Incidental Mutation 'R0411:Otoa'
ID36660
Institutional Source Beutler Lab
Gene Symbol Otoa
Ensembl Gene ENSMUSG00000034990
Gene Nameotoancorin
Synonyms
MMRRC Submission 038613-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R0411 (G1)
Quality Score225
Status Validated
Chromosome7
Chromosomal Location121081650-121163097 bp(+) (GRCm38)
Type of Mutationcritical splice donor site (2 bp from exon)
DNA Base Change (assembly) T to C at 121156527 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000044177 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000047025] [ENSMUST00000047025] [ENSMUST00000047025] [ENSMUST00000047025] [ENSMUST00000163275] [ENSMUST00000163275] [ENSMUST00000163275] [ENSMUST00000163275]
Predicted Effect probably null
Transcript: ENSMUST00000047025
SMART Domains Protein: ENSMUSP00000044177
Gene: ENSMUSG00000034990

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
low complexity region 896 908 N/A INTRINSIC
low complexity region 1072 1089 N/A INTRINSIC
low complexity region 1124 1133 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000047025
SMART Domains Protein: ENSMUSP00000044177
Gene: ENSMUSG00000034990

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
low complexity region 896 908 N/A INTRINSIC
low complexity region 1072 1089 N/A INTRINSIC
low complexity region 1124 1133 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000047025
SMART Domains Protein: ENSMUSP00000044177
Gene: ENSMUSG00000034990

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
low complexity region 896 908 N/A INTRINSIC
low complexity region 1072 1089 N/A INTRINSIC
low complexity region 1124 1133 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000047025
SMART Domains Protein: ENSMUSP00000044177
Gene: ENSMUSG00000034990

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
low complexity region 896 908 N/A INTRINSIC
low complexity region 1072 1089 N/A INTRINSIC
low complexity region 1124 1133 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000163275
Predicted Effect probably benign
Transcript: ENSMUST00000163275
Predicted Effect probably benign
Transcript: ENSMUST00000163275
Predicted Effect probably benign
Transcript: ENSMUST00000163275
Predicted Effect probably benign
Transcript: ENSMUST00000165409
Predicted Effect probably benign
Transcript: ENSMUST00000165409
Predicted Effect probably benign
Transcript: ENSMUST00000165409
Predicted Effect probably benign
Transcript: ENSMUST00000165409
Meta Mutation Damage Score 0.9755 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 95.0%
Validation Efficiency 97% (66/68)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is specifically expressed in the inner ear, and is located at the interface between the apical surface of the inner ear sensory epithelia and their overlying acellular gels. It is prposed that this protein is involved in the attachment of the inner ear acellular gels to the apical surface of the underlying nonsensory cells. Mutations in this gene are associated with autosomal recessive deafness type 22 (DFNB22). Alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Sep 2009]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit hearing loss, detachment of the tectorial membrane from the spiral limbus, abnormal tectorial membrane morphology, absence of Hensen's stripe and increased cochlear nerve coumpond action potential threshold. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 66 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
0610040J01Rik A G 5: 63,896,491 probably benign Het
6030469F06Rik A T 12: 31,184,731 noncoding transcript Het
Acad11 T C 9: 104,116,296 F541L probably damaging Het
Acin1 G T 14: 54,646,774 R92S probably damaging Het
Appl1 A G 14: 26,940,256 S490P probably benign Het
Aqp9 C A 9: 71,130,444 V184L probably benign Het
Arih1 A T 9: 59,485,983 I122N possibly damaging Het
Bmi1 T C 2: 18,683,172 probably benign Het
Bmpr1a G A 14: 34,415,877 T391I possibly damaging Het
Cacna1s A G 1: 136,113,303 K1256E probably damaging Het
Cacng3 C T 7: 122,768,572 P225L probably damaging Het
Cd101 A T 3: 101,018,527 probably null Het
Cd55 A G 1: 130,462,557 probably benign Het
Cenpe T C 3: 135,222,255 I258T probably damaging Het
Cma2 A G 14: 55,973,678 probably benign Het
Ddost T A 4: 138,309,653 S176T probably benign Het
Ddx19b A T 8: 111,023,964 probably null Het
Dmxl2 A G 9: 54,378,939 I2681T probably damaging Het
Ern1 C T 11: 106,398,586 E964K probably benign Het
Galntl5 C T 5: 25,220,174 R430C probably benign Het
Gga3 A G 11: 115,587,433 L511P probably damaging Het
Gm7271 G T 5: 76,500,487 V47L possibly damaging Het
Gria2 C T 3: 80,710,858 probably benign Het
Hmbs A T 9: 44,341,652 L28* probably null Het
Iffo2 A G 4: 139,603,221 E220G probably damaging Het
Ifi30 A G 8: 70,764,918 probably benign Het
Irf2 T A 8: 46,846,061 C297S probably benign Het
Izumo4 T C 10: 80,703,084 Y94H probably damaging Het
Klhdc9 A G 1: 171,359,785 V215A probably benign Het
Kmt2a T C 9: 44,819,964 probably benign Het
Kmt2c A T 5: 25,375,957 C513S probably damaging Het
Lyg1 A T 1: 37,949,896 M81K possibly damaging Het
Maip1 T G 1: 57,415,693 W279G probably damaging Het
Myo7a T C 7: 98,071,937 T1263A probably benign Het
Naa15 T A 3: 51,465,639 I701N possibly damaging Het
Ncoa3 A G 2: 166,068,543 N1292S probably benign Het
Necab2 T A 8: 119,454,240 probably benign Het
Nfatc1 T A 18: 80,698,042 I234F possibly damaging Het
Olfm1 G A 2: 28,208,211 R95K possibly damaging Het
Olfr1118 A G 2: 87,309,058 T90A probably benign Het
Olfr1329 A T 4: 118,916,626 N280K possibly damaging Het
Padi4 GCTGCGTACCTCCAC GC 4: 140,748,449 probably benign Het
Pard6g A G 18: 80,117,122 D150G probably damaging Het
Pax5 A G 4: 44,609,783 L215S probably damaging Het
Pja2 A T 17: 64,287,521 probably benign Het
Plk4 T A 3: 40,811,219 probably benign Het
Polr1a A T 6: 71,978,421 H1687L possibly damaging Het
Ptcd2 G A 13: 99,343,391 L41F probably damaging Het
Ropn1 T A 16: 34,669,964 S62T probably benign Het
Setd1a T C 7: 127,796,051 probably benign Het
Setdb1 T C 3: 95,327,686 D902G probably damaging Het
Sik3 T A 9: 46,208,770 L719Q probably damaging Het
Slc36a1 G T 11: 55,232,507 V433F probably benign Het
Slc6a3 T C 13: 73,557,050 V220A possibly damaging Het
Slc6a5 A T 7: 49,911,791 R24W probably damaging Het
Smox G T 2: 131,520,644 R281L probably benign Het
Sulf2 G T 2: 166,093,516 H226N probably damaging Het
Syne2 C T 12: 76,059,584 probably null Het
Tenm3 C T 8: 48,287,791 S1210N possibly damaging Het
Tns1 A T 1: 73,925,761 V1237E probably damaging Het
Trf C T 9: 103,217,501 V92M probably damaging Het
Ttn A G 2: 76,709,373 V34423A possibly damaging Het
Vmn2r118 A G 17: 55,611,021 probably benign Het
Vmn2r19 A G 6: 123,309,744 Y112C probably damaging Het
Wdr66 C T 5: 123,290,054 T538M probably damaging Het
Zfp326 G T 5: 105,878,775 A15S possibly damaging Het
Other mutations in Otoa
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01469:Otoa APN 7 121155273 critical splice donor site probably null
IGL01791:Otoa APN 7 121155849 missense probably benign 0.25
IGL01924:Otoa APN 7 121105968 missense probably damaging 0.99
IGL01953:Otoa APN 7 121160325 splice site probably null
IGL02121:Otoa APN 7 121122024 missense probably benign 0.06
IGL02303:Otoa APN 7 121132924 critical splice donor site probably null
IGL02390:Otoa APN 7 121131367 missense possibly damaging 0.84
IGL02591:Otoa APN 7 121155830 missense probably damaging 1.00
IGL02811:Otoa APN 7 121118655 missense possibly damaging 0.60
IGL02878:Otoa APN 7 121143853 missense probably damaging 1.00
IGL03328:Otoa APN 7 121110994 missense probably damaging 0.98
R0056:Otoa UTSW 7 121131347 missense probably benign 0.00
R0279:Otoa UTSW 7 121111079 splice site probably benign
R0390:Otoa UTSW 7 121131341 missense probably benign 0.07
R0628:Otoa UTSW 7 121145650 splice site probably benign
R1113:Otoa UTSW 7 121125443 nonsense probably null
R1240:Otoa UTSW 7 121156490 missense probably benign
R1308:Otoa UTSW 7 121125443 nonsense probably null
R1692:Otoa UTSW 7 121091551 missense probably damaging 0.99
R1728:Otoa UTSW 7 121125439 missense probably benign 0.36
R1729:Otoa UTSW 7 121125439 missense probably benign 0.36
R1744:Otoa UTSW 7 121127776 splice site probably benign
R1759:Otoa UTSW 7 121134103 missense probably damaging 1.00
R1784:Otoa UTSW 7 121125439 missense probably benign 0.36
R1817:Otoa UTSW 7 121160530 utr 3 prime probably benign
R1961:Otoa UTSW 7 121118569 missense probably benign 0.05
R2061:Otoa UTSW 7 121131328 missense probably damaging 1.00
R2509:Otoa UTSW 7 121160472 missense probably benign
R2510:Otoa UTSW 7 121160472 missense probably benign
R3411:Otoa UTSW 7 121122043 missense probably damaging 1.00
R3438:Otoa UTSW 7 121160343 missense possibly damaging 0.80
R3905:Otoa UTSW 7 121125565 missense probably damaging 1.00
R3907:Otoa UTSW 7 121125565 missense probably damaging 1.00
R4613:Otoa UTSW 7 121145568 missense probably damaging 1.00
R4751:Otoa UTSW 7 121132924 critical splice donor site probably benign
R4896:Otoa UTSW 7 121102679 missense probably damaging 1.00
R4932:Otoa UTSW 7 121155135 missense probably damaging 0.98
R5224:Otoa UTSW 7 121139793 missense probably damaging 0.98
R5235:Otoa UTSW 7 121156470 missense probably damaging 1.00
R5595:Otoa UTSW 7 121121977 missense probably damaging 1.00
R5891:Otoa UTSW 7 121132360 splice site probably null
R5894:Otoa UTSW 7 121121869 missense probably damaging 1.00
R5905:Otoa UTSW 7 121094601 missense probably damaging 1.00
R5976:Otoa UTSW 7 121127713 missense probably benign 0.00
R6464:Otoa UTSW 7 121102605 missense probably damaging 1.00
R6761:Otoa UTSW 7 121121950 missense probably damaging 1.00
R6770:Otoa UTSW 7 121145614 missense probably benign 0.25
R6821:Otoa UTSW 7 121092847 critical splice donor site probably null
R6924:Otoa UTSW 7 121131501 intron probably null
R7016:Otoa UTSW 7 121147766 missense probably damaging 0.99
R7215:Otoa UTSW 7 121118572 missense unknown
R7313:Otoa UTSW 7 121102542 missense probably benign 0.42
R7340:Otoa UTSW 7 121130065 missense probably benign 0.38
R7443:Otoa UTSW 7 121132410 missense probably benign 0.00
R7559:Otoa UTSW 7 121143926 missense probably damaging 0.99
R7640:Otoa UTSW 7 121145626 missense probably damaging 1.00
R7654:Otoa UTSW 7 121147700 missense probably damaging 1.00
R7659:Otoa UTSW 7 121134044 missense probably benign 0.01
U24488:Otoa UTSW 7 121118540 critical splice acceptor site probably null
X0023:Otoa UTSW 7 121118571 missense probably benign 0.00
Z1177:Otoa UTSW 7 121118655 missense not run
Predicted Primers PCR Primer
(F):5'- TGAACCTCCCTCTGGGTATACACG -3'
(R):5'- TCTTCTCTGGCCCTGAAAGCAAAG -3'

Sequencing Primer
(F):5'- GTTGATTAAGGAACTGGACTCCC -3'
(R):5'- CCCTGAAAGCAAAGGGCTG -3'
Posted On2013-05-09