Incidental Mutation 'R4781:Sim1'
ID366510
Institutional Source Beutler Lab
Gene Symbol Sim1
Ensembl Gene ENSMUSG00000019913
Gene Namesingle-minded family bHLH transcription factor 1
SynonymsbHLHe14
MMRRC Submission 042415-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R4781 (G1)
Quality Score225
Status Validated
Chromosome10
Chromosomal Location50894754-50989152 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 50983785 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Serine at position 581 (L581S)
Ref Sequence ENSEMBL: ENSMUSP00000020071 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000020071]
Predicted Effect probably benign
Transcript: ENSMUST00000020071
AA Change: L581S

PolyPhen 2 Score 0.076 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000020071
Gene: ENSMUSG00000019913
AA Change: L581S

DomainStartEndE-ValueType
HLH 6 59 8.73e-6 SMART
PAS 79 145 7.39e-14 SMART
PAS 220 286 5.61e-5 SMART
PAC 292 335 4.63e-6 SMART
Pfam:SIM_C 359 668 2.5e-114 PFAM
Meta Mutation Damage Score 0.1499 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.0%
Validation Efficiency 100% (74/74)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] SIM1 and SIM2 genes are Drosophila single-minded (sim) gene homologs. SIM1 transcript was detected only in fetal kidney out of various adult and fetal tissues tested. Since the sim gene plays an important role in Drosophila development and has peak levels of expression during the period of neurogenesis,it was proposed that the human SIM gene is a candidate for involvement in certain dysmorphic features (particularly the facial and skull characteristics), abnormalities of brain development, and/or mental retardation of Down syndrome. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for disruptions of this gene die at birth with abnormalities in the paraventricular and supraoptic nuclei. Heterozygous mutant mice are obese and may also be diabetic, hyperinsulinemic and insulin resistant. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 66 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310022A10Rik T A 7: 27,571,651 I157N probably damaging Het
Adgrl3 T C 5: 81,760,724 Y1165H probably damaging Het
Adra2a A G 19: 54,046,495 D94G probably damaging Het
Akr1c20 T A 13: 4,508,175 K197* probably null Het
Ankrd65 C T 4: 155,793,036 H335Y possibly damaging Het
Axin2 T A 11: 108,943,856 L636Q probably damaging Het
BC147527 A C 13: 120,308,162 K6T possibly damaging Het
Camk1g G T 1: 193,356,344 T90N probably benign Het
Cd177 C A 7: 24,750,626 C528F probably damaging Het
Cntnap5a A T 1: 116,412,201 D730V possibly damaging Het
Crtap T C 9: 114,386,236 D195G probably benign Het
Csn1s2b A G 5: 87,819,093 S74G possibly damaging Het
Cyp3a16 T C 5: 145,456,112 R128G possibly damaging Het
Dnah7a A G 1: 53,425,208 F3675L probably benign Het
Dram2 T A 3: 106,571,676 W195R probably damaging Het
E130308A19Rik C T 4: 59,691,057 P297L probably benign Het
Eif3i T C 4: 129,595,273 S83G probably benign Het
Gabra1 G A 11: 42,133,661 P396S probably damaging Het
Gipr T A 7: 19,157,375 Y459F possibly damaging Het
Gm11677 C T 11: 111,724,711 noncoding transcript Het
Gm6981 T C 9: 52,002,756 noncoding transcript Het
Grin2d T C 7: 45,862,481 D180G probably damaging Het
Hectd4 T G 5: 121,306,107 probably null Het
Hhat T C 1: 192,686,979 probably benign Het
Hoxa6 A G 6: 52,206,420 L215P possibly damaging Het
Hsf4 G A 8: 105,274,752 probably null Het
Igf1r G A 7: 68,165,199 A283T possibly damaging Het
Ighv15-2 A G 12: 114,564,856 S25P probably damaging Het
Inpp5a C T 7: 139,478,005 T43I probably benign Het
Kmt2c T A 5: 25,443,825 E82V probably damaging Het
Lrrc31 A G 3: 30,687,377 probably benign Het
Mdga2 A G 12: 66,797,622 probably null Het
Mefv G A 16: 3,715,334 P358S probably benign Het
Mrgpra9 A G 7: 47,235,047 F291L possibly damaging Het
Mtmr3 A G 11: 4,488,435 L673P probably benign Het
Muc19 T C 15: 91,903,166 noncoding transcript Het
Myo5b A T 18: 74,744,681 T1584S possibly damaging Het
Olfr1375 A T 11: 51,048,480 R124S probably damaging Het
Olfr1427 T C 19: 12,099,367 T91A probably benign Het
Palld G T 8: 61,877,028 R272S probably benign Het
Pcnx3 T A 19: 5,687,130 N144Y probably damaging Het
Prf1 A G 10: 61,300,424 K160E probably damaging Het
Rasgrp1 G A 2: 117,291,709 A400V probably benign Het
Rnf150 A G 8: 82,864,152 Y48C probably damaging Het
Rpl11 G T 4: 136,050,288 Q170K probably benign Het
Scin G A 12: 40,081,764 A257V possibly damaging Het
Scn7a C A 2: 66,703,760 A524S possibly damaging Het
Skor1 T C 9: 63,144,459 T715A probably benign Het
Slc22a26 A G 19: 7,790,135 V301A probably benign Het
Sorcs1 T C 19: 50,182,681 Y923C probably damaging Het
Src T A 2: 157,467,485 M304K possibly damaging Het
Srgap3 A T 6: 112,757,425 probably benign Het
Stard3 G A 11: 98,372,334 E72K possibly damaging Het
Svep1 T A 4: 58,070,340 N2482I probably damaging Het
Tbc1d23 T C 16: 57,218,415 K20R possibly damaging Het
Tfip11 G A 5: 112,333,399 E414K probably damaging Het
Tinag G T 9: 76,996,950 T397K possibly damaging Het
Traf7 C G 17: 24,510,438 probably benign Het
Trmt10b T A 4: 45,305,817 I164N probably damaging Het
Trpm1 A G 7: 64,235,052 D827G probably benign Het
Ube2u A T 4: 100,486,658 T85S probably benign Het
Ulk4 T C 9: 121,103,576 D1066G probably benign Het
Vmn2r72 T A 7: 85,737,861 I832F probably benign Het
Yipf1 A C 4: 107,336,158 E80D probably benign Het
Zfp40 T A 17: 23,175,655 R653W probably damaging Het
Zxdc A G 6: 90,372,553 T308A probably damaging Het
Other mutations in Sim1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01105:Sim1 APN 10 50981534 missense probably damaging 0.99
IGL01142:Sim1 APN 10 50910671 missense probably damaging 0.99
IGL01886:Sim1 APN 10 50984315 missense probably damaging 1.00
PIT4585001:Sim1 UTSW 10 50984188 nonsense probably null
R0128:Sim1 UTSW 10 50907961 missense probably damaging 1.00
R0130:Sim1 UTSW 10 50907961 missense probably damaging 1.00
R0717:Sim1 UTSW 10 50909828 missense probably damaging 1.00
R0948:Sim1 UTSW 10 50981327 nonsense probably null
R1169:Sim1 UTSW 10 50981522 missense probably benign 0.13
R1388:Sim1 UTSW 10 50895994 missense probably damaging 1.00
R1746:Sim1 UTSW 10 50984109 missense probably benign
R1778:Sim1 UTSW 10 50981553 nonsense probably null
R1834:Sim1 UTSW 10 50909828 missense probably damaging 1.00
R2434:Sim1 UTSW 10 50907958 missense probably damaging 1.00
R2919:Sim1 UTSW 10 50909815 missense probably benign 0.23
R3617:Sim1 UTSW 10 50909528 missense probably damaging 1.00
R3625:Sim1 UTSW 10 50981336 missense probably benign 0.30
R4152:Sim1 UTSW 10 50983854 missense probably damaging 0.98
R4414:Sim1 UTSW 10 50981612 missense probably benign 0.13
R4645:Sim1 UTSW 10 50983997 missense probably benign 0.13
R4889:Sim1 UTSW 10 50981324 missense probably benign 0.05
R4924:Sim1 UTSW 10 50909902 missense probably damaging 1.00
R6625:Sim1 UTSW 10 50983986 missense probably benign
R6783:Sim1 UTSW 10 50908727 missense possibly damaging 0.72
R6876:Sim1 UTSW 10 50983695 missense possibly damaging 0.77
R6909:Sim1 UTSW 10 50909410 missense possibly damaging 0.92
R6924:Sim1 UTSW 10 50908539 missense probably benign 0.10
R7016:Sim1 UTSW 10 50984250 missense probably benign 0.03
R7135:Sim1 UTSW 10 50895927 missense probably damaging 0.99
R7149:Sim1 UTSW 10 50909540 missense probably damaging 1.00
R7300:Sim1 UTSW 10 50909518 missense probably benign 0.23
R7750:Sim1 UTSW 10 50896035 missense possibly damaging 0.94
Predicted Primers PCR Primer
(F):5'- GATGTAGGTCGAGGTCACTG -3'
(R):5'- TATCCGAGACAGTGCAGTGG -3'

Sequencing Primer
(F):5'- CACTGGGATGAAGATAGTGTGGTC -3'
(R):5'- CATGAGGGCTGAGCATCTTTCC -3'
Posted On2015-12-21