Mutagenetix > Incidental Mutations

Incidental Mutation 'R0411:Otoa'

36660

Institutional Source

Beutler Lab

Gene Symbol

Otoa

Ensembl Gene

ENSMUSG00000034990

Gene Name

otoancorin

Synonyms

MMRRC Submission

038613-MU

Accession Numbers

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R0411 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

121081650-121163097 bp(+) (GRCm38)

Type of Mutation

critical splice donor site (2 bp from exon)

DNA Base Change (assembly)

T to C at 121156527 bp

Zygosity

Heterozygous

Amino Acid Change

Ref Sequence

ENSEMBL: ENSMUSP00000044177 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000047025] [ENSMUST00000047025] [ENSMUST00000047025] [ENSMUST00000047025] [ENSMUST00000163275] [ENSMUST00000163275] [ENSMUST00000163275] [ENSMUST00000163275]

Predicted Effect

probably null
Transcript: ENSMUST00000047025

SMART Domains

Protein: ENSMUSP00000044177
Gene: ENSMUSG00000034990

Domain	Start	End	E-Value	Type
signal peptide	1	23	N/A	INTRINSIC
low complexity region	896	908	N/A	INTRINSIC
low complexity region	1072	1089	N/A	INTRINSIC
low complexity region	1124	1133	N/A	INTRINSIC

Predicted Effect

probably null
Transcript: ENSMUST00000047025

SMART Domains

Protein: ENSMUSP00000044177
Gene: ENSMUSG00000034990

Domain	Start	End	E-Value	Type
signal peptide	1	23	N/A	INTRINSIC
low complexity region	896	908	N/A	INTRINSIC
low complexity region	1072	1089	N/A	INTRINSIC
low complexity region	1124	1133	N/A	INTRINSIC

Predicted Effect

probably null
Transcript: ENSMUST00000047025

SMART Domains

Protein: ENSMUSP00000044177
Gene: ENSMUSG00000034990

Domain	Start	End	E-Value	Type
signal peptide	1	23	N/A	INTRINSIC
low complexity region	896	908	N/A	INTRINSIC
low complexity region	1072	1089	N/A	INTRINSIC
low complexity region	1124	1133	N/A	INTRINSIC

Predicted Effect

probably null
Transcript: ENSMUST00000047025

SMART Domains

Protein: ENSMUSP00000044177
Gene: ENSMUSG00000034990

Domain	Start	End	E-Value	Type
signal peptide	1	23	N/A	INTRINSIC
low complexity region	896	908	N/A	INTRINSIC
low complexity region	1072	1089	N/A	INTRINSIC
low complexity region	1124	1133	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000163275

Predicted Effect

probably benign
Transcript: ENSMUST00000163275

Predicted Effect

probably benign
Transcript: ENSMUST00000163275

Predicted Effect

probably benign
Transcript: ENSMUST00000163275

Predicted Effect

probably benign
Transcript: ENSMUST00000165409

Predicted Effect

probably benign
Transcript: ENSMUST00000165409

Predicted Effect

probably benign
Transcript: ENSMUST00000165409

Predicted Effect

probably benign
Transcript: ENSMUST00000165409

Meta Mutation Damage Score

0.9755

Coding Region Coverage

1x: 99.3%
3x: 98.6%
10x: 97.1%
20x: 95.0%

Validation Efficiency

97% (66/68)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is specifically expressed in the inner ear, and is located at the interface between the apical surface of the inner ear sensory epithelia and their overlying acellular gels. It is prposed that this protein is involved in the attachment of the inner ear acellular gels to the apical surface of the underlying nonsensory cells. Mutations in this gene are associated with autosomal recessive deafness type 22 (DFNB22). Alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Sep 2009]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit hearing loss, detachment of the tectorial membrane from the spiral limbus, abnormal tectorial membrane morphology, absence of Hensen's stripe and increased cochlear nerve coumpond action potential threshold. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 66 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
0610040J01Rik	A	G	5: 63,896,491		probably benign	Het
6030469F06Rik	A	T	12: 31,184,731		noncoding transcript	Het
Acad11	T	C	9: 104,116,296	F541L	probably damaging	Het
Acin1	G	T	14: 54,646,774	R92S	probably damaging	Het
Appl1	A	G	14: 26,940,256	S490P	probably benign	Het
Aqp9	C	A	9: 71,130,444	V184L	probably benign	Het
Arih1	A	T	9: 59,485,983	I122N	possibly damaging	Het
Bmi1	T	C	2: 18,683,172		probably benign	Het
Bmpr1a	G	A	14: 34,415,877	T391I	possibly damaging	Het
Cacna1s	A	G	1: 136,113,303	K1256E	probably damaging	Het
Cacng3	C	T	7: 122,768,572	P225L	probably damaging	Het
Cd101	A	T	3: 101,018,527		probably null	Het
Cd55	A	G	1: 130,462,557		probably benign	Het
Cenpe	T	C	3: 135,222,255	I258T	probably damaging	Het
Cma2	A	G	14: 55,973,678		probably benign	Het
Ddost	T	A	4: 138,309,653	S176T	probably benign	Het
Ddx19b	A	T	8: 111,023,964		probably null	Het
Dmxl2	A	G	9: 54,378,939	I2681T	probably damaging	Het
Ern1	C	T	11: 106,398,586	E964K	probably benign	Het
Galntl5	C	T	5: 25,220,174	R430C	probably benign	Het
Gga3	A	G	11: 115,587,433	L511P	probably damaging	Het
Gm7271	G	T	5: 76,500,487	V47L	possibly damaging	Het
Gria2	C	T	3: 80,710,858		probably benign	Het
Hmbs	A	T	9: 44,341,652	L28*	probably null	Het
Iffo2	A	G	4: 139,603,221	E220G	probably damaging	Het
Ifi30	A	G	8: 70,764,918		probably benign	Het
Irf2	T	A	8: 46,846,061	C297S	probably benign	Het
Izumo4	T	C	10: 80,703,084	Y94H	probably damaging	Het
Klhdc9	A	G	1: 171,359,785	V215A	probably benign	Het
Kmt2a	T	C	9: 44,819,964		probably benign	Het
Kmt2c	A	T	5: 25,375,957	C513S	probably damaging	Het
Lyg1	A	T	1: 37,949,896	M81K	possibly damaging	Het
Maip1	T	G	1: 57,415,693	W279G	probably damaging	Het
Myo7a	T	C	7: 98,071,937	T1263A	probably benign	Het
Naa15	T	A	3: 51,465,639	I701N	possibly damaging	Het
Ncoa3	A	G	2: 166,068,543	N1292S	probably benign	Het
Necab2	T	A	8: 119,454,240		probably benign	Het
Nfatc1	T	A	18: 80,698,042	I234F	possibly damaging	Het
Olfm1	G	A	2: 28,208,211	R95K	possibly damaging	Het
Olfr1118	A	G	2: 87,309,058	T90A	probably benign	Het
Olfr1329	A	T	4: 118,916,626	N280K	possibly damaging	Het
Padi4	GCTGCGTACCTCCAC	GC	4: 140,748,449		probably benign	Het
Pard6g	A	G	18: 80,117,122	D150G	probably damaging	Het
Pax5	A	G	4: 44,609,783	L215S	probably damaging	Het
Pja2	A	T	17: 64,287,521		probably benign	Het
Plk4	T	A	3: 40,811,219		probably benign	Het
Polr1a	A	T	6: 71,978,421	H1687L	possibly damaging	Het
Ptcd2	G	A	13: 99,343,391	L41F	probably damaging	Het
Ropn1	T	A	16: 34,669,964	S62T	probably benign	Het
Setd1a	T	C	7: 127,796,051		probably benign	Het
Setdb1	T	C	3: 95,327,686	D902G	probably damaging	Het
Sik3	T	A	9: 46,208,770	L719Q	probably damaging	Het
Slc36a1	G	T	11: 55,232,507	V433F	probably benign	Het
Slc6a3	T	C	13: 73,557,050	V220A	possibly damaging	Het
Slc6a5	A	T	7: 49,911,791	R24W	probably damaging	Het
Smox	G	T	2: 131,520,644	R281L	probably benign	Het
Sulf2	G	T	2: 166,093,516	H226N	probably damaging	Het
Syne2	C	T	12: 76,059,584		probably null	Het
Tenm3	C	T	8: 48,287,791	S1210N	possibly damaging	Het
Tns1	A	T	1: 73,925,761	V1237E	probably damaging	Het
Trf	C	T	9: 103,217,501	V92M	probably damaging	Het
Ttn	A	G	2: 76,709,373	V34423A	possibly damaging	Het
Vmn2r118	A	G	17: 55,611,021		probably benign	Het
Vmn2r19	A	G	6: 123,309,744	Y112C	probably damaging	Het
Wdr66	C	T	5: 123,290,054	T538M	probably damaging	Het
Zfp326	G	T	5: 105,878,775	A15S	possibly damaging	Het

Other mutations in Otoa

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01469:Otoa	APN	7	121155273	critical splice donor site	probably null
IGL01791:Otoa	APN	7	121155849	missense	probably benign	0.25
IGL01924:Otoa	APN	7	121105968	missense	probably damaging	0.99
IGL01953:Otoa	APN	7	121160325	splice site	probably null
IGL02121:Otoa	APN	7	121122024	missense	probably benign	0.06
IGL02303:Otoa	APN	7	121132924	critical splice donor site	probably null
IGL02390:Otoa	APN	7	121131367	missense	possibly damaging	0.84
IGL02591:Otoa	APN	7	121155830	missense	probably damaging	1.00
IGL02811:Otoa	APN	7	121118655	missense	possibly damaging	0.60
IGL02878:Otoa	APN	7	121143853	missense	probably damaging	1.00
IGL03328:Otoa	APN	7	121110994	missense	probably damaging	0.98
R0056:Otoa	UTSW	7	121131347	missense	probably benign	0.00
R0279:Otoa	UTSW	7	121111079	splice site	probably benign
R0390:Otoa	UTSW	7	121131341	missense	probably benign	0.07
R0628:Otoa	UTSW	7	121145650	splice site	probably benign
R1113:Otoa	UTSW	7	121125443	nonsense	probably null
R1240:Otoa	UTSW	7	121156490	missense	probably benign
R1308:Otoa	UTSW	7	121125443	nonsense	probably null
R1692:Otoa	UTSW	7	121091551	missense	probably damaging	0.99
R1728:Otoa	UTSW	7	121125439	missense	probably benign	0.36
R1729:Otoa	UTSW	7	121125439	missense	probably benign	0.36
R1744:Otoa	UTSW	7	121127776	splice site	probably benign
R1759:Otoa	UTSW	7	121134103	missense	probably damaging	1.00
R1784:Otoa	UTSW	7	121125439	missense	probably benign	0.36
R1817:Otoa	UTSW	7	121160530	utr 3 prime	probably benign
R1961:Otoa	UTSW	7	121118569	missense	probably benign	0.05
R2061:Otoa	UTSW	7	121131328	missense	probably damaging	1.00
R2509:Otoa	UTSW	7	121160472	missense	probably benign
R2510:Otoa	UTSW	7	121160472	missense	probably benign
R3411:Otoa	UTSW	7	121122043	missense	probably damaging	1.00
R3438:Otoa	UTSW	7	121160343	missense	possibly damaging	0.80
R3905:Otoa	UTSW	7	121125565	missense	probably damaging	1.00
R3907:Otoa	UTSW	7	121125565	missense	probably damaging	1.00
R4613:Otoa	UTSW	7	121145568	missense	probably damaging	1.00
R4751:Otoa	UTSW	7	121132924	critical splice donor site	probably benign
R4896:Otoa	UTSW	7	121102679	missense	probably damaging	1.00
R4932:Otoa	UTSW	7	121155135	missense	probably damaging	0.98
R5224:Otoa	UTSW	7	121139793	missense	probably damaging	0.98
R5235:Otoa	UTSW	7	121156470	missense	probably damaging	1.00
R5595:Otoa	UTSW	7	121121977	missense	probably damaging	1.00
R5891:Otoa	UTSW	7	121132360	splice site	probably null
R5894:Otoa	UTSW	7	121121869	missense	probably damaging	1.00
R5905:Otoa	UTSW	7	121094601	missense	probably damaging	1.00
R5976:Otoa	UTSW	7	121127713	missense	probably benign	0.00
R6464:Otoa	UTSW	7	121102605	missense	probably damaging	1.00
R6761:Otoa	UTSW	7	121121950	missense	probably damaging	1.00
R6770:Otoa	UTSW	7	121145614	missense	probably benign	0.25
R6821:Otoa	UTSW	7	121092847	critical splice donor site	probably null
R6924:Otoa	UTSW	7	121131501	splice site	probably null
R7016:Otoa	UTSW	7	121147766	missense	probably damaging	0.99
R7215:Otoa	UTSW	7	121118572	missense	unknown
R7313:Otoa	UTSW	7	121102542	missense	probably benign	0.42
R7340:Otoa	UTSW	7	121130065	missense	probably benign	0.38
R7443:Otoa	UTSW	7	121132410	missense	probably benign	0.00
R7559:Otoa	UTSW	7	121143926	missense	probably damaging	0.99
R7640:Otoa	UTSW	7	121145626	missense	probably damaging	1.00
R7654:Otoa	UTSW	7	121147700	missense	probably damaging	1.00
R7659:Otoa	UTSW	7	121134044	missense	probably benign	0.01
R8421:Otoa	UTSW	7	121099268	critical splice donor site	probably null
U24488:Otoa	UTSW	7	121118540	critical splice acceptor site	probably null
X0023:Otoa	UTSW	7	121118571	missense	probably benign	0.00
Z1177:Otoa	UTSW	7	121118655	missense	probably benign	0.00

Predicted Primers

PCR Primer
(F):5'- TGAACCTCCCTCTGGGTATACACG -3'
(R):5'- TCTTCTCTGGCCCTGAAAGCAAAG -3'

Sequencing Primer
(F):5'- GTTGATTAAGGAACTGGACTCCC -3'
(R):5'- CCCTGAAAGCAAAGGGCTG -3'

Posted On

2013-05-09