTCCCAGCACCGAGGAT -3'
(R):5'- ATGAGGGCTATCCAGTGCT -3'

Sequencing Primer
(F):5'- GCCACCTCTATGAGAGAAGGCG -3'
(R):5'- ATCCAGTGCTTGCCGTG -3'

Posted On

2015-12-21