Incidental Mutation 'R4781:Ulk4'
ID 366508
Institutional Source Beutler Lab
Gene Symbol Ulk4
Ensembl Gene ENSMUSG00000040936
Gene Name unc-51-like kinase 4
Synonyms 4932415A06Rik
MMRRC Submission 042415-MU
Accession Numbers
Essential gene? Possibly essential (E-score: 0.701) question?
Stock # R4781 (G1)
Quality Score 225
Status Validated
Chromosome 9
Chromosomal Location 120793520-121115225 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 120932642 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Aspartic acid to Glycine at position 1066 (D1066G)
Ref Sequence ENSEMBL: ENSMUSP00000131342 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000051479] [ENSMUST00000051565] [ENSMUST00000171061] [ENSMUST00000171923]
AlphaFold no structure available at present
Predicted Effect probably benign
Transcript: ENSMUST00000051479
AA Change: D1066G

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000057960
Gene: ENSMUSG00000040936
AA Change: D1066G

DomainStartEndE-ValueType
Pfam:Pkinase_Tyr 4 277 9.9e-26 PFAM
Pfam:Pkinase 4 280 4.6e-49 PFAM
low complexity region 949 964 N/A INTRINSIC
low complexity region 968 985 N/A INTRINSIC
low complexity region 1107 1119 N/A INTRINSIC
low complexity region 1147 1161 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000051565
SMART Domains Protein: ENSMUSP00000054833
Gene: ENSMUSG00000040936

DomainStartEndE-ValueType
SCOP:d1jvpp_ 1 32 9e-6 SMART
Blast:S_TKc 4 45 2e-8 BLAST
Predicted Effect noncoding transcript
Transcript: ENSMUST00000164336
Predicted Effect noncoding transcript
Transcript: ENSMUST00000170406
Predicted Effect probably benign
Transcript: ENSMUST00000171061
SMART Domains Protein: ENSMUSP00000129214
Gene: ENSMUSG00000040936

DomainStartEndE-ValueType
Pfam:Pkinase_Tyr 4 277 4.3e-26 PFAM
Pfam:Pkinase 4 280 2.1e-49 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000171923
AA Change: D1066G

PolyPhen 2 Score 0.004 (Sensitivity: 0.98; Specificity: 0.59)
SMART Domains Protein: ENSMUSP00000131342
Gene: ENSMUSG00000040936
AA Change: D1066G

DomainStartEndE-ValueType
Pfam:Pkinase_Tyr 4 153 3.1e-14 PFAM
Pfam:Pkinase 4 280 4.9e-50 PFAM
Pfam:Pkinase_Tyr 165 277 6.1e-10 PFAM
low complexity region 949 964 N/A INTRINSIC
low complexity region 968 985 N/A INTRINSIC
low complexity region 1107 1119 N/A INTRINSIC
low complexity region 1147 1171 N/A INTRINSIC
Meta Mutation Damage Score 0.0855 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.0%
Validation Efficiency 100% (74/74)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the unc-51-like serine/threonine kinase (STK) family. Members of this protein family play a role in neuronal growth and endocytosis. The encoded protein is likely involved in neurite branching, neurite elongation and neuronal migration. Genome-wide association studies (GWAS) indicate an association of variations in this gene with blood pressure and hypertension. Sequence variations in this gene may also be be associated with psychiatric disorders, including schizophrenia and bipolar disorder. Pseudogenes associated with this gene have been identified and are located on chromosome 15. [provided by RefSeq, Jul 2016]
PHENOTYPE: Homozygotes for a null allele show reduced body size, hydrocephaly, dilated brain ventricles, otitis media, and premature death. Hypomorphic mice show partial corpus callosum aplasia, hydrocephaly, subcommissural organ and ependymal motile ciliary defects, aqueduct stenosis, and impaired CSF flow. [provided by MGI curators]
Allele List at MGI

All alleles(2) : Targeted, other(1) Gene trapped(1)

Other mutations in this stock
Total: 66 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310022A10Rik T A 7: 27,271,076 (GRCm39) I157N probably damaging Het
Adgrl3 T C 5: 81,908,571 (GRCm39) Y1165H probably damaging Het
Adra2a A G 19: 54,034,926 (GRCm39) D94G probably damaging Het
Akr1c20 T A 13: 4,558,174 (GRCm39) K197* probably null Het
Ankrd65 C T 4: 155,877,493 (GRCm39) H335Y possibly damaging Het
Axin2 T A 11: 108,834,682 (GRCm39) L636Q probably damaging Het
Camk1g G T 1: 193,038,652 (GRCm39) T90N probably benign Het
Cd177 C A 7: 24,450,051 (GRCm39) C528F probably damaging Het
Cntnap5a A T 1: 116,339,931 (GRCm39) D730V possibly damaging Het
Crtap T C 9: 114,215,304 (GRCm39) D195G probably benign Het
Csn1s2b A G 5: 87,966,952 (GRCm39) S74G possibly damaging Het
Cyp3a16 T C 5: 145,392,922 (GRCm39) R128G possibly damaging Het
Dnah7a A G 1: 53,464,367 (GRCm39) F3675L probably benign Het
Dram2 T A 3: 106,478,992 (GRCm39) W195R probably damaging Het
E130308A19Rik C T 4: 59,691,057 (GRCm39) P297L probably benign Het
Eif3i T C 4: 129,489,066 (GRCm39) S83G probably benign Het
Gabra1 G A 11: 42,024,488 (GRCm39) P396S probably damaging Het
Gipr T A 7: 18,891,300 (GRCm39) Y459F possibly damaging Het
Gm11677 C T 11: 111,615,537 (GRCm39) noncoding transcript Het
Gm6981 T C 9: 51,914,056 (GRCm39) noncoding transcript Het
Grin2d T C 7: 45,511,905 (GRCm39) D180G probably damaging Het
Hectd4 T G 5: 121,444,170 (GRCm39) probably null Het
Hhat T C 1: 192,369,287 (GRCm39) probably benign Het
Hoxa6 A G 6: 52,183,400 (GRCm39) L215P possibly damaging Het
Hsf4 G A 8: 106,001,384 (GRCm39) probably null Het
Igf1r G A 7: 67,814,947 (GRCm39) A283T possibly damaging Het
Ighv15-2 A G 12: 114,528,476 (GRCm39) S25P probably damaging Het
Inpp5a C T 7: 139,057,921 (GRCm39) T43I probably benign Het
Kmt2c T A 5: 25,648,823 (GRCm39) E82V probably damaging Het
Lrrc31 A G 3: 30,741,526 (GRCm39) probably benign Het
Mdga2 A G 12: 66,844,396 (GRCm39) probably null Het
Mefv G A 16: 3,533,198 (GRCm39) P358S probably benign Het
Mrgpra9 A G 7: 46,884,795 (GRCm39) F291L possibly damaging Het
Mtmr3 A G 11: 4,438,435 (GRCm39) L673P probably benign Het
Muc19 T C 15: 91,787,360 (GRCm39) noncoding transcript Het
Myo5b A T 18: 74,877,752 (GRCm39) T1584S possibly damaging Het
Or1x6 A T 11: 50,939,307 (GRCm39) R124S probably damaging Het
Or4z4 T C 19: 12,076,731 (GRCm39) T91A probably benign Het
Palld G T 8: 62,330,062 (GRCm39) R272S probably benign Het
Pcnx3 T A 19: 5,737,158 (GRCm39) N144Y probably damaging Het
Prf1 A G 10: 61,136,203 (GRCm39) K160E probably damaging Het
Rasgrp1 G A 2: 117,122,190 (GRCm39) A400V probably benign Het
Rnf150 A G 8: 83,590,781 (GRCm39) Y48C probably damaging Het
Rpl11 G T 4: 135,777,599 (GRCm39) Q170K probably benign Het
Scin G A 12: 40,131,763 (GRCm39) A257V possibly damaging Het
Scn7a C A 2: 66,534,104 (GRCm39) A524S possibly damaging Het
Sim1 T C 10: 50,859,881 (GRCm39) L581S probably benign Het
Skor1 T C 9: 63,051,741 (GRCm39) T715A probably benign Het
Slc22a26 A G 19: 7,767,500 (GRCm39) V301A probably benign Het
Sorcs1 T C 19: 50,171,119 (GRCm39) Y923C probably damaging Het
Src T A 2: 157,309,405 (GRCm39) M304K possibly damaging Het
Srgap3 A T 6: 112,734,386 (GRCm39) probably benign Het
Stard3 G A 11: 98,263,160 (GRCm39) E72K possibly damaging Het
Svep1 T A 4: 58,070,340 (GRCm39) N2482I probably damaging Het
Tbc1d23 T C 16: 57,038,778 (GRCm39) K20R possibly damaging Het
Tcstv4 A C 13: 120,769,698 (GRCm39) K6T possibly damaging Het
Tfip11 G A 5: 112,481,265 (GRCm39) E414K probably damaging Het
Tinag G T 9: 76,904,232 (GRCm39) T397K possibly damaging Het
Traf7 C G 17: 24,729,412 (GRCm39) probably benign Het
Trmt10b T A 4: 45,305,817 (GRCm39) I164N probably damaging Het
Trpm1 A G 7: 63,884,800 (GRCm39) D827G probably benign Het
Ube2u A T 4: 100,343,855 (GRCm39) T85S probably benign Het
Vmn2r72 T A 7: 85,387,069 (GRCm39) I832F probably benign Het
Yipf1 A C 4: 107,193,355 (GRCm39) E80D probably benign Het
Zfp40 T A 17: 23,394,629 (GRCm39) R653W probably damaging Het
Zxdc A G 6: 90,349,535 (GRCm39) T308A probably damaging Het
Other mutations in Ulk4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01122:Ulk4 APN 9 120,997,358 (GRCm39) missense possibly damaging 0.48
IGL01345:Ulk4 APN 9 121,037,228 (GRCm39) missense possibly damaging 0.48
IGL01432:Ulk4 APN 9 121,095,367 (GRCm39) missense probably damaging 1.00
IGL01807:Ulk4 APN 9 121,084,251 (GRCm39) missense probably damaging 1.00
IGL02139:Ulk4 APN 9 120,970,897 (GRCm39) splice site probably null
IGL02266:Ulk4 APN 9 120,910,766 (GRCm39) missense probably benign 0.10
IGL02511:Ulk4 APN 9 121,017,420 (GRCm39) missense probably damaging 1.00
IGL02546:Ulk4 APN 9 120,981,373 (GRCm39) nonsense probably null
IGL02687:Ulk4 APN 9 121,021,728 (GRCm39) missense possibly damaging 0.89
IGL03220:Ulk4 APN 9 120,974,402 (GRCm39) missense probably damaging 1.00
3-1:Ulk4 UTSW 9 121,084,237 (GRCm39) missense probably benign 0.02
R0031:Ulk4 UTSW 9 121,102,048 (GRCm39) missense probably damaging 1.00
R0433:Ulk4 UTSW 9 120,873,885 (GRCm39) missense probably benign 0.27
R0513:Ulk4 UTSW 9 120,981,391 (GRCm39) missense probably benign 0.13
R0524:Ulk4 UTSW 9 121,081,717 (GRCm39) critical splice donor site probably null
R1268:Ulk4 UTSW 9 121,086,140 (GRCm39) splice site probably benign
R1439:Ulk4 UTSW 9 121,095,324 (GRCm39) missense possibly damaging 0.58
R1470:Ulk4 UTSW 9 120,910,722 (GRCm39) missense probably benign 0.00
R1470:Ulk4 UTSW 9 120,910,722 (GRCm39) missense probably benign 0.00
R1531:Ulk4 UTSW 9 120,873,841 (GRCm39) missense probably damaging 0.97
R1595:Ulk4 UTSW 9 120,873,904 (GRCm39) missense probably damaging 0.96
R1620:Ulk4 UTSW 9 121,033,871 (GRCm39) missense possibly damaging 0.81
R1835:Ulk4 UTSW 9 120,997,250 (GRCm39) missense probably null 1.00
R1966:Ulk4 UTSW 9 121,086,182 (GRCm39) missense probably benign
R2129:Ulk4 UTSW 9 120,981,248 (GRCm39) missense probably benign 0.03
R2329:Ulk4 UTSW 9 121,101,953 (GRCm39) missense probably damaging 1.00
R2877:Ulk4 UTSW 9 121,089,105 (GRCm39) missense probably benign 0.11
R2878:Ulk4 UTSW 9 121,089,105 (GRCm39) missense probably benign 0.11
R3734:Ulk4 UTSW 9 121,091,055 (GRCm39) missense probably benign 0.21
R3769:Ulk4 UTSW 9 121,092,766 (GRCm39) missense probably benign 0.00
R4005:Ulk4 UTSW 9 120,997,265 (GRCm39) missense possibly damaging 0.94
R4024:Ulk4 UTSW 9 120,873,915 (GRCm39) missense possibly damaging 0.86
R4321:Ulk4 UTSW 9 120,903,062 (GRCm39) missense probably benign 0.00
R4461:Ulk4 UTSW 9 120,985,950 (GRCm39) missense possibly damaging 0.83
R4537:Ulk4 UTSW 9 121,092,704 (GRCm39) nonsense probably null
R4542:Ulk4 UTSW 9 121,092,704 (GRCm39) nonsense probably null
R4572:Ulk4 UTSW 9 121,021,830 (GRCm39) missense probably damaging 1.00
R4647:Ulk4 UTSW 9 120,970,918 (GRCm39) missense probably benign 0.15
R4712:Ulk4 UTSW 9 121,073,436 (GRCm39) missense probably benign 0.23
R4730:Ulk4 UTSW 9 121,092,791 (GRCm39) missense probably benign 0.05
R4731:Ulk4 UTSW 9 121,092,704 (GRCm39) nonsense probably null
R4732:Ulk4 UTSW 9 121,092,704 (GRCm39) nonsense probably null
R4733:Ulk4 UTSW 9 121,092,704 (GRCm39) nonsense probably null
R4737:Ulk4 UTSW 9 120,902,938 (GRCm39) nonsense probably null
R4860:Ulk4 UTSW 9 121,079,968 (GRCm39) missense possibly damaging 0.68
R4926:Ulk4 UTSW 9 121,087,798 (GRCm39) missense probably benign 0.00
R4990:Ulk4 UTSW 9 121,021,852 (GRCm39) missense probably benign 0.01
R6056:Ulk4 UTSW 9 121,102,021 (GRCm39) missense probably damaging 1.00
R6448:Ulk4 UTSW 9 120,932,696 (GRCm39) missense probably damaging 0.99
R6546:Ulk4 UTSW 9 120,970,960 (GRCm39) missense probably damaging 1.00
R6668:Ulk4 UTSW 9 121,017,408 (GRCm39) missense probably damaging 1.00
R6915:Ulk4 UTSW 9 121,087,886 (GRCm39) missense probably benign
R6929:Ulk4 UTSW 9 120,903,081 (GRCm39) missense probably benign 0.02
R7069:Ulk4 UTSW 9 121,095,583 (GRCm39) missense probably benign 0.25
R7069:Ulk4 UTSW 9 121,087,876 (GRCm39) missense probably benign 0.01
R7293:Ulk4 UTSW 9 121,084,190 (GRCm39) missense probably damaging 1.00
R7299:Ulk4 UTSW 9 120,974,125 (GRCm39) missense probably benign 0.32
R7301:Ulk4 UTSW 9 120,974,125 (GRCm39) missense probably benign 0.32
R7337:Ulk4 UTSW 9 121,077,993 (GRCm39) missense probably benign 0.44
R7395:Ulk4 UTSW 9 121,084,178 (GRCm39) missense probably benign
R7423:Ulk4 UTSW 9 120,932,687 (GRCm39) missense possibly damaging 0.48
R7545:Ulk4 UTSW 9 120,970,904 (GRCm39) missense probably benign 0.00
R7753:Ulk4 UTSW 9 121,095,578 (GRCm39) critical splice donor site probably null
R7790:Ulk4 UTSW 9 121,092,734 (GRCm39) missense possibly damaging 0.70
R7791:Ulk4 UTSW 9 121,092,734 (GRCm39) missense possibly damaging 0.70
R7793:Ulk4 UTSW 9 121,092,734 (GRCm39) missense possibly damaging 0.70
R7834:Ulk4 UTSW 9 121,092,734 (GRCm39) missense possibly damaging 0.70
R7836:Ulk4 UTSW 9 120,873,885 (GRCm39) missense possibly damaging 0.72
R7960:Ulk4 UTSW 9 121,102,022 (GRCm39) missense probably damaging 1.00
R8087:Ulk4 UTSW 9 121,095,317 (GRCm39) missense probably damaging 0.99
R8203:Ulk4 UTSW 9 120,997,274 (GRCm39) missense probably damaging 0.96
R8246:Ulk4 UTSW 9 120,985,941 (GRCm39) makesense probably null
R8430:Ulk4 UTSW 9 121,086,144 (GRCm39) critical splice donor site probably null
R8841:Ulk4 UTSW 9 121,033,804 (GRCm39) missense probably damaging 1.00
R9014:Ulk4 UTSW 9 121,017,294 (GRCm39) missense probably benign 0.00
R9092:Ulk4 UTSW 9 120,903,003 (GRCm39) missense
R9126:Ulk4 UTSW 9 121,090,988 (GRCm39) missense probably damaging 0.99
R9176:Ulk4 UTSW 9 120,974,128 (GRCm39) missense probably benign
R9235:Ulk4 UTSW 9 120,981,217 (GRCm39) missense probably benign 0.13
R9713:Ulk4 UTSW 9 120,873,862 (GRCm39) nonsense probably null
X0024:Ulk4 UTSW 9 121,021,819 (GRCm39) missense probably damaging 1.00
X0066:Ulk4 UTSW 9 121,091,672 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AATGTCAAAACCGCGGCTG -3'
(R):5'- GTTTAACTCCATCTCTGCGGTG -3'

Sequencing Primer
(F):5'- AAAACCGCGGCTGGTGAC -3'
(R):5'- TTCTGTTTCAGAAGAGAAGGGACCC -3'
Posted On 2015-12-21