Mutagenetix > Incidental Mutation

Incidental Mutation 'R4782:Irs1'

366550

Institutional Source

Beutler Lab

Gene Symbol

Irs1

Ensembl Gene

ENSMUSG00000055980

Gene Name

insulin receptor substrate 1

Synonyms

G972R, IRS-1

Accession Numbers

Essential gene?

Possibly essential (E-score: 0.622) question?

Stock #

R4782 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

82233101-82291416 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 82287463 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Threonine to Alanine at position 1011 (T1011A)

Ref Sequence

ENSEMBL: ENSMUSP00000063795 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000069799]

AlphaFold

no structure available at present

Predicted Effect

probably benign
Transcript: ENSMUST00000069799
AA Change: T1011A

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)

SMART Domains

Protein: ENSMUSP00000063795
Gene: ENSMUSG00000055980
AA Change: T1011A

Domain	Start	End	E-Value	Type
PH	13	117	8.13e-14	SMART
low complexity region	123	143	N/A	INTRINSIC
IRS	155	257	1.19e-35	SMART
PTBI	155	257	7.8e-60	SMART
low complexity region	263	276	N/A	INTRINSIC
low complexity region	378	399	N/A	INTRINSIC
low complexity region	407	419	N/A	INTRINSIC
low complexity region	551	568	N/A	INTRINSIC
low complexity region	662	689	N/A	INTRINSIC
low complexity region	784	794	N/A	INTRINSIC
low complexity region	801	810	N/A	INTRINSIC
low complexity region	824	837	N/A	INTRINSIC
low complexity region	1019	1040	N/A	INTRINSIC
low complexity region	1051	1062	N/A	INTRINSIC
low complexity region	1111	1127	N/A	INTRINSIC
low complexity region	1185	1200	N/A	INTRINSIC

Coding Region Coverage

1x: 99.2%
3x: 98.5%
10x: 96.9%
20x: 94.4%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein which is phosphorylated by insulin receptor tyrosine kinase. Mutations in this gene are associated with type II diabetes and susceptibility to insulin resistance. [provided by RefSeq, Nov 2009]
PHENOTYPE: Homozygotes for targeted null mutations exhibit 50 percent reductions in body weights at birth and at 4 months of age, impaired glucose tolerance, and mild insulin and IGF-1 resistance. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 121 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abca13	A	G	11: 9,328,096	E3092G	probably damaging	Het
Abhd12b	C	G	12: 70,169,064	S170C	probably damaging	Het
Abtb2	A	T	2: 103,717,299	D1006V	probably benign	Het
Adgrl1	A	G	8: 83,935,573	H1021R	probably benign	Het
Ago3	A	T	4: 126,347,872		probably null	Het
Ahnak	A	G	19: 9,012,499		probably benign	Het
Akap6	CA	C	12: 52,887,623		probably null	Het
Amotl2	T	G	9: 102,720,123		probably null	Het
Ankrd34b	T	A	13: 92,438,305	I15N	probably damaging	Het
Ap3d1	C	T	10: 80,721,586		probably null	Het
Appl2	A	T	10: 83,600,991	D635E	probably damaging	Het
Arid1b	C	T	17: 5,339,221	P1681S	probably damaging	Het
Atp10a	T	C	7: 58,791,095	M496T	probably benign	Het
Atp2c2	A	G	8: 119,749,152	K595E	probably damaging	Het
Atpaf2	T	C	11: 60,404,412	H204R	probably damaging	Het
Atr	G	A	9: 95,862,797	V56I	probably benign	Het
Bod1l	G	A	5: 41,833,663	T183I	probably benign	Het
Btbd11	A	C	10: 85,654,550	I1027L	probably damaging	Het
Ccdc171	A	T	4: 83,681,016	E689D	probably damaging	Het
Cdc73	T	A	1: 143,627,875	Q346L	probably benign	Het
Chd2	A	T	7: 73,484,436	M721K	possibly damaging	Het
Col22a1	T	A	15: 71,801,925	T981S	unknown	Het
Col4a3bp	T	C	13: 96,612,265	V281A	probably benign	Het
Cpox	G	A	16: 58,672,623	A207T	probably damaging	Het
Cym	G	A	3: 107,216,097	T160I	possibly damaging	Het
D130043K22Rik	T	C	13: 24,878,040	I664T	probably damaging	Het
Ddx4	C	T	13: 112,613,696		probably null	Het
Ddx4	A	T	13: 112,651,360	V15E	probably benign	Het
Depdc1a	G	A	3: 159,526,636	E675K	probably damaging	Het
Dglucy	A	T	12: 100,850,343	M415L	probably benign	Het
Dlg4	C	T	11: 70,026,954	P21L	probably damaging	Het
Dmxl1	A	T	18: 49,862,992	N395I	probably damaging	Het
Dzank1	A	T	2: 144,504,399	C249S	probably damaging	Het
Efnb2	A	T	8: 8,623,104		probably null	Het
Ercc6l2	T	G	13: 63,834,738	I244S	probably damaging	Het
Ewsr1	A	T	11: 5,070,423	M584K	unknown	Het
Fam193b	A	G	13: 55,543,471	S197P	probably damaging	Het
Fanca	A	G	8: 123,288,202	V689A	probably damaging	Het
Fbxo31	A	T	8: 121,552,439	Y436*	probably null	Het
Fbxo31	A	G	8: 121,552,441	Y436H	probably damaging	Het
Fcna	T	A	2: 25,625,326	D215V	probably damaging	Het
Foxj3	A	T	4: 119,621,660	S438C	unknown	Het
Gcm2	T	C	13: 41,103,494	K260E	possibly damaging	Het
Gcnt4	A	T	13: 96,947,406	L403F	possibly damaging	Het
Gdf10	A	G	14: 33,931,913	T126A	probably benign	Het
Ggcx	A	G	6: 72,428,892	K569E	probably benign	Het
Gm10250	C	T	15: 5,121,096		probably benign	Het
Gm8251	T	C	1: 44,059,043	D965G	possibly damaging	Het
Gpnmb	G	T	6: 49,045,483		probably null	Het
Ifi44	G	A	3: 151,745,592	P241S	probably damaging	Het
Jag2	A	T	12: 112,914,249	S595T	probably benign	Het
Kif5a	T	A	10: 127,230,954	Q960L	probably benign	Het
Kifc2	A	G	15: 76,664,348	E430G	possibly damaging	Het
Lama3	T	A	18: 12,411,570	C323*	probably null	Het
Lgsn	T	C	1: 31,203,742	Y302H	probably benign	Het
Lmbrd1	G	A	1: 24,744,975		probably null	Het
Lrpap1	A	G	5: 35,099,278	V120A	probably damaging	Het
Macrod2	T	A	2: 140,419,938	D46E	possibly damaging	Het
Mbd4	C	A	6: 115,845,322	R63L	possibly damaging	Het
Mfsd10	T	C	5: 34,634,949		probably benign	Het
Mib2	G	T	4: 155,659,772	S144R	probably benign	Het
Muc5b	T	A	7: 141,847,716	C566*	probably null	Het
Ndufs1	C	A	1: 63,160,949	G268V	probably damaging	Het
Nfs1	A	G	2: 156,134,449	V175A	possibly damaging	Het
Ngb	G	A	12: 87,100,225	H73Y	probably benign	Het
Npepps	G	A	11: 97,226,826	T549I	probably damaging	Het
Nr1h2	A	G	7: 44,550,499	V329A	possibly damaging	Het
Nsun6	T	C	2: 15,036,326	I151M	possibly damaging	Het
Ofcc1	T	C	13: 40,001,892		probably null	Het
Olfr1388	T	A	11: 49,443,869	F6Y	probably benign	Het
Olfr262	C	T	19: 12,241,572	V30I	probably benign	Het
Olfr372	A	G	8: 72,058,094	N138S	probably benign	Het
Olfr391-ps	C	T	11: 73,798,839	C306Y	probably benign	Het
Olfr555	T	A	7: 102,658,834	N4K	possibly damaging	Het
Olfr910	A	G	9: 38,539,075	Y60C	probably damaging	Het
Parp6	A	G	9: 59,634,984		probably null	Het
Pcnt	C	A	10: 76,409,577	R1075S	possibly damaging	Het
Pla2g4f	T	C	2: 120,303,276	E548G	probably damaging	Het
Polrmt	G	T	10: 79,739,523	H725N	probably benign	Het
Pou2f3	T	C	9: 43,139,858	T178A	probably damaging	Het
Prtn3	C	A	10: 79,882,065	P169H	probably damaging	Het
Ptprd	A	G	4: 76,091,532	I764T	probably benign	Het
Ptprh	A	T	7: 4,569,577	H467Q	probably benign	Het
Raph1	A	T	1: 60,489,114	I996N	probably damaging	Het
Rasa4	G	A	5: 136,091,229	W53*	probably null	Het
Rasgrp1	C	T	2: 117,284,875	R744Q	probably benign	Het
Rmnd5a	T	C	6: 71,413,349	E141G	probably damaging	Het
Rps12	T	C	10: 23,786,790	I51M	possibly damaging	Het
Scn10a	T	G	9: 119,622,910	S1316R	possibly damaging	Het
Sdhb	A	G	4: 140,977,466	H246R	possibly damaging	Het
Setx	G	A	2: 29,144,046	R332Q	probably damaging	Het
Siglec1	A	C	2: 131,075,923	S1011R	probably damaging	Het
Sin3b	A	C	8: 72,725,643	I126L	probably benign	Het
Slc11a1	T	G	1: 74,384,088	L366R	probably damaging	Het
Slc12a1	C	T	2: 125,161,079	R177*	probably null	Het
Slc30a1	A	C	1: 191,909,048	K269Q	probably benign	Het
Slco1a5	T	C	6: 142,248,807	Y370C	possibly damaging	Het
Slf2	T	A	19: 44,934,925		probably null	Het
Sltm	A	G	9: 70,589,057	H958R	probably damaging	Het
Snrnp40	A	G	4: 130,362,756	I91M	probably damaging	Het
Spta1	A	T	1: 174,230,666	Q1900L	probably benign	Het
Srgn	C	T	10: 62,497,852	E49K	possibly damaging	Het
Ssu2	A	C	6: 112,376,450	C238G	probably damaging	Het
Terf2	G	T	8: 107,076,675	H425Q	probably benign	Het
Thra	G	A	11: 98,756,164	S37N	probably benign	Het
Toporsl	A	G	4: 52,610,845	D246G	probably damaging	Het
Ubap2l	G	A	3: 90,020,903	T553M	probably damaging	Het
Usp10	A	G	8: 119,941,191	Y77C	probably benign	Het
Utrn	T	C	10: 12,750,069	T123A	probably damaging	Het
Vmn1r204	T	G	13: 22,556,697	F166C	probably benign	Het
Vmn2r14	T	C	5: 109,221,504	I68V	probably benign	Het
Wls	C	T	3: 159,897,445	T165I	probably benign	Het
Wsb1	A	G	11: 79,240,373	M399T	probably benign	Het
Xbp1	C	T	11: 5,521,167	T58M	probably damaging	Het
Zbtb46	A	T	2: 181,391,136	D577E	probably benign	Het
Zfp366	A	G	13: 99,246,483	D718G	probably damaging	Het
Zfp408	A	T	2: 91,645,024	V595E	possibly damaging	Het
Zfp493	T	A	13: 67,786,203	W60R	probably null	Het
Zfp606	A	T	7: 12,494,005	K626N	probably damaging	Het
Zfp820	A	T	17: 21,818,985	L454Q	probably benign	Het
Zswim5	A	G	4: 116,972,972	I515V	probably benign	Het

Other mutations in Irs1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00325:Irs1	APN	1	82288483	missense	probably benign	0.01
IGL00534:Irs1	APN	1	82288471	missense	probably benign
IGL01926:Irs1	APN	1	82289959	missense	probably damaging	0.98
IGL02130:Irs1	APN	1	82289467	missense	probably damaging	1.00
IGL03338:Irs1	APN	1	82288401	missense	probably benign	0.05
Hoverboard	UTSW	1	82290098	nonsense	probably null
runt	UTSW	1	82287732	frame shift	probably null
runt2	UTSW	1	82286967	nonsense	probably null
Sprite	UTSW	1	82288109	nonsense	probably null
R0019:Irs1	UTSW	1	82287256	nonsense	probably null
R0063:Irs1	UTSW	1	82288859	missense	probably damaging	1.00
R0063:Irs1	UTSW	1	82288859	missense	probably damaging	1.00
R0318:Irs1	UTSW	1	82288660	missense	probably benign	0.01
R1199:Irs1	UTSW	1	82289626	missense	probably damaging	1.00
R1363:Irs1	UTSW	1	82287288	missense	probably benign	0.02
R1584:Irs1	UTSW	1	82289444	missense	probably benign	0.24
R1874:Irs1	UTSW	1	82289853	frame shift	probably null
R1903:Irs1	UTSW	1	82289461	missense	probably damaging	1.00
R1929:Irs1	UTSW	1	82288459	missense	probably benign
R1986:Irs1	UTSW	1	82288765	missense	probably damaging	1.00
R2136:Irs1	UTSW	1	82290042	missense	probably damaging	1.00
R2179:Irs1	UTSW	1	82290219	missense	possibly damaging	0.81
R2271:Irs1	UTSW	1	82288459	missense	probably benign
R2760:Irs1	UTSW	1	82288570	missense	probably damaging	1.00
R3721:Irs1	UTSW	1	82290085	missense	probably benign	0.11
R3821:Irs1	UTSW	1	82290049	missense	probably benign
R4306:Irs1	UTSW	1	82287964	missense	probably benign	0.11
R4420:Irs1	UTSW	1	82288450	missense	possibly damaging	0.94
R4451:Irs1	UTSW	1	82289028	missense	probably benign	0.00
R4479:Irs1	UTSW	1	82287294	missense	probably damaging	1.00
R4771:Irs1	UTSW	1	82287975	missense	probably benign	0.00
R4836:Irs1	UTSW	1	82287732	frame shift	probably null
R4880:Irs1	UTSW	1	82287732	frame shift	probably null
R4881:Irs1	UTSW	1	82287732	frame shift	probably null
R5031:Irs1	UTSW	1	82286967	nonsense	probably null
R5053:Irs1	UTSW	1	82286922	missense	probably benign
R5418:Irs1	UTSW	1	82288770	missense	probably damaging	1.00
R5595:Irs1	UTSW	1	82289925	missense	probably damaging	1.00
R5698:Irs1	UTSW	1	82288734	missense	probably benign	0.01
R6381:Irs1	UTSW	1	82287684	missense	possibly damaging	0.66
R6563:Irs1	UTSW	1	82288407	missense	probably damaging	0.98
R7002:Irs1	UTSW	1	82288260	missense	probably benign	0.13
R7095:Irs1	UTSW	1	82290098	nonsense	probably null
R7195:Irs1	UTSW	1	82287456	missense	probably benign	0.13
R7216:Irs1	UTSW	1	82289755	missense	probably damaging	0.98
R7361:Irs1	UTSW	1	82289114	nonsense	probably null
R7490:Irs1	UTSW	1	82287264	missense	probably damaging	0.99
R7540:Irs1	UTSW	1	82288002	missense	not run
R7706:Irs1	UTSW	1	82287691	missense	probably damaging	1.00
R7910:Irs1	UTSW	1	82290081	missense	probably benign	0.06
R7912:Irs1	UTSW	1	82289884	missense	probably benign
R7962:Irs1	UTSW	1	82288722	missense	possibly damaging	0.57
R8139:Irs1	UTSW	1	82289739	missense	probably damaging	1.00
R8158:Irs1	UTSW	1	82289533	missense	probably damaging	1.00
R8159:Irs1	UTSW	1	82288569	missense	probably damaging	1.00
R8187:Irs1	UTSW	1	82288300	missense	probably damaging	1.00
R8288:Irs1	UTSW	1	82287961	nonsense	probably null
R8436:Irs1	UTSW	1	82290249	missense	possibly damaging	0.96
R8865:Irs1	UTSW	1	82288109	nonsense	probably null
R8950:Irs1	UTSW	1	82286931	missense	probably benign
R9591:Irs1	UTSW	1	82288248	missense	probably benign	0.00
X0063:Irs1	UTSW	1	82288908	missense	probably damaging	1.00
X0065:Irs1	UTSW	1	82289365	missense	probably damaging	1.00
Z1177:Irs1	UTSW	1	82288996	missense	possibly damaging	0.87
Z1177:Irs1	UTSW	1	82290394	missense	probably benign	0.29

Predicted Primers

PCR Primer
(F):5'- ACCCTGGTGAATGCACTCATG -3'
(R):5'- ATGAACATGGACTTGGGGC -3'

Sequencing Primer
(F):5'- ACTCATGCCCCCAGGTC -3'
(R):5'- CCTGGCAGGAGAGTGGTG -3'

Posted On

2015-12-29