Mutagenetix > Incidental Mutations

Incidental Mutation 'R4781:Olfr1375'

366525

Institutional Source

Beutler Lab

Gene Symbol

Olfr1375

Ensembl Gene

ENSMUSG00000057890

Gene Name

olfactory receptor 1375

Synonyms

GA_x6K02T2QP88-4389999-4389056, MOR126-2, Olfr1375-ps1

MMRRC Submission

042415-MU

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.069) question?

Stock #

R4781 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

51048109-51049050 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to T at 51048480 bp

Zygosity

Heterozygous

Amino Acid Change

Arginine to Serine at position 124 (R124S)

Ref Sequence

ENSEMBL: ENSMUSP00000144756 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000073543]

Predicted Effect

probably damaging
Transcript: ENSMUST00000073543
AA Change: R124S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000073233
Gene: ENSMUSG00000057890
AA Change: R124S

Domain	Start	End	E-Value	Type
Pfam:7tm_4	33	309	6.4e-60	PFAM
Pfam:7TM_GPCR_Srsx	37	306	3.9e-6	PFAM
Pfam:7tm_1	43	291	9.5e-26	PFAM

Predicted Effect

probably damaging
Transcript: ENSMUST00000073543
AA Change: R124S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000144756
Gene: ENSMUSG00000057890
AA Change: R124S

Domain	Start	End	E-Value	Type
Pfam:7tm_4	33	309	6.4e-60	PFAM
Pfam:7TM_GPCR_Srsx	37	306	3.9e-6	PFAM
Pfam:7tm_1	43	291	9.5e-26	PFAM

Coding Region Coverage

1x: 99.2%
3x: 98.6%
10x: 97.2%
20x: 95.0%

Validation Efficiency

100% (74/74)

MGI Phenotype

FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]

Allele List at MGI

Other mutations in this stock

Total: 66 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2310022A10Rik	T	A	7: 27,571,651	I157N	probably damaging	Het
Adgrl3	T	C	5: 81,760,724	Y1165H	probably damaging	Het
Adra2a	A	G	19: 54,046,495	D94G	probably damaging	Het
Akr1c20	T	A	13: 4,508,175	K197*	probably null	Het
Ankrd65	C	T	4: 155,793,036	H335Y	possibly damaging	Het
Axin2	T	A	11: 108,943,856	L636Q	probably damaging	Het
BC147527	A	C	13: 120,308,162	K6T	possibly damaging	Het
Camk1g	G	T	1: 193,356,344	T90N	probably benign	Het
Cd177	C	A	7: 24,750,626	C528F	probably damaging	Het
Cntnap5a	A	T	1: 116,412,201	D730V	possibly damaging	Het
Crtap	T	C	9: 114,386,236	D195G	probably benign	Het
Csn1s2b	A	G	5: 87,819,093	S74G	possibly damaging	Het
Cyp3a16	T	C	5: 145,456,112	R128G	possibly damaging	Het
Dnah7a	A	G	1: 53,425,208	F3675L	probably benign	Het
Dram2	T	A	3: 106,571,676	W195R	probably damaging	Het
E130308A19Rik	C	T	4: 59,691,057	P297L	probably benign	Het
Eif3i	T	C	4: 129,595,273	S83G	probably benign	Het
Gabra1	G	A	11: 42,133,661	P396S	probably damaging	Het
Gipr	T	A	7: 19,157,375	Y459F	possibly damaging	Het
Gm11677	C	T	11: 111,724,711		noncoding transcript	Het
Gm6981	T	C	9: 52,002,756		noncoding transcript	Het
Grin2d	T	C	7: 45,862,481	D180G	probably damaging	Het
Hectd4	T	G	5: 121,306,107		probably null	Het
Hhat	T	C	1: 192,686,979		probably benign	Het
Hoxa6	A	G	6: 52,206,420	L215P	possibly damaging	Het
Hsf4	G	A	8: 105,274,752		probably null	Het
Igf1r	G	A	7: 68,165,199	A283T	possibly damaging	Het
Ighv15-2	A	G	12: 114,564,856	S25P	probably damaging	Het
Inpp5a	C	T	7: 139,478,005	T43I	probably benign	Het
Kmt2c	T	A	5: 25,443,825	E82V	probably damaging	Het
Lrrc31	A	G	3: 30,687,377		probably benign	Het
Mdga2	A	G	12: 66,797,622		probably null	Het
Mefv	G	A	16: 3,715,334	P358S	probably benign	Het
Mrgpra9	A	G	7: 47,235,047	F291L	possibly damaging	Het
Mtmr3	A	G	11: 4,488,435	L673P	probably benign	Het
Muc19	T	C	15: 91,903,166		noncoding transcript	Het
Myo5b	A	T	18: 74,744,681	T1584S	possibly damaging	Het
Olfr1427	T	C	19: 12,099,367	T91A	probably benign	Het
Palld	G	T	8: 61,877,028	R272S	probably benign	Het
Pcnx3	T	A	19: 5,687,130	N144Y	probably damaging	Het
Prf1	A	G	10: 61,300,424	K160E	probably damaging	Het
Rasgrp1	G	A	2: 117,291,709	A400V	probably benign	Het
Rnf150	A	G	8: 82,864,152	Y48C	probably damaging	Het
Rpl11	G	T	4: 136,050,288	Q170K	probably benign	Het
Scin	G	A	12: 40,081,764	A257V	possibly damaging	Het
Scn7a	C	A	2: 66,703,760	A524S	possibly damaging	Het
Sim1	T	C	10: 50,983,785	L581S	probably benign	Het
Skor1	T	C	9: 63,144,459	T715A	probably benign	Het
Slc22a26	A	G	19: 7,790,135	V301A	probably benign	Het
Sorcs1	T	C	19: 50,182,681	Y923C	probably damaging	Het
Src	T	A	2: 157,467,485	M304K	possibly damaging	Het
Srgap3	A	T	6: 112,757,425		probably benign	Het
Stard3	G	A	11: 98,372,334	E72K	possibly damaging	Het
Svep1	T	A	4: 58,070,340	N2482I	probably damaging	Het
Tbc1d23	T	C	16: 57,218,415	K20R	possibly damaging	Het
Tfip11	G	A	5: 112,333,399	E414K	probably damaging	Het
Tinag	G	T	9: 76,996,950	T397K	possibly damaging	Het
Traf7	C	G	17: 24,510,438		probably benign	Het
Trmt10b	T	A	4: 45,305,817	I164N	probably damaging	Het
Trpm1	A	G	7: 64,235,052	D827G	probably benign	Het
Ube2u	A	T	4: 100,486,658	T85S	probably benign	Het
Ulk4	T	C	9: 121,103,576	D1066G	probably benign	Het
Vmn2r72	T	A	7: 85,737,861	I832F	probably benign	Het
Yipf1	A	C	4: 107,336,158	E80D	probably benign	Het
Zfp40	T	A	17: 23,175,655	R653W	probably damaging	Het
Zxdc	A	G	6: 90,372,553	T308A	probably damaging	Het

Other mutations in Olfr1375

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00092:Olfr1375	APN	11	51048400	missense	probably benign	0.00
R0268:Olfr1375	UTSW	11	51048941	missense	probably damaging	1.00
R0462:Olfr1375	UTSW	11	51048509	missense	probably damaging	1.00
R0478:Olfr1375	UTSW	11	51048712	missense	probably benign	0.03
R0839:Olfr1375	UTSW	11	51048427	missense	probably benign	0.06
R2517:Olfr1375	UTSW	11	51048473	missense	probably damaging	1.00
R4688:Olfr1375	UTSW	11	51048988	missense	probably damaging	1.00
R5396:Olfr1375	UTSW	11	51048470	missense	probably damaging	1.00
R6163:Olfr1375	UTSW	11	51048768	nonsense	probably null
R6739:Olfr1375	UTSW	11	51048737	missense	probably damaging	0.97
R7344:Olfr1375	UTSW	11	51048295	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- TGGGAACACACTCATCTTCCTG -3'
(R):5'- AGGCCAACTTCATGAGCAGG -3'

Sequencing Primer
(F):5'- GGCCATCATCTCCGACCC -3'
(R):5'- TTCATGAGCAGGTAAGCATCAC -3'

Posted On

2015-12-29