Incidental Mutation 'R4781:Traf7'
ID 366537
Institutional Source Beutler Lab
Gene Symbol Traf7
Ensembl Gene ENSMUSG00000052752
Gene Name TNF receptor-associated factor 7
Synonyms RFWD1
MMRRC Submission 042415-MU
Accession Numbers
Essential gene? Possibly essential (E-score: 0.644) question?
Stock # R4781 (G1)
Quality Score 225
Status Validated
Chromosome 17
Chromosomal Location 24727824-24746912 bp(-) (GRCm39)
Type of Mutation unclassified
DNA Base Change (assembly) C to G at 24729412 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change
Gene Model predicted gene model for transcript(s): [ENSMUST00000024958] [ENSMUST00000070777] [ENSMUST00000088464] [ENSMUST00000176086] [ENSMUST00000176324] [ENSMUST00000176353] [ENSMUST00000176178] [ENSMUST00000176652] [ENSMUST00000176668] [ENSMUST00000176237] [ENSMUST00000177025] [ENSMUST00000177154] [ENSMUST00000177193] [ENSMUST00000177401] [ENSMUST00000177405]
AlphaFold no structure available at present
Predicted Effect probably benign
Transcript: ENSMUST00000024958
SMART Domains Protein: ENSMUSP00000024958
Gene: ENSMUSG00000033597

DomainStartEndE-ValueType
ANK 48 77 9.93e-5 SMART
ANK 81 110 1.9e-1 SMART
ANK 114 143 1.51e-4 SMART
ANK 147 176 1.15e0 SMART
ANK 188 217 2.6e-8 SMART
ANK 220 249 3.31e-1 SMART
SH3 284 346 3.62e-5 SMART
Pfam:Caskin1-CID 373 421 3e-26 PFAM
SAM 473 539 3.63e-15 SMART
SAM 542 609 5.41e-14 SMART
low complexity region 631 647 N/A INTRINSIC
low complexity region 667 679 N/A INTRINSIC
low complexity region 715 724 N/A INTRINSIC
low complexity region 841 863 N/A INTRINSIC
Pfam:Caskin-Pro-rich 878 966 3e-37 PFAM
low complexity region 1163 1168 N/A INTRINSIC
low complexity region 1190 1216 N/A INTRINSIC
low complexity region 1222 1232 N/A INTRINSIC
low complexity region 1269 1288 N/A INTRINSIC
low complexity region 1294 1312 N/A INTRINSIC
low complexity region 1315 1333 N/A INTRINSIC
low complexity region 1344 1359 N/A INTRINSIC
Pfam:Caskin-tail 1369 1431 7.2e-33 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000070777
SMART Domains Protein: ENSMUSP00000069334
Gene: ENSMUSG00000052752

DomainStartEndE-ValueType
low complexity region 31 44 N/A INTRINSIC
RING 92 125 4.73e-6 SMART
coiled coil region 264 332 N/A INTRINSIC
WD40 344 383 8.35e-11 SMART
WD40 387 424 8.42e-7 SMART
WD40 427 463 2.09e-2 SMART
WD40 468 504 1.92e0 SMART
WD40 507 544 5.15e-2 SMART
WD40 547 588 1.78e-5 SMART
WD40 591 628 1.63e-4 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000088464
SMART Domains Protein: ENSMUSP00000085812
Gene: ENSMUSG00000052752

DomainStartEndE-ValueType
low complexity region 31 44 N/A INTRINSIC
low complexity region 90 104 N/A INTRINSIC
low complexity region 109 117 N/A INTRINSIC
RING 130 163 4.73e-6 SMART
Pfam:zf-TRAF 221 277 3.4e-8 PFAM
coiled coil region 304 372 N/A INTRINSIC
WD40 384 423 8.35e-11 SMART
WD40 427 464 8.42e-7 SMART
WD40 467 503 2.09e-2 SMART
WD40 508 544 1.92e0 SMART
WD40 547 584 5.15e-2 SMART
WD40 587 628 1.78e-5 SMART
WD40 631 668 1.63e-4 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000175698
Predicted Effect noncoding transcript
Transcript: ENSMUST00000175732
Predicted Effect probably benign
Transcript: ENSMUST00000176086
SMART Domains Protein: ENSMUSP00000135845
Gene: ENSMUSG00000052752

DomainStartEndE-ValueType
low complexity region 103 132 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000176530
Predicted Effect noncoding transcript
Transcript: ENSMUST00000176805
Predicted Effect noncoding transcript
Transcript: ENSMUST00000177024
Predicted Effect noncoding transcript
Transcript: ENSMUST00000176633
Predicted Effect noncoding transcript
Transcript: ENSMUST00000176900
Predicted Effect probably benign
Transcript: ENSMUST00000176324
Predicted Effect probably benign
Transcript: ENSMUST00000176353
SMART Domains Protein: ENSMUSP00000135267
Gene: ENSMUSG00000052752

DomainStartEndE-ValueType
low complexity region 31 44 N/A INTRINSIC
RING 92 125 4.73e-6 SMART
coiled coil region 264 332 N/A INTRINSIC
WD40 344 383 8.35e-11 SMART
WD40 387 424 8.42e-7 SMART
WD40 427 463 2.09e-2 SMART
WD40 468 504 1.92e0 SMART
WD40 507 544 5.15e-2 SMART
WD40 547 588 1.78e-5 SMART
WD40 591 628 1.63e-4 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000176178
SMART Domains Protein: ENSMUSP00000134808
Gene: ENSMUSG00000052752

DomainStartEndE-ValueType
low complexity region 31 44 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000176652
SMART Domains Protein: ENSMUSP00000134759
Gene: ENSMUSG00000052752

DomainStartEndE-ValueType
low complexity region 31 44 N/A INTRINSIC
low complexity region 90 104 N/A INTRINSIC
low complexity region 109 117 N/A INTRINSIC
RING 130 163 4.73e-6 SMART
coiled coil region 304 372 N/A INTRINSIC
WD40 384 423 8.35e-11 SMART
WD40 427 464 8.42e-7 SMART
WD40 467 503 2.09e-2 SMART
WD40 508 544 1.92e0 SMART
WD40 547 584 5.15e-2 SMART
WD40 587 628 1.78e-5 SMART
WD40 631 668 1.63e-4 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000176668
SMART Domains Protein: ENSMUSP00000135586
Gene: ENSMUSG00000052752

DomainStartEndE-ValueType
low complexity region 31 44 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000176237
SMART Domains Protein: ENSMUSP00000134946
Gene: ENSMUSG00000052752

DomainStartEndE-ValueType
low complexity region 31 44 N/A INTRINSIC
RING 91 124 4.73e-6 SMART
Pfam:zf-TRAF 182 238 8.4e-9 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000177025
Predicted Effect probably benign
Transcript: ENSMUST00000177154
SMART Domains Protein: ENSMUSP00000135874
Gene: ENSMUSG00000052752

DomainStartEndE-ValueType
low complexity region 31 44 N/A INTRINSIC
low complexity region 91 105 N/A INTRINSIC
low complexity region 110 118 N/A INTRINSIC
RING 131 164 4.73e-6 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000177193
SMART Domains Protein: ENSMUSP00000135288
Gene: ENSMUSG00000052752

DomainStartEndE-ValueType
low complexity region 31 44 N/A INTRINSIC
low complexity region 90 104 N/A INTRINSIC
low complexity region 109 117 N/A INTRINSIC
RING 130 163 4.73e-6 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000177401
Predicted Effect probably benign
Transcript: ENSMUST00000177405
SMART Domains Protein: ENSMUSP00000135127
Gene: ENSMUSG00000052752

DomainStartEndE-ValueType
low complexity region 31 44 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000177502
SMART Domains Protein: ENSMUSP00000134970
Gene: ENSMUSG00000052752

DomainStartEndE-ValueType
low complexity region 3 11 N/A INTRINSIC
RING 24 68 4.24e-2 SMART
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.0%
Validation Efficiency 100% (74/74)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Tumor necrosis factor (TNF; see MIM 191160) receptor-associated factors, such as TRAF7, are signal transducers for members of the TNF receptor superfamily (see MIM 191190). TRAFs are composed of an N-terminal cysteine/histidine-rich region containing zinc RING and/or zinc finger motifs; a coiled-coil (leucine zipper) motif; and a homologous region that defines the TRAF family, the TRAF domain, which is involved in self-association and receptor binding.[supplied by OMIM, Apr 2004]
Allele List at MGI
Other mutations in this stock
Total: 66 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310022A10Rik T A 7: 27,271,076 (GRCm39) I157N probably damaging Het
Adgrl3 T C 5: 81,908,571 (GRCm39) Y1165H probably damaging Het
Adra2a A G 19: 54,034,926 (GRCm39) D94G probably damaging Het
Akr1c20 T A 13: 4,558,174 (GRCm39) K197* probably null Het
Ankrd65 C T 4: 155,877,493 (GRCm39) H335Y possibly damaging Het
Axin2 T A 11: 108,834,682 (GRCm39) L636Q probably damaging Het
Camk1g G T 1: 193,038,652 (GRCm39) T90N probably benign Het
Cd177 C A 7: 24,450,051 (GRCm39) C528F probably damaging Het
Cntnap5a A T 1: 116,339,931 (GRCm39) D730V possibly damaging Het
Crtap T C 9: 114,215,304 (GRCm39) D195G probably benign Het
Csn1s2b A G 5: 87,966,952 (GRCm39) S74G possibly damaging Het
Cyp3a16 T C 5: 145,392,922 (GRCm39) R128G possibly damaging Het
Dnah7a A G 1: 53,464,367 (GRCm39) F3675L probably benign Het
Dram2 T A 3: 106,478,992 (GRCm39) W195R probably damaging Het
E130308A19Rik C T 4: 59,691,057 (GRCm39) P297L probably benign Het
Eif3i T C 4: 129,489,066 (GRCm39) S83G probably benign Het
Gabra1 G A 11: 42,024,488 (GRCm39) P396S probably damaging Het
Gipr T A 7: 18,891,300 (GRCm39) Y459F possibly damaging Het
Gm11677 C T 11: 111,615,537 (GRCm39) noncoding transcript Het
Gm6981 T C 9: 51,914,056 (GRCm39) noncoding transcript Het
Grin2d T C 7: 45,511,905 (GRCm39) D180G probably damaging Het
Hectd4 T G 5: 121,444,170 (GRCm39) probably null Het
Hhat T C 1: 192,369,287 (GRCm39) probably benign Het
Hoxa6 A G 6: 52,183,400 (GRCm39) L215P possibly damaging Het
Hsf4 G A 8: 106,001,384 (GRCm39) probably null Het
Igf1r G A 7: 67,814,947 (GRCm39) A283T possibly damaging Het
Ighv15-2 A G 12: 114,528,476 (GRCm39) S25P probably damaging Het
Inpp5a C T 7: 139,057,921 (GRCm39) T43I probably benign Het
Kmt2c T A 5: 25,648,823 (GRCm39) E82V probably damaging Het
Lrrc31 A G 3: 30,741,526 (GRCm39) probably benign Het
Mdga2 A G 12: 66,844,396 (GRCm39) probably null Het
Mefv G A 16: 3,533,198 (GRCm39) P358S probably benign Het
Mrgpra9 A G 7: 46,884,795 (GRCm39) F291L possibly damaging Het
Mtmr3 A G 11: 4,438,435 (GRCm39) L673P probably benign Het
Muc19 T C 15: 91,787,360 (GRCm39) noncoding transcript Het
Myo5b A T 18: 74,877,752 (GRCm39) T1584S possibly damaging Het
Or1x6 A T 11: 50,939,307 (GRCm39) R124S probably damaging Het
Or4z4 T C 19: 12,076,731 (GRCm39) T91A probably benign Het
Palld G T 8: 62,330,062 (GRCm39) R272S probably benign Het
Pcnx3 T A 19: 5,737,158 (GRCm39) N144Y probably damaging Het
Prf1 A G 10: 61,136,203 (GRCm39) K160E probably damaging Het
Rasgrp1 G A 2: 117,122,190 (GRCm39) A400V probably benign Het
Rnf150 A G 8: 83,590,781 (GRCm39) Y48C probably damaging Het
Rpl11 G T 4: 135,777,599 (GRCm39) Q170K probably benign Het
Scin G A 12: 40,131,763 (GRCm39) A257V possibly damaging Het
Scn7a C A 2: 66,534,104 (GRCm39) A524S possibly damaging Het
Sim1 T C 10: 50,859,881 (GRCm39) L581S probably benign Het
Skor1 T C 9: 63,051,741 (GRCm39) T715A probably benign Het
Slc22a26 A G 19: 7,767,500 (GRCm39) V301A probably benign Het
Sorcs1 T C 19: 50,171,119 (GRCm39) Y923C probably damaging Het
Src T A 2: 157,309,405 (GRCm39) M304K possibly damaging Het
Srgap3 A T 6: 112,734,386 (GRCm39) probably benign Het
Stard3 G A 11: 98,263,160 (GRCm39) E72K possibly damaging Het
Svep1 T A 4: 58,070,340 (GRCm39) N2482I probably damaging Het
Tbc1d23 T C 16: 57,038,778 (GRCm39) K20R possibly damaging Het
Tcstv4 A C 13: 120,769,698 (GRCm39) K6T possibly damaging Het
Tfip11 G A 5: 112,481,265 (GRCm39) E414K probably damaging Het
Tinag G T 9: 76,904,232 (GRCm39) T397K possibly damaging Het
Trmt10b T A 4: 45,305,817 (GRCm39) I164N probably damaging Het
Trpm1 A G 7: 63,884,800 (GRCm39) D827G probably benign Het
Ube2u A T 4: 100,343,855 (GRCm39) T85S probably benign Het
Ulk4 T C 9: 120,932,642 (GRCm39) D1066G probably benign Het
Vmn2r72 T A 7: 85,387,069 (GRCm39) I832F probably benign Het
Yipf1 A C 4: 107,193,355 (GRCm39) E80D probably benign Het
Zfp40 T A 17: 23,394,629 (GRCm39) R653W probably damaging Het
Zxdc A G 6: 90,349,535 (GRCm39) T308A probably damaging Het
Other mutations in Traf7
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01674:Traf7 APN 17 24,729,349 (GRCm39) unclassified probably benign
IGL01821:Traf7 APN 17 24,729,473 (GRCm39) missense probably damaging 0.99
IGL02263:Traf7 APN 17 24,732,020 (GRCm39) missense possibly damaging 0.47
IGL02307:Traf7 APN 17 24,732,020 (GRCm39) missense possibly damaging 0.47
IGL02321:Traf7 APN 17 24,732,020 (GRCm39) missense possibly damaging 0.47
IGL02323:Traf7 APN 17 24,732,020 (GRCm39) missense possibly damaging 0.47
IGL02636:Traf7 APN 17 24,731,964 (GRCm39) missense probably benign
Antediluvian UTSW 17 24,729,015 (GRCm39) missense probably damaging 1.00
Caveman UTSW 17 24,728,519 (GRCm39) missense probably damaging 1.00
Oldhat UTSW 17 24,731,266 (GRCm39) missense probably benign 0.28
R0109:Traf7 UTSW 17 24,732,900 (GRCm39) missense probably benign 0.12
R0109:Traf7 UTSW 17 24,732,900 (GRCm39) missense probably benign 0.12
R0193:Traf7 UTSW 17 24,729,525 (GRCm39) missense probably benign 0.22
R1426:Traf7 UTSW 17 24,730,655 (GRCm39) missense probably damaging 1.00
R1484:Traf7 UTSW 17 24,730,785 (GRCm39) missense possibly damaging 0.86
R1574:Traf7 UTSW 17 24,729,527 (GRCm39) missense probably damaging 1.00
R1574:Traf7 UTSW 17 24,729,527 (GRCm39) missense probably damaging 1.00
R1728:Traf7 UTSW 17 24,731,353 (GRCm39) missense probably damaging 0.98
R1729:Traf7 UTSW 17 24,731,353 (GRCm39) missense probably damaging 0.98
R1784:Traf7 UTSW 17 24,731,353 (GRCm39) missense probably damaging 0.98
R1959:Traf7 UTSW 17 24,732,255 (GRCm39) missense probably damaging 1.00
R1994:Traf7 UTSW 17 24,729,476 (GRCm39) missense probably damaging 0.99
R2484:Traf7 UTSW 17 24,730,613 (GRCm39) missense probably damaging 1.00
R4682:Traf7 UTSW 17 24,732,348 (GRCm39) missense probably damaging 1.00
R4778:Traf7 UTSW 17 24,729,412 (GRCm39) unclassified probably benign
R4779:Traf7 UTSW 17 24,729,412 (GRCm39) unclassified probably benign
R5120:Traf7 UTSW 17 24,737,718 (GRCm39) nonsense probably null
R6594:Traf7 UTSW 17 24,728,813 (GRCm39) missense possibly damaging 0.92
R6885:Traf7 UTSW 17 24,731,266 (GRCm39) missense probably benign 0.28
R7396:Traf7 UTSW 17 24,728,519 (GRCm39) missense probably damaging 1.00
R7669:Traf7 UTSW 17 24,732,282 (GRCm39) nonsense probably null
R7707:Traf7 UTSW 17 24,729,683 (GRCm39) splice site probably null
R8087:Traf7 UTSW 17 24,731,038 (GRCm39) missense possibly damaging 0.69
R8557:Traf7 UTSW 17 24,729,015 (GRCm39) missense probably damaging 1.00
R8932:Traf7 UTSW 17 24,731,286 (GRCm39) missense probably damaging 1.00
R9457:Traf7 UTSW 17 24,746,737 (GRCm39) critical splice donor site probably benign
R9539:Traf7 UTSW 17 24,729,333 (GRCm39) missense probably damaging 0.98
R9679:Traf7 UTSW 17 24,746,737 (GRCm39) critical splice donor site probably benign
R9680:Traf7 UTSW 17 24,746,737 (GRCm39) critical splice donor site probably benign
Z1177:Traf7 UTSW 17 24,728,546 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AAGAGCCACTGTACAGATAGC -3'
(R):5'- ACCATCATTGTGAGTGGGCAC -3'

Sequencing Primer
(F):5'- CTCTGTGCTGCCACCAG -3'
(R):5'- CGAGAAGACCCATTGCTCTTTC -3'
Posted On 2015-12-29