Incidental Mutation 'R4781:Tinag'
ID 366506
Institutional Source Beutler Lab
Gene Symbol Tinag
Ensembl Gene ENSMUSG00000032357
Gene Name tubulointerstitial nephritis antigen
Synonyms TIN-ag
MMRRC Submission 042415-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.112) question?
Stock # R4781 (G1)
Quality Score 225
Status Validated
Chromosome 9
Chromosomal Location 76951693-77045794 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) G to T at 76996950 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Threonine to Lysine at position 397 (T397K)
Ref Sequence ENSEMBL: ENSMUSP00000034911 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000034911] [ENSMUST00000184897]
AlphaFold Q9WUR0
Predicted Effect possibly damaging
Transcript: ENSMUST00000034911
AA Change: T397K

PolyPhen 2 Score 0.692 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000034911
Gene: ENSMUSG00000032357
AA Change: T397K

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
SO 58 105 1.68e-11 SMART
Pept_C1 216 466 1.83e-52 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000184897
SMART Domains Protein: ENSMUSP00000139155
Gene: ENSMUSG00000032357

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
SO 58 105 1.68e-11 SMART
Meta Mutation Damage Score 0.1300 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.0%
Validation Efficiency 100% (74/74)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a glycoprotein that is restricted within the kidney to the basement membranes underlying the epithelium of Bowman's capsule and proximal and distal tubules. Autoantibodies against this protein are found in sera of patients with tubulointerstital nephritis, membranous nephropathy and anti-glomerular basement membrane nephritis. Ontogeny studies suggest that the expression of this antigen is developmentally regulated in a precise spatial and temporal pattern throughout nephrogenesis. [provided by RefSeq, Nov 2011]
Allele List at MGI
Other mutations in this stock
Total: 66 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310022A10Rik T A 7: 27,571,651 I157N probably damaging Het
Adgrl3 T C 5: 81,760,724 Y1165H probably damaging Het
Adra2a A G 19: 54,046,495 D94G probably damaging Het
Akr1c20 T A 13: 4,508,175 K197* probably null Het
Ankrd65 C T 4: 155,793,036 H335Y possibly damaging Het
Axin2 T A 11: 108,943,856 L636Q probably damaging Het
BC147527 A C 13: 120,308,162 K6T possibly damaging Het
Camk1g G T 1: 193,356,344 T90N probably benign Het
Cd177 C A 7: 24,750,626 C528F probably damaging Het
Cntnap5a A T 1: 116,412,201 D730V possibly damaging Het
Crtap T C 9: 114,386,236 D195G probably benign Het
Csn1s2b A G 5: 87,819,093 S74G possibly damaging Het
Cyp3a16 T C 5: 145,456,112 R128G possibly damaging Het
Dnah7a A G 1: 53,425,208 F3675L probably benign Het
Dram2 T A 3: 106,571,676 W195R probably damaging Het
E130308A19Rik C T 4: 59,691,057 P297L probably benign Het
Eif3i T C 4: 129,595,273 S83G probably benign Het
Gabra1 G A 11: 42,133,661 P396S probably damaging Het
Gipr T A 7: 19,157,375 Y459F possibly damaging Het
Gm11677 C T 11: 111,724,711 noncoding transcript Het
Gm6981 T C 9: 52,002,756 noncoding transcript Het
Grin2d T C 7: 45,862,481 D180G probably damaging Het
Hectd4 T G 5: 121,306,107 probably null Het
Hhat T C 1: 192,686,979 probably benign Het
Hoxa6 A G 6: 52,206,420 L215P possibly damaging Het
Hsf4 G A 8: 105,274,752 probably null Het
Igf1r G A 7: 68,165,199 A283T possibly damaging Het
Ighv15-2 A G 12: 114,564,856 S25P probably damaging Het
Inpp5a C T 7: 139,478,005 T43I probably benign Het
Kmt2c T A 5: 25,443,825 E82V probably damaging Het
Lrrc31 A G 3: 30,687,377 probably benign Het
Mdga2 A G 12: 66,797,622 probably null Het
Mefv G A 16: 3,715,334 P358S probably benign Het
Mrgpra9 A G 7: 47,235,047 F291L possibly damaging Het
Mtmr3 A G 11: 4,488,435 L673P probably benign Het
Muc19 T C 15: 91,903,166 noncoding transcript Het
Myo5b A T 18: 74,744,681 T1584S possibly damaging Het
Olfr1375 A T 11: 51,048,480 R124S probably damaging Het
Olfr1427 T C 19: 12,099,367 T91A probably benign Het
Palld G T 8: 61,877,028 R272S probably benign Het
Pcnx3 T A 19: 5,687,130 N144Y probably damaging Het
Prf1 A G 10: 61,300,424 K160E probably damaging Het
Rasgrp1 G A 2: 117,291,709 A400V probably benign Het
Rnf150 A G 8: 82,864,152 Y48C probably damaging Het
Rpl11 G T 4: 136,050,288 Q170K probably benign Het
Scin G A 12: 40,081,764 A257V possibly damaging Het
Scn7a C A 2: 66,703,760 A524S possibly damaging Het
Sim1 T C 10: 50,983,785 L581S probably benign Het
Skor1 T C 9: 63,144,459 T715A probably benign Het
Slc22a26 A G 19: 7,790,135 V301A probably benign Het
Sorcs1 T C 19: 50,182,681 Y923C probably damaging Het
Src T A 2: 157,467,485 M304K possibly damaging Het
Srgap3 A T 6: 112,757,425 probably benign Het
Stard3 G A 11: 98,372,334 E72K possibly damaging Het
Svep1 T A 4: 58,070,340 N2482I probably damaging Het
Tbc1d23 T C 16: 57,218,415 K20R possibly damaging Het
Tfip11 G A 5: 112,333,399 E414K probably damaging Het
Traf7 C G 17: 24,510,438 probably benign Het
Trmt10b T A 4: 45,305,817 I164N probably damaging Het
Trpm1 A G 7: 64,235,052 D827G probably benign Het
Ube2u A T 4: 100,486,658 T85S probably benign Het
Ulk4 T C 9: 121,103,576 D1066G probably benign Het
Vmn2r72 T A 7: 85,737,861 I832F probably benign Het
Yipf1 A C 4: 107,336,158 E80D probably benign Het
Zfp40 T A 17: 23,175,655 R653W probably damaging Het
Zxdc A G 6: 90,372,553 T308A probably damaging Het
Other mutations in Tinag
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01450:Tinag APN 9 77045576 missense possibly damaging 0.93
IGL01524:Tinag APN 9 77045538 missense probably damaging 1.00
IGL01537:Tinag APN 9 77045603 missense probably benign 0.01
IGL01832:Tinag APN 9 77031756 missense probably benign 0.18
IGL02512:Tinag APN 9 77031787 splice site probably benign
IGL02888:Tinag APN 9 77031713 missense probably benign 0.24
G1citation:Tinag UTSW 9 77031702 missense probably benign 0.00
R0179:Tinag UTSW 9 76996882 splice site probably benign
R0200:Tinag UTSW 9 76951935 missense probably damaging 1.00
R0206:Tinag UTSW 9 76999852 missense probably damaging 1.00
R0545:Tinag UTSW 9 77031710 missense possibly damaging 0.61
R0666:Tinag UTSW 9 77005687 missense probably benign 0.02
R0685:Tinag UTSW 9 76952003 missense probably damaging 1.00
R0732:Tinag UTSW 9 77001654 missense possibly damaging 0.93
R1445:Tinag UTSW 9 77045516 missense probably damaging 1.00
R2318:Tinag UTSW 9 77045411 missense probably damaging 1.00
R3809:Tinag UTSW 9 76951905 missense probably benign 0.15
R4747:Tinag UTSW 9 76996956 missense probably benign
R5110:Tinag UTSW 9 76952007 missense probably damaging 1.00
R5328:Tinag UTSW 9 77005631 nonsense probably null
R5605:Tinag UTSW 9 77045412 missense probably damaging 1.00
R5897:Tinag UTSW 9 77045444 missense probably damaging 1.00
R6296:Tinag UTSW 9 76996935 missense possibly damaging 0.67
R6822:Tinag UTSW 9 77031702 missense probably benign 0.00
R6915:Tinag UTSW 9 77001615 missense probably damaging 1.00
R7285:Tinag UTSW 9 77045661 missense probably benign
R7334:Tinag UTSW 9 77001649 missense probably damaging 1.00
R7974:Tinag UTSW 9 76999849 missense probably benign 0.01
R8354:Tinag UTSW 9 77031695 missense probably damaging 1.00
R8454:Tinag UTSW 9 77031695 missense probably damaging 1.00
R9029:Tinag UTSW 9 77027014 splice site probably benign
R9072:Tinag UTSW 9 76997018 critical splice acceptor site probably null
R9073:Tinag UTSW 9 76997018 critical splice acceptor site probably null
R9508:Tinag UTSW 9 77005699 missense probably damaging 1.00
Z1177:Tinag UTSW 9 77045498 missense probably benign
Predicted Primers PCR Primer
(F):5'- TATCTGAGGCAACCAAAGACATCAG -3'
(R):5'- TCTTCAGAGCGGAAAGGATG -3'

Sequencing Primer
(F):5'- GAGGCAACCAAAGACATCAGATACAG -3'
(R):5'- CAGCCATAATGCAAGTCC -3'
Posted On 2015-12-21