Mutagenetix > Incidental Mutation

Incidental Mutation 'R4781:Scin'

366529

Institutional Source

Beutler Lab

Gene Symbol

Scin

Ensembl Gene

ENSMUSG00000002565

Gene Name

scinderin

Synonyms

adseverin

MMRRC Submission

042415-MU

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R4781 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

40059769-40134228 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

G to A at 40081764 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Alanine to Valine at position 257 (A257V)

Ref Sequence

ENSEMBL: ENSMUSP00000077573 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000002640] [ENSMUST00000078481]

AlphaFold

Q60604

Predicted Effect

possibly damaging
Transcript: ENSMUST00000002640
AA Change: A257V

PolyPhen 2 Score 0.594 (Sensitivity: 0.87; Specificity: 0.91)

SMART Domains

Protein: ENSMUSP00000002640
Gene: ENSMUSG00000002565
AA Change: A257V

Domain	Start	End	E-Value	Type
GEL	17	114	3.44e-26	SMART
GEL	135	227	3.92e-30	SMART
low complexity region	232	242	N/A	INTRINSIC
GEL	252	347	6.56e-32	SMART
GEL	396	489	7.72e-29	SMART
GEL	510	596	2.33e-23	SMART
GEL	615	710	2.07e-29	SMART

Predicted Effect

possibly damaging
Transcript: ENSMUST00000078481
AA Change: A257V

PolyPhen 2 Score 0.594 (Sensitivity: 0.87; Specificity: 0.91)

SMART Domains

Protein: ENSMUSP00000077573
Gene: ENSMUSG00000002565
AA Change: A257V

Domain	Start	End	E-Value	Type
GEL	17	114	3.44e-26	SMART
GEL	135	227	3.92e-30	SMART
low complexity region	232	242	N/A	INTRINSIC
GEL	252	347	6.56e-32	SMART
GEL	396	489	7.72e-29	SMART
GEL	510	610	1.09e-28	SMART

Meta Mutation Damage Score

0.1130

Coding Region Coverage

1x: 99.2%
3x: 98.6%
10x: 97.2%
20x: 95.0%

Validation Efficiency

100% (74/74)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] SCIN is a Ca(2+)-dependent actin-severing and -capping protein (Zunino et al., 2001 [PubMed 11568009]).[supplied by OMIM, May 2010]
PHENOTYPE: Mice homozygous for a conditional allele knocked-out in osteoclasts exhibit impaired osteoclast differentiation and reduced peridontal disease-mediated bone loss. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 66 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2310022A10Rik	T	A	7: 27,571,651	I157N	probably damaging	Het
Adgrl3	T	C	5: 81,760,724	Y1165H	probably damaging	Het
Adra2a	A	G	19: 54,046,495	D94G	probably damaging	Het
Akr1c20	T	A	13: 4,508,175	K197*	probably null	Het
Ankrd65	C	T	4: 155,793,036	H335Y	possibly damaging	Het
Axin2	T	A	11: 108,943,856	L636Q	probably damaging	Het
BC147527	A	C	13: 120,308,162	K6T	possibly damaging	Het
Camk1g	G	T	1: 193,356,344	T90N	probably benign	Het
Cd177	C	A	7: 24,750,626	C528F	probably damaging	Het
Cntnap5a	A	T	1: 116,412,201	D730V	possibly damaging	Het
Crtap	T	C	9: 114,386,236	D195G	probably benign	Het
Csn1s2b	A	G	5: 87,819,093	S74G	possibly damaging	Het
Cyp3a16	T	C	5: 145,456,112	R128G	possibly damaging	Het
Dnah7a	A	G	1: 53,425,208	F3675L	probably benign	Het
Dram2	T	A	3: 106,571,676	W195R	probably damaging	Het
E130308A19Rik	C	T	4: 59,691,057	P297L	probably benign	Het
Eif3i	T	C	4: 129,595,273	S83G	probably benign	Het
Gabra1	G	A	11: 42,133,661	P396S	probably damaging	Het
Gipr	T	A	7: 19,157,375	Y459F	possibly damaging	Het
Gm11677	C	T	11: 111,724,711		noncoding transcript	Het
Gm6981	T	C	9: 52,002,756		noncoding transcript	Het
Grin2d	T	C	7: 45,862,481	D180G	probably damaging	Het
Hectd4	T	G	5: 121,306,107		probably null	Het
Hhat	T	C	1: 192,686,979		probably benign	Het
Hoxa6	A	G	6: 52,206,420	L215P	possibly damaging	Het
Hsf4	G	A	8: 105,274,752		probably null	Het
Igf1r	G	A	7: 68,165,199	A283T	possibly damaging	Het
Ighv15-2	A	G	12: 114,564,856	S25P	probably damaging	Het
Inpp5a	C	T	7: 139,478,005	T43I	probably benign	Het
Kmt2c	T	A	5: 25,443,825	E82V	probably damaging	Het
Lrrc31	A	G	3: 30,687,377		probably benign	Het
Mdga2	A	G	12: 66,797,622		probably null	Het
Mefv	G	A	16: 3,715,334	P358S	probably benign	Het
Mrgpra9	A	G	7: 47,235,047	F291L	possibly damaging	Het
Mtmr3	A	G	11: 4,488,435	L673P	probably benign	Het
Muc19	T	C	15: 91,903,166		noncoding transcript	Het
Myo5b	A	T	18: 74,744,681	T1584S	possibly damaging	Het
Olfr1375	A	T	11: 51,048,480	R124S	probably damaging	Het
Olfr1427	T	C	19: 12,099,367	T91A	probably benign	Het
Palld	G	T	8: 61,877,028	R272S	probably benign	Het
Pcnx3	T	A	19: 5,687,130	N144Y	probably damaging	Het
Prf1	A	G	10: 61,300,424	K160E	probably damaging	Het
Rasgrp1	G	A	2: 117,291,709	A400V	probably benign	Het
Rnf150	A	G	8: 82,864,152	Y48C	probably damaging	Het
Rpl11	G	T	4: 136,050,288	Q170K	probably benign	Het
Scn7a	C	A	2: 66,703,760	A524S	possibly damaging	Het
Sim1	T	C	10: 50,983,785	L581S	probably benign	Het
Skor1	T	C	9: 63,144,459	T715A	probably benign	Het
Slc22a26	A	G	19: 7,790,135	V301A	probably benign	Het
Sorcs1	T	C	19: 50,182,681	Y923C	probably damaging	Het
Src	T	A	2: 157,467,485	M304K	possibly damaging	Het
Srgap3	A	T	6: 112,757,425		probably benign	Het
Stard3	G	A	11: 98,372,334	E72K	possibly damaging	Het
Svep1	T	A	4: 58,070,340	N2482I	probably damaging	Het
Tbc1d23	T	C	16: 57,218,415	K20R	possibly damaging	Het
Tfip11	G	A	5: 112,333,399	E414K	probably damaging	Het
Tinag	G	T	9: 76,996,950	T397K	possibly damaging	Het
Traf7	C	G	17: 24,510,438		probably benign	Het
Trmt10b	T	A	4: 45,305,817	I164N	probably damaging	Het
Trpm1	A	G	7: 64,235,052	D827G	probably benign	Het
Ube2u	A	T	4: 100,486,658	T85S	probably benign	Het
Ulk4	T	C	9: 121,103,576	D1066G	probably benign	Het
Vmn2r72	T	A	7: 85,737,861	I832F	probably benign	Het
Yipf1	A	C	4: 107,336,158	E80D	probably benign	Het
Zfp40	T	A	17: 23,175,655	R653W	probably damaging	Het
Zxdc	A	G	6: 90,372,553	T308A	probably damaging	Het

Other mutations in Scin

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00163:Scin	APN	12	40076972	missense	probably benign	0.03
IGL01414:Scin	APN	12	40124699	missense	probably damaging	1.00
IGL01790:Scin	APN	12	40063257	missense	probably benign	0.02
IGL01807:Scin	APN	12	40084289	missense	probably damaging	1.00
IGL01946:Scin	APN	12	40060491	utr 3 prime	probably benign
IGL02040:Scin	APN	12	40069453	intron	probably benign
IGL02391:Scin	APN	12	40077531	missense	probably benign	0.05
IGL03221:Scin	APN	12	40076974	missense	probably benign	0.01
I1329:Scin	UTSW	12	40073330	missense	probably damaging	0.99
PIT4498001:Scin	UTSW	12	40069447	critical splice acceptor site	probably null
R0108:Scin	UTSW	12	40127987	missense	possibly damaging	0.68
R0470:Scin	UTSW	12	40073292	splice site	probably benign
R0477:Scin	UTSW	12	40060516	missense	probably damaging	1.00
R0538:Scin	UTSW	12	40081771	missense	probably damaging	0.98
R0539:Scin	UTSW	12	40081766	missense	possibly damaging	0.65
R0591:Scin	UTSW	12	40080930	critical splice donor site	probably null
R0668:Scin	UTSW	12	40080949	missense	probably damaging	1.00
R0718:Scin	UTSW	12	40079607	missense	probably damaging	1.00
R1473:Scin	UTSW	12	40077502	missense	probably benign
R1566:Scin	UTSW	12	40081674	missense	probably benign	0.17
R1570:Scin	UTSW	12	40084381	splice site	probably benign
R1624:Scin	UTSW	12	40127930	missense	probably benign
R1827:Scin	UTSW	12	40068923	missense	possibly damaging	0.88
R1836:Scin	UTSW	12	40124698	missense	probably damaging	1.00
R1985:Scin	UTSW	12	40133908	critical splice donor site	probably null
R2042:Scin	UTSW	12	40077510	missense	possibly damaging	0.96
R2061:Scin	UTSW	12	40080948	missense	probably damaging	1.00
R2147:Scin	UTSW	12	40080985	missense	probably benign	0.00
R2232:Scin	UTSW	12	40068931	missense	probably damaging	1.00
R2504:Scin	UTSW	12	40081706	missense	probably benign	0.02
R4898:Scin	UTSW	12	40104932	missense	probably benign
R4914:Scin	UTSW	12	40069374	missense	possibly damaging	0.79
R4915:Scin	UTSW	12	40069374	missense	possibly damaging	0.79
R4916:Scin	UTSW	12	40069374	missense	possibly damaging	0.79
R4917:Scin	UTSW	12	40069374	missense	possibly damaging	0.79
R4918:Scin	UTSW	12	40069374	missense	possibly damaging	0.79
R5068:Scin	UTSW	12	40124700	missense	probably damaging	1.00
R5098:Scin	UTSW	12	40077542	nonsense	probably null
R5233:Scin	UTSW	12	40077559	missense	probably benign
R5564:Scin	UTSW	12	40124569	missense	probably benign
R5677:Scin	UTSW	12	40063259	missense	probably damaging	1.00
R5967:Scin	UTSW	12	40077538	missense	probably benign	0.35
R6027:Scin	UTSW	12	40077516	missense	probably damaging	1.00
R6130:Scin	UTSW	12	40069436	missense	probably benign	0.01
R6134:Scin	UTSW	12	40060579	missense	probably damaging	1.00
R6135:Scin	UTSW	12	40079808	missense	possibly damaging	0.80
R6439:Scin	UTSW	12	40068946	missense	probably damaging	0.99
R6613:Scin	UTSW	12	40079715	missense	probably benign	0.04
R7127:Scin	UTSW	12	40105072	missense	possibly damaging	0.69
R7234:Scin	UTSW	12	40080958	nonsense	probably null
R7431:Scin	UTSW	12	40133922	missense	probably damaging	1.00
R7609:Scin	UTSW	12	40124589	missense	probably damaging	1.00
R7665:Scin	UTSW	12	40069415	missense	probably damaging	1.00
R7704:Scin	UTSW	12	40124688	missense	possibly damaging	0.93
R7904:Scin	UTSW	12	40077000	missense	probably damaging	1.00
R7995:Scin	UTSW	12	40079805	missense	probably benign	0.00
R8323:Scin	UTSW	12	40079682	missense	probably benign	0.00
R8489:Scin	UTSW	12	40081020	missense	probably damaging	1.00
R8556:Scin	UTSW	12	40077594	critical splice acceptor site	probably null
R8915:Scin	UTSW	12	40073433	missense	probably damaging	1.00
R9063:Scin	UTSW	12	40084337	missense	possibly damaging	0.49
R9089:Scin	UTSW	12	40081704	nonsense	probably null
R9139:Scin	UTSW	12	40063237	missense	possibly damaging	0.75
R9457:Scin	UTSW	12	40104958	missense	possibly damaging	0.86
R9592:Scin	UTSW	12	40081747	missense	probably benign	0.01
X0018:Scin	UTSW	12	40069433	missense	probably damaging	1.00
Z1176:Scin	UTSW	12	40079604	missense	probably benign	0.37

Predicted Primers

PCR Primer
(F):5'- TCTTTCACCTCCTAGGAAGAGAAC -3'
(R):5'- ACAAAAGTGCTTGGGGTGC -3'

Sequencing Primer
(F):5'- CTCCTAGGAAGAGAACATCAGATCTG -3'
(R):5'- CCAGGGATGCTTTGCCTCTG -3'

Posted On

2015-12-29