Incidental Mutation 'R4781:Gm11677'
ID 366528
Institutional Source Beutler Lab
Gene Symbol Gm11677
Ensembl Gene ENSMUSG00000081666
Gene Name predicted gene 11677
Synonyms
MMRRC Submission 042415-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.192) question?
Stock # R4781 (G1)
Quality Score 225
Status Validated
Chromosome 11
Chromosomal Location 111615474-111616450 bp(-) (GRCm39)
Type of Mutation exon
DNA Base Change (assembly) C to T at 111615537 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change
Gene Model predicted gene model for transcript(s):
AlphaFold no structure available at present
Predicted Effect noncoding transcript
Transcript: ENSMUST00000121349
Meta Mutation Damage Score 0.0869 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.0%
Validation Efficiency 100% (74/74)
Allele List at MGI
Other mutations in this stock
Total: 66 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310022A10Rik T A 7: 27,271,076 (GRCm39) I157N probably damaging Het
Adgrl3 T C 5: 81,908,571 (GRCm39) Y1165H probably damaging Het
Adra2a A G 19: 54,034,926 (GRCm39) D94G probably damaging Het
Akr1c20 T A 13: 4,558,174 (GRCm39) K197* probably null Het
Ankrd65 C T 4: 155,877,493 (GRCm39) H335Y possibly damaging Het
Axin2 T A 11: 108,834,682 (GRCm39) L636Q probably damaging Het
Camk1g G T 1: 193,038,652 (GRCm39) T90N probably benign Het
Cd177 C A 7: 24,450,051 (GRCm39) C528F probably damaging Het
Cntnap5a A T 1: 116,339,931 (GRCm39) D730V possibly damaging Het
Crtap T C 9: 114,215,304 (GRCm39) D195G probably benign Het
Csn1s2b A G 5: 87,966,952 (GRCm39) S74G possibly damaging Het
Cyp3a16 T C 5: 145,392,922 (GRCm39) R128G possibly damaging Het
Dnah7a A G 1: 53,464,367 (GRCm39) F3675L probably benign Het
Dram2 T A 3: 106,478,992 (GRCm39) W195R probably damaging Het
E130308A19Rik C T 4: 59,691,057 (GRCm39) P297L probably benign Het
Eif3i T C 4: 129,489,066 (GRCm39) S83G probably benign Het
Gabra1 G A 11: 42,024,488 (GRCm39) P396S probably damaging Het
Gipr T A 7: 18,891,300 (GRCm39) Y459F possibly damaging Het
Gm6981 T C 9: 51,914,056 (GRCm39) noncoding transcript Het
Grin2d T C 7: 45,511,905 (GRCm39) D180G probably damaging Het
Hectd4 T G 5: 121,444,170 (GRCm39) probably null Het
Hhat T C 1: 192,369,287 (GRCm39) probably benign Het
Hoxa6 A G 6: 52,183,400 (GRCm39) L215P possibly damaging Het
Hsf4 G A 8: 106,001,384 (GRCm39) probably null Het
Igf1r G A 7: 67,814,947 (GRCm39) A283T possibly damaging Het
Ighv15-2 A G 12: 114,528,476 (GRCm39) S25P probably damaging Het
Inpp5a C T 7: 139,057,921 (GRCm39) T43I probably benign Het
Kmt2c T A 5: 25,648,823 (GRCm39) E82V probably damaging Het
Lrrc31 A G 3: 30,741,526 (GRCm39) probably benign Het
Mdga2 A G 12: 66,844,396 (GRCm39) probably null Het
Mefv G A 16: 3,533,198 (GRCm39) P358S probably benign Het
Mrgpra9 A G 7: 46,884,795 (GRCm39) F291L possibly damaging Het
Mtmr3 A G 11: 4,438,435 (GRCm39) L673P probably benign Het
Muc19 T C 15: 91,787,360 (GRCm39) noncoding transcript Het
Myo5b A T 18: 74,877,752 (GRCm39) T1584S possibly damaging Het
Or1x6 A T 11: 50,939,307 (GRCm39) R124S probably damaging Het
Or4z4 T C 19: 12,076,731 (GRCm39) T91A probably benign Het
Palld G T 8: 62,330,062 (GRCm39) R272S probably benign Het
Pcnx3 T A 19: 5,737,158 (GRCm39) N144Y probably damaging Het
Prf1 A G 10: 61,136,203 (GRCm39) K160E probably damaging Het
Rasgrp1 G A 2: 117,122,190 (GRCm39) A400V probably benign Het
Rnf150 A G 8: 83,590,781 (GRCm39) Y48C probably damaging Het
Rpl11 G T 4: 135,777,599 (GRCm39) Q170K probably benign Het
Scin G A 12: 40,131,763 (GRCm39) A257V possibly damaging Het
Scn7a C A 2: 66,534,104 (GRCm39) A524S possibly damaging Het
Sim1 T C 10: 50,859,881 (GRCm39) L581S probably benign Het
Skor1 T C 9: 63,051,741 (GRCm39) T715A probably benign Het
Slc22a26 A G 19: 7,767,500 (GRCm39) V301A probably benign Het
Sorcs1 T C 19: 50,171,119 (GRCm39) Y923C probably damaging Het
Src T A 2: 157,309,405 (GRCm39) M304K possibly damaging Het
Srgap3 A T 6: 112,734,386 (GRCm39) probably benign Het
Stard3 G A 11: 98,263,160 (GRCm39) E72K possibly damaging Het
Svep1 T A 4: 58,070,340 (GRCm39) N2482I probably damaging Het
Tbc1d23 T C 16: 57,038,778 (GRCm39) K20R possibly damaging Het
Tcstv4 A C 13: 120,769,698 (GRCm39) K6T possibly damaging Het
Tfip11 G A 5: 112,481,265 (GRCm39) E414K probably damaging Het
Tinag G T 9: 76,904,232 (GRCm39) T397K possibly damaging Het
Traf7 C G 17: 24,729,412 (GRCm39) probably benign Het
Trmt10b T A 4: 45,305,817 (GRCm39) I164N probably damaging Het
Trpm1 A G 7: 63,884,800 (GRCm39) D827G probably benign Het
Ube2u A T 4: 100,343,855 (GRCm39) T85S probably benign Het
Ulk4 T C 9: 120,932,642 (GRCm39) D1066G probably benign Het
Vmn2r72 T A 7: 85,387,069 (GRCm39) I832F probably benign Het
Yipf1 A C 4: 107,193,355 (GRCm39) E80D probably benign Het
Zfp40 T A 17: 23,394,629 (GRCm39) R653W probably damaging Het
Zxdc A G 6: 90,349,535 (GRCm39) T308A probably damaging Het
Other mutations in Gm11677
AlleleSourceChrCoordTypePredicted EffectPPH Score
R4778:Gm11677 UTSW 11 111,615,537 (GRCm39) exon noncoding transcript
R4779:Gm11677 UTSW 11 111,615,537 (GRCm39) exon noncoding transcript
R5058:Gm11677 UTSW 11 111,616,264 (GRCm39) exon noncoding transcript
R5219:Gm11677 UTSW 11 111,616,225 (GRCm39) exon noncoding transcript
R5271:Gm11677 UTSW 11 111,615,537 (GRCm39) exon noncoding transcript
R5724:Gm11677 UTSW 11 111,615,537 (GRCm39) exon noncoding transcript
R5817:Gm11677 UTSW 11 111,615,537 (GRCm39) exon noncoding transcript
R5818:Gm11677 UTSW 11 111,615,537 (GRCm39) exon noncoding transcript
Predicted Primers PCR Primer
(F):5'- CCACTCAGGCTGATAACCTC -3'
(R):5'- AGAAGCAGTTCAGCAAGACC -3'

Sequencing Primer
(F):5'- CCCTTTGCATAACGAGTACAGTAGG -3'
(R):5'- TTCACACTGGGGAGAAGCCATTC -3'
Posted On 2015-12-29