Incidental Mutation 'R4781:Tinag'
ID 366506
Institutional Source Beutler Lab
Gene Symbol Tinag
Ensembl Gene ENSMUSG00000032357
Gene Name tubulointerstitial nephritis antigen
Synonyms TIN-ag
MMRRC Submission 042415-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.094) question?
Stock # R4781 (G1)
Quality Score 225
Status Validated
Chromosome 9
Chromosomal Location 76858975-76953076 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) G to T at 76904232 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Threonine to Lysine at position 397 (T397K)
Ref Sequence ENSEMBL: ENSMUSP00000034911 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000034911] [ENSMUST00000184897]
AlphaFold Q9WUR0
Predicted Effect possibly damaging
Transcript: ENSMUST00000034911
AA Change: T397K

PolyPhen 2 Score 0.692 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000034911
Gene: ENSMUSG00000032357
AA Change: T397K

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
SO 58 105 1.68e-11 SMART
Pept_C1 216 466 1.83e-52 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000184897
SMART Domains Protein: ENSMUSP00000139155
Gene: ENSMUSG00000032357

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
SO 58 105 1.68e-11 SMART
Meta Mutation Damage Score 0.1300 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.0%
Validation Efficiency 100% (74/74)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a glycoprotein that is restricted within the kidney to the basement membranes underlying the epithelium of Bowman's capsule and proximal and distal tubules. Autoantibodies against this protein are found in sera of patients with tubulointerstital nephritis, membranous nephropathy and anti-glomerular basement membrane nephritis. Ontogeny studies suggest that the expression of this antigen is developmentally regulated in a precise spatial and temporal pattern throughout nephrogenesis. [provided by RefSeq, Nov 2011]
Allele List at MGI
Other mutations in this stock
Total: 66 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310022A10Rik T A 7: 27,271,076 (GRCm39) I157N probably damaging Het
Adgrl3 T C 5: 81,908,571 (GRCm39) Y1165H probably damaging Het
Adra2a A G 19: 54,034,926 (GRCm39) D94G probably damaging Het
Akr1c20 T A 13: 4,558,174 (GRCm39) K197* probably null Het
Ankrd65 C T 4: 155,877,493 (GRCm39) H335Y possibly damaging Het
Axin2 T A 11: 108,834,682 (GRCm39) L636Q probably damaging Het
Camk1g G T 1: 193,038,652 (GRCm39) T90N probably benign Het
Cd177 C A 7: 24,450,051 (GRCm39) C528F probably damaging Het
Cntnap5a A T 1: 116,339,931 (GRCm39) D730V possibly damaging Het
Crtap T C 9: 114,215,304 (GRCm39) D195G probably benign Het
Csn1s2b A G 5: 87,966,952 (GRCm39) S74G possibly damaging Het
Cyp3a16 T C 5: 145,392,922 (GRCm39) R128G possibly damaging Het
Dnah7a A G 1: 53,464,367 (GRCm39) F3675L probably benign Het
Dram2 T A 3: 106,478,992 (GRCm39) W195R probably damaging Het
E130308A19Rik C T 4: 59,691,057 (GRCm39) P297L probably benign Het
Eif3i T C 4: 129,489,066 (GRCm39) S83G probably benign Het
Gabra1 G A 11: 42,024,488 (GRCm39) P396S probably damaging Het
Gipr T A 7: 18,891,300 (GRCm39) Y459F possibly damaging Het
Gm11677 C T 11: 111,615,537 (GRCm39) noncoding transcript Het
Gm6981 T C 9: 51,914,056 (GRCm39) noncoding transcript Het
Grin2d T C 7: 45,511,905 (GRCm39) D180G probably damaging Het
Hectd4 T G 5: 121,444,170 (GRCm39) probably null Het
Hhat T C 1: 192,369,287 (GRCm39) probably benign Het
Hoxa6 A G 6: 52,183,400 (GRCm39) L215P possibly damaging Het
Hsf4 G A 8: 106,001,384 (GRCm39) probably null Het
Igf1r G A 7: 67,814,947 (GRCm39) A283T possibly damaging Het
Ighv15-2 A G 12: 114,528,476 (GRCm39) S25P probably damaging Het
Inpp5a C T 7: 139,057,921 (GRCm39) T43I probably benign Het
Kmt2c T A 5: 25,648,823 (GRCm39) E82V probably damaging Het
Lrrc31 A G 3: 30,741,526 (GRCm39) probably benign Het
Mdga2 A G 12: 66,844,396 (GRCm39) probably null Het
Mefv G A 16: 3,533,198 (GRCm39) P358S probably benign Het
Mrgpra9 A G 7: 46,884,795 (GRCm39) F291L possibly damaging Het
Mtmr3 A G 11: 4,438,435 (GRCm39) L673P probably benign Het
Muc19 T C 15: 91,787,360 (GRCm39) noncoding transcript Het
Myo5b A T 18: 74,877,752 (GRCm39) T1584S possibly damaging Het
Or1x6 A T 11: 50,939,307 (GRCm39) R124S probably damaging Het
Or4z4 T C 19: 12,076,731 (GRCm39) T91A probably benign Het
Palld G T 8: 62,330,062 (GRCm39) R272S probably benign Het
Pcnx3 T A 19: 5,737,158 (GRCm39) N144Y probably damaging Het
Prf1 A G 10: 61,136,203 (GRCm39) K160E probably damaging Het
Rasgrp1 G A 2: 117,122,190 (GRCm39) A400V probably benign Het
Rnf150 A G 8: 83,590,781 (GRCm39) Y48C probably damaging Het
Rpl11 G T 4: 135,777,599 (GRCm39) Q170K probably benign Het
Scin G A 12: 40,131,763 (GRCm39) A257V possibly damaging Het
Scn7a C A 2: 66,534,104 (GRCm39) A524S possibly damaging Het
Sim1 T C 10: 50,859,881 (GRCm39) L581S probably benign Het
Skor1 T C 9: 63,051,741 (GRCm39) T715A probably benign Het
Slc22a26 A G 19: 7,767,500 (GRCm39) V301A probably benign Het
Sorcs1 T C 19: 50,171,119 (GRCm39) Y923C probably damaging Het
Src T A 2: 157,309,405 (GRCm39) M304K possibly damaging Het
Srgap3 A T 6: 112,734,386 (GRCm39) probably benign Het
Stard3 G A 11: 98,263,160 (GRCm39) E72K possibly damaging Het
Svep1 T A 4: 58,070,340 (GRCm39) N2482I probably damaging Het
Tbc1d23 T C 16: 57,038,778 (GRCm39) K20R possibly damaging Het
Tcstv4 A C 13: 120,769,698 (GRCm39) K6T possibly damaging Het
Tfip11 G A 5: 112,481,265 (GRCm39) E414K probably damaging Het
Traf7 C G 17: 24,729,412 (GRCm39) probably benign Het
Trmt10b T A 4: 45,305,817 (GRCm39) I164N probably damaging Het
Trpm1 A G 7: 63,884,800 (GRCm39) D827G probably benign Het
Ube2u A T 4: 100,343,855 (GRCm39) T85S probably benign Het
Ulk4 T C 9: 120,932,642 (GRCm39) D1066G probably benign Het
Vmn2r72 T A 7: 85,387,069 (GRCm39) I832F probably benign Het
Yipf1 A C 4: 107,193,355 (GRCm39) E80D probably benign Het
Zfp40 T A 17: 23,394,629 (GRCm39) R653W probably damaging Het
Zxdc A G 6: 90,349,535 (GRCm39) T308A probably damaging Het
Other mutations in Tinag
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01450:Tinag APN 9 76,952,858 (GRCm39) missense possibly damaging 0.93
IGL01524:Tinag APN 9 76,952,820 (GRCm39) missense probably damaging 1.00
IGL01537:Tinag APN 9 76,952,885 (GRCm39) missense probably benign 0.01
IGL01832:Tinag APN 9 76,939,038 (GRCm39) missense probably benign 0.18
IGL02512:Tinag APN 9 76,939,069 (GRCm39) splice site probably benign
IGL02888:Tinag APN 9 76,938,995 (GRCm39) missense probably benign 0.24
G1citation:Tinag UTSW 9 76,938,984 (GRCm39) missense probably benign 0.00
R0179:Tinag UTSW 9 76,904,164 (GRCm39) splice site probably benign
R0200:Tinag UTSW 9 76,859,217 (GRCm39) missense probably damaging 1.00
R0206:Tinag UTSW 9 76,907,134 (GRCm39) missense probably damaging 1.00
R0545:Tinag UTSW 9 76,938,992 (GRCm39) missense possibly damaging 0.61
R0666:Tinag UTSW 9 76,912,969 (GRCm39) missense probably benign 0.02
R0685:Tinag UTSW 9 76,859,285 (GRCm39) missense probably damaging 1.00
R0732:Tinag UTSW 9 76,908,936 (GRCm39) missense possibly damaging 0.93
R1445:Tinag UTSW 9 76,952,798 (GRCm39) missense probably damaging 1.00
R2318:Tinag UTSW 9 76,952,693 (GRCm39) missense probably damaging 1.00
R3809:Tinag UTSW 9 76,859,187 (GRCm39) missense probably benign 0.15
R4747:Tinag UTSW 9 76,904,238 (GRCm39) missense probably benign
R5110:Tinag UTSW 9 76,859,289 (GRCm39) missense probably damaging 1.00
R5328:Tinag UTSW 9 76,912,913 (GRCm39) nonsense probably null
R5605:Tinag UTSW 9 76,952,694 (GRCm39) missense probably damaging 1.00
R5897:Tinag UTSW 9 76,952,726 (GRCm39) missense probably damaging 1.00
R6296:Tinag UTSW 9 76,904,217 (GRCm39) missense possibly damaging 0.67
R6822:Tinag UTSW 9 76,938,984 (GRCm39) missense probably benign 0.00
R6915:Tinag UTSW 9 76,908,897 (GRCm39) missense probably damaging 1.00
R7285:Tinag UTSW 9 76,952,943 (GRCm39) missense probably benign
R7334:Tinag UTSW 9 76,908,931 (GRCm39) missense probably damaging 1.00
R7974:Tinag UTSW 9 76,907,131 (GRCm39) missense probably benign 0.01
R8354:Tinag UTSW 9 76,938,977 (GRCm39) missense probably damaging 1.00
R8454:Tinag UTSW 9 76,938,977 (GRCm39) missense probably damaging 1.00
R9029:Tinag UTSW 9 76,934,296 (GRCm39) splice site probably benign
R9072:Tinag UTSW 9 76,904,300 (GRCm39) critical splice acceptor site probably null
R9073:Tinag UTSW 9 76,904,300 (GRCm39) critical splice acceptor site probably null
R9508:Tinag UTSW 9 76,912,981 (GRCm39) missense probably damaging 1.00
Z1177:Tinag UTSW 9 76,952,780 (GRCm39) missense probably benign
Predicted Primers PCR Primer
(F):5'- TATCTGAGGCAACCAAAGACATCAG -3'
(R):5'- TCTTCAGAGCGGAAAGGATG -3'

Sequencing Primer
(F):5'- GAGGCAACCAAAGACATCAGATACAG -3'
(R):5'- CAGCCATAATGCAAGTCC -3'
Posted On 2015-12-21