Mutagenetix > Incidental Mutation

Incidental Mutation 'R4781:Tinag'

366506

Institutional Source

Beutler Lab

Gene Symbol

Tinag

Ensembl Gene

ENSMUSG00000032357

Gene Name

tubulointerstitial nephritis antigen

Synonyms

TIN-ag

MMRRC Submission

042415-MU

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.112) question?

Stock #

R4781 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

76951693-77045794 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

G to T at 76996950 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Threonine to Lysine at position 397 (T397K)

Ref Sequence

ENSEMBL: ENSMUSP00000034911 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000034911] [ENSMUST00000184897]

AlphaFold

Q9WUR0

Predicted Effect

possibly damaging
Transcript: ENSMUST00000034911
AA Change: T397K

PolyPhen 2 Score 0.692 (Sensitivity: 0.86; Specificity: 0.92)

SMART Domains

Protein: ENSMUSP00000034911
Gene: ENSMUSG00000032357
AA Change: T397K

Domain	Start	End	E-Value	Type
signal peptide	1	19	N/A	INTRINSIC
SO	58	105	1.68e-11	SMART
Pept_C1	216	466	1.83e-52	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000184897

SMART Domains

Protein: ENSMUSP00000139155
Gene: ENSMUSG00000032357

Domain	Start	End	E-Value	Type
signal peptide	1	19	N/A	INTRINSIC
SO	58	105	1.68e-11	SMART

Meta Mutation Damage Score

0.1300

Coding Region Coverage

1x: 99.2%
3x: 98.6%
10x: 97.2%
20x: 95.0%

Validation Efficiency

100% (74/74)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a glycoprotein that is restricted within the kidney to the basement membranes underlying the epithelium of Bowman's capsule and proximal and distal tubules. Autoantibodies against this protein are found in sera of patients with tubulointerstital nephritis, membranous nephropathy and anti-glomerular basement membrane nephritis. Ontogeny studies suggest that the expression of this antigen is developmentally regulated in a precise spatial and temporal pattern throughout nephrogenesis. [provided by RefSeq, Nov 2011]

Allele List at MGI

Other mutations in this stock

Total: 66 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2310022A10Rik	T	A	7: 27,571,651	I157N	probably damaging	Het
Adgrl3	T	C	5: 81,760,724	Y1165H	probably damaging	Het
Adra2a	A	G	19: 54,046,495	D94G	probably damaging	Het
Akr1c20	T	A	13: 4,508,175	K197*	probably null	Het
Ankrd65	C	T	4: 155,793,036	H335Y	possibly damaging	Het
Axin2	T	A	11: 108,943,856	L636Q	probably damaging	Het
BC147527	A	C	13: 120,308,162	K6T	possibly damaging	Het
Camk1g	G	T	1: 193,356,344	T90N	probably benign	Het
Cd177	C	A	7: 24,750,626	C528F	probably damaging	Het
Cntnap5a	A	T	1: 116,412,201	D730V	possibly damaging	Het
Crtap	T	C	9: 114,386,236	D195G	probably benign	Het
Csn1s2b	A	G	5: 87,819,093	S74G	possibly damaging	Het
Cyp3a16	T	C	5: 145,456,112	R128G	possibly damaging	Het
Dnah7a	A	G	1: 53,425,208	F3675L	probably benign	Het
Dram2	T	A	3: 106,571,676	W195R	probably damaging	Het
E130308A19Rik	C	T	4: 59,691,057	P297L	probably benign	Het
Eif3i	T	C	4: 129,595,273	S83G	probably benign	Het
Gabra1	G	A	11: 42,133,661	P396S	probably damaging	Het
Gipr	T	A	7: 19,157,375	Y459F	possibly damaging	Het
Gm11677	C	T	11: 111,724,711		noncoding transcript	Het
Gm6981	T	C	9: 52,002,756		noncoding transcript	Het
Grin2d	T	C	7: 45,862,481	D180G	probably damaging	Het
Hectd4	T	G	5: 121,306,107		probably null	Het
Hhat	T	C	1: 192,686,979		probably benign	Het
Hoxa6	A	G	6: 52,206,420	L215P	possibly damaging	Het
Hsf4	G	A	8: 105,274,752		probably null	Het
Igf1r	G	A	7: 68,165,199	A283T	possibly damaging	Het
Ighv15-2	A	G	12: 114,564,856	S25P	probably damaging	Het
Inpp5a	C	T	7: 139,478,005	T43I	probably benign	Het
Kmt2c	T	A	5: 25,443,825	E82V	probably damaging	Het
Lrrc31	A	G	3: 30,687,377		probably benign	Het
Mdga2	A	G	12: 66,797,622		probably null	Het
Mefv	G	A	16: 3,715,334	P358S	probably benign	Het
Mrgpra9	A	G	7: 47,235,047	F291L	possibly damaging	Het
Mtmr3	A	G	11: 4,488,435	L673P	probably benign	Het
Muc19	T	C	15: 91,903,166		noncoding transcript	Het
Myo5b	A	T	18: 74,744,681	T1584S	possibly damaging	Het
Olfr1375	A	T	11: 51,048,480	R124S	probably damaging	Het
Olfr1427	T	C	19: 12,099,367	T91A	probably benign	Het
Palld	G	T	8: 61,877,028	R272S	probably benign	Het
Pcnx3	T	A	19: 5,687,130	N144Y	probably damaging	Het
Prf1	A	G	10: 61,300,424	K160E	probably damaging	Het
Rasgrp1	G	A	2: 117,291,709	A400V	probably benign	Het
Rnf150	A	G	8: 82,864,152	Y48C	probably damaging	Het
Rpl11	G	T	4: 136,050,288	Q170K	probably benign	Het
Scin	G	A	12: 40,081,764	A257V	possibly damaging	Het
Scn7a	C	A	2: 66,703,760	A524S	possibly damaging	Het
Sim1	T	C	10: 50,983,785	L581S	probably benign	Het
Skor1	T	C	9: 63,144,459	T715A	probably benign	Het
Slc22a26	A	G	19: 7,790,135	V301A	probably benign	Het
Sorcs1	T	C	19: 50,182,681	Y923C	probably damaging	Het
Src	T	A	2: 157,467,485	M304K	possibly damaging	Het
Srgap3	A	T	6: 112,757,425		probably benign	Het
Stard3	G	A	11: 98,372,334	E72K	possibly damaging	Het
Svep1	T	A	4: 58,070,340	N2482I	probably damaging	Het
Tbc1d23	T	C	16: 57,218,415	K20R	possibly damaging	Het
Tfip11	G	A	5: 112,333,399	E414K	probably damaging	Het
Traf7	C	G	17: 24,510,438		probably benign	Het
Trmt10b	T	A	4: 45,305,817	I164N	probably damaging	Het
Trpm1	A	G	7: 64,235,052	D827G	probably benign	Het
Ube2u	A	T	4: 100,486,658	T85S	probably benign	Het
Ulk4	T	C	9: 121,103,576	D1066G	probably benign	Het
Vmn2r72	T	A	7: 85,737,861	I832F	probably benign	Het
Yipf1	A	C	4: 107,336,158	E80D	probably benign	Het
Zfp40	T	A	17: 23,175,655	R653W	probably damaging	Het
Zxdc	A	G	6: 90,372,553	T308A	probably damaging	Het

Other mutations in Tinag

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01450:Tinag	APN	9	77045576	missense	possibly damaging	0.93
IGL01524:Tinag	APN	9	77045538	missense	probably damaging	1.00
IGL01537:Tinag	APN	9	77045603	missense	probably benign	0.01
IGL01832:Tinag	APN	9	77031756	missense	probably benign	0.18
IGL02512:Tinag	APN	9	77031787	splice site	probably benign
IGL02888:Tinag	APN	9	77031713	missense	probably benign	0.24
G1citation:Tinag	UTSW	9	77031702	missense	probably benign	0.00
R0179:Tinag	UTSW	9	76996882	splice site	probably benign
R0200:Tinag	UTSW	9	76951935	missense	probably damaging	1.00
R0206:Tinag	UTSW	9	76999852	missense	probably damaging	1.00
R0545:Tinag	UTSW	9	77031710	missense	possibly damaging	0.61
R0666:Tinag	UTSW	9	77005687	missense	probably benign	0.02
R0685:Tinag	UTSW	9	76952003	missense	probably damaging	1.00
R0732:Tinag	UTSW	9	77001654	missense	possibly damaging	0.93
R1445:Tinag	UTSW	9	77045516	missense	probably damaging	1.00
R2318:Tinag	UTSW	9	77045411	missense	probably damaging	1.00
R3809:Tinag	UTSW	9	76951905	missense	probably benign	0.15
R4747:Tinag	UTSW	9	76996956	missense	probably benign
R5110:Tinag	UTSW	9	76952007	missense	probably damaging	1.00
R5328:Tinag	UTSW	9	77005631	nonsense	probably null
R5605:Tinag	UTSW	9	77045412	missense	probably damaging	1.00
R5897:Tinag	UTSW	9	77045444	missense	probably damaging	1.00
R6296:Tinag	UTSW	9	76996935	missense	possibly damaging	0.67
R6822:Tinag	UTSW	9	77031702	missense	probably benign	0.00
R6915:Tinag	UTSW	9	77001615	missense	probably damaging	1.00
R7285:Tinag	UTSW	9	77045661	missense	probably benign
R7334:Tinag	UTSW	9	77001649	missense	probably damaging	1.00
R7974:Tinag	UTSW	9	76999849	missense	probably benign	0.01
R8354:Tinag	UTSW	9	77031695	missense	probably damaging	1.00
R8454:Tinag	UTSW	9	77031695	missense	probably damaging	1.00
R9029:Tinag	UTSW	9	77027014	splice site	probably benign
R9072:Tinag	UTSW	9	76997018	critical splice acceptor site	probably null
R9073:Tinag	UTSW	9	76997018	critical splice acceptor site	probably null
R9508:Tinag	UTSW	9	77005699	missense	probably damaging	1.00
Z1177:Tinag	UTSW	9	77045498	missense	probably benign

Predicted Primers

PCR Primer
(F):5'- TATCTGAGGCAACCAAAGACATCAG -3'
(R):5'- TCTTCAGAGCGGAAAGGATG -3'

Sequencing Primer
(F):5'- GAGGCAACCAAAGACATCAGATACAG -3'
(R):5'- CAGCCATAATGCAAGTCC -3'

Posted On

2015-12-21