Incidental Mutation 'R0411:Setd1a'
ID 36662
Institutional Source Beutler Lab
Gene Symbol Setd1a
Ensembl Gene ENSMUSG00000042308
Gene Name SET domain containing 1A
Synonyms KMT2F
MMRRC Submission 038613-MU
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R0411 (G1)
Quality Score 225
Status Validated
Chromosome 7
Chromosomal Location 127376561-127399294 bp(+) (GRCm39)
Type of Mutation unclassified
DNA Base Change (assembly) T to C at 127395223 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000146308 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000046863] [ENSMUST00000047075] [ENSMUST00000047157] [ENSMUST00000106271] [ENSMUST00000106272] [ENSMUST00000154987] [ENSMUST00000125188] [ENSMUST00000206674] [ENSMUST00000155005] [ENSMUST00000138432] [ENSMUST00000139068]
AlphaFold E9PYH6
Predicted Effect probably benign
Transcript: ENSMUST00000046863
SMART Domains Protein: ENSMUSP00000036245
Gene: ENSMUSG00000042289

DomainStartEndE-ValueType
Pfam:KR 11 147 3e-10 PFAM
Pfam:RmlD_sub_bind 11 198 8.1e-10 PFAM
Pfam:Polysacc_synt_2 12 140 4.6e-13 PFAM
Pfam:NmrA 12 142 1.9e-9 PFAM
Pfam:Epimerase 12 215 3.2e-25 PFAM
Pfam:GDP_Man_Dehyd 13 185 8.1e-17 PFAM
Pfam:3Beta_HSD 13 290 5.4e-99 PFAM
Pfam:NAD_binding_4 14 240 1.4e-15 PFAM
transmembrane domain 312 334 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000047075
AA Change: V1263A
SMART Domains Protein: ENSMUSP00000047672
Gene: ENSMUSG00000042308
AA Change: V1263A

DomainStartEndE-ValueType
RRM 95 168 7.6e-6 SMART
low complexity region 209 242 N/A INTRINSIC
low complexity region 278 295 N/A INTRINSIC
low complexity region 315 357 N/A INTRINSIC
low complexity region 427 487 N/A INTRINSIC
Blast:SET 488 976 N/A BLAST
low complexity region 977 1007 N/A INTRINSIC
low complexity region 1015 1079 N/A INTRINSIC
low complexity region 1087 1098 N/A INTRINSIC
low complexity region 1122 1152 N/A INTRINSIC
low complexity region 1157 1173 N/A INTRINSIC
Blast:SET 1193 1310 2e-24 BLAST
low complexity region 1311 1368 N/A INTRINSIC
low complexity region 1369 1396 N/A INTRINSIC
N-SET 1428 1567 6.75e-64 SMART
SET 1577 1700 3.22e-35 SMART
PostSET 1700 1716 1.16e-4 SMART
Predicted Effect unknown
Transcript: ENSMUST00000047157
AA Change: V1263A
SMART Domains Protein: ENSMUSP00000037600
Gene: ENSMUSG00000042308
AA Change: V1263A

DomainStartEndE-ValueType
RRM 95 168 7.6e-6 SMART
low complexity region 209 242 N/A INTRINSIC
low complexity region 278 295 N/A INTRINSIC
low complexity region 315 357 N/A INTRINSIC
low complexity region 427 487 N/A INTRINSIC
Blast:SET 488 976 N/A BLAST
low complexity region 977 1007 N/A INTRINSIC
low complexity region 1015 1079 N/A INTRINSIC
low complexity region 1087 1098 N/A INTRINSIC
low complexity region 1122 1152 N/A INTRINSIC
low complexity region 1157 1173 N/A INTRINSIC
Blast:SET 1193 1310 2e-24 BLAST
low complexity region 1311 1368 N/A INTRINSIC
low complexity region 1369 1396 N/A INTRINSIC
N-SET 1428 1567 6.75e-64 SMART
SET 1577 1700 3.22e-35 SMART
PostSET 1700 1716 1.16e-4 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000106271
SMART Domains Protein: ENSMUSP00000101878
Gene: ENSMUSG00000042289

DomainStartEndE-ValueType
Pfam:adh_short 10 143 1.3e-13 PFAM
Pfam:RmlD_sub_bind 10 186 3.7e-10 PFAM
Pfam:KR 11 140 5.7e-10 PFAM
Pfam:Polysacc_synt_2 12 140 2.8e-13 PFAM
Pfam:NmrA 12 141 2.7e-9 PFAM
Pfam:Epimerase 12 220 2.9e-26 PFAM
Pfam:NAD_binding_10 13 186 2.3e-11 PFAM
Pfam:3Beta_HSD 13 216 1e-70 PFAM
Pfam:NAD_binding_4 14 183 1.3e-17 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000106272
SMART Domains Protein: ENSMUSP00000101879
Gene: ENSMUSG00000042289

DomainStartEndE-ValueType
Pfam:adh_short 10 143 3.7e-13 PFAM
Pfam:RmlD_sub_bind 10 180 2.8e-9 PFAM
Pfam:KR 11 139 1.6e-9 PFAM
Pfam:Polysacc_synt_2 12 140 7.7e-13 PFAM
Pfam:NmrA 12 141 7.3e-9 PFAM
Pfam:Epimerase 12 215 7.1e-26 PFAM
Pfam:NAD_binding_10 13 179 1.1e-10 PFAM
Pfam:3Beta_HSD 13 188 6.1e-70 PFAM
Pfam:NAD_binding_4 14 187 1.5e-17 PFAM
Pfam:3Beta_HSD 177 261 4e-23 PFAM
transmembrane domain 281 303 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000124631
Predicted Effect unknown
Transcript: ENSMUST00000154987
AA Change: V720A
Predicted Effect noncoding transcript
Transcript: ENSMUST00000144748
Predicted Effect noncoding transcript
Transcript: ENSMUST00000206995
Predicted Effect probably benign
Transcript: ENSMUST00000136823
Predicted Effect probably benign
Transcript: ENSMUST00000125188
Predicted Effect probably benign
Transcript: ENSMUST00000206674
Predicted Effect probably benign
Transcript: ENSMUST00000155005
Predicted Effect noncoding transcript
Transcript: ENSMUST00000206516
Predicted Effect noncoding transcript
Transcript: ENSMUST00000136597
Predicted Effect noncoding transcript
Transcript: ENSMUST00000132702
Predicted Effect probably benign
Transcript: ENSMUST00000138432
SMART Domains Protein: ENSMUSP00000114536
Gene: ENSMUSG00000042289

DomainStartEndE-ValueType
Pfam:3Beta_HSD 18 78 1.3e-15 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000139068
SMART Domains Protein: ENSMUSP00000121246
Gene: ENSMUSG00000042289

DomainStartEndE-ValueType
Pfam:3Beta_HSD 13 55 2.7e-13 PFAM
Pfam:3Beta_HSD 53 100 3.2e-19 PFAM
Meta Mutation Damage Score 0.1286 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 95.0%
Validation Efficiency 97% (66/68)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a component of a histone methyltransferase (HMT) complex that produces mono-, di-, and trimethylated histone H3 at Lys4. Trimethylation of histone H3 at lysine 4 (H3K4me3) is a chromatin modification known to generally mark the transcription start sites of active genes. The protein contains SET domains, a RNA recognition motif domain and is a member of the class V-like SAM-binding methyltransferase superfamily. [provided by RefSeq, Dec 2016]
PHENOTYPE: Animals homozygous for this allele were dead by E7.5 [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 66 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
0610040J01Rik A G 5: 64,053,834 (GRCm39) probably benign Het
6030469F06Rik A T 12: 31,234,730 (GRCm39) noncoding transcript Het
Acad11 T C 9: 103,993,495 (GRCm39) F541L probably damaging Het
Acin1 G T 14: 54,884,231 (GRCm39) R92S probably damaging Het
Appl1 A G 14: 26,662,213 (GRCm39) S490P probably benign Het
Aqp9 C A 9: 71,037,726 (GRCm39) V184L probably benign Het
Arih1 A T 9: 59,393,266 (GRCm39) I122N possibly damaging Het
Bmi1 T C 2: 18,687,983 (GRCm39) probably benign Het
Bmpr1a G A 14: 34,137,834 (GRCm39) T391I possibly damaging Het
Cacna1s A G 1: 136,041,041 (GRCm39) K1256E probably damaging Het
Cacng3 C T 7: 122,367,795 (GRCm39) P225L probably damaging Het
Cd101 A T 3: 100,925,843 (GRCm39) probably null Het
Cd55 A G 1: 130,390,294 (GRCm39) probably benign Het
Cenpe T C 3: 134,928,016 (GRCm39) I258T probably damaging Het
Cfap251 C T 5: 123,428,117 (GRCm39) T538M probably damaging Het
Cma2 A G 14: 56,211,135 (GRCm39) probably benign Het
Ddost T A 4: 138,036,964 (GRCm39) S176T probably benign Het
Ddx19b A T 8: 111,750,596 (GRCm39) probably null Het
Dmxl2 A G 9: 54,286,223 (GRCm39) I2681T probably damaging Het
Ern1 C T 11: 106,289,412 (GRCm39) E964K probably benign Het
Exoc1l G T 5: 76,648,334 (GRCm39) V47L possibly damaging Het
Galntl5 C T 5: 25,425,172 (GRCm39) R430C probably benign Het
Gga3 A G 11: 115,478,259 (GRCm39) L511P probably damaging Het
Gria2 C T 3: 80,618,165 (GRCm39) probably benign Het
Hmbs A T 9: 44,252,949 (GRCm39) L28* probably null Het
Iffo2 A G 4: 139,330,532 (GRCm39) E220G probably damaging Het
Ifi30 A G 8: 71,217,562 (GRCm39) probably benign Het
Irf2 T A 8: 47,299,096 (GRCm39) C297S probably benign Het
Izumo4 T C 10: 80,538,918 (GRCm39) Y94H probably damaging Het
Klhdc9 A G 1: 171,187,353 (GRCm39) V215A probably benign Het
Kmt2a T C 9: 44,731,261 (GRCm39) probably benign Het
Kmt2c A T 5: 25,580,955 (GRCm39) C513S probably damaging Het
Lyg1 A T 1: 37,988,977 (GRCm39) M81K possibly damaging Het
Maip1 T G 1: 57,454,852 (GRCm39) W279G probably damaging Het
Myo7a T C 7: 97,721,144 (GRCm39) T1263A probably benign Het
Naa15 T A 3: 51,373,060 (GRCm39) I701N possibly damaging Het
Ncoa3 A G 2: 165,910,463 (GRCm39) N1292S probably benign Het
Necab2 T A 8: 120,180,979 (GRCm39) probably benign Het
Nfatc1 T A 18: 80,741,257 (GRCm39) I234F possibly damaging Het
Olfm1 G A 2: 28,098,223 (GRCm39) R95K possibly damaging Het
Or10ag56 A G 2: 87,139,402 (GRCm39) T90A probably benign Het
Or10ak8 A T 4: 118,773,823 (GRCm39) N280K possibly damaging Het
Otoa T C 7: 120,755,750 (GRCm39) probably null Het
Padi4 GCTGCGTACCTCCAC GC 4: 140,475,760 (GRCm39) probably benign Het
Pard6g A G 18: 80,160,337 (GRCm39) D150G probably damaging Het
Pax5 A G 4: 44,609,783 (GRCm39) L215S probably damaging Het
Pja2 A T 17: 64,594,516 (GRCm39) probably benign Het
Plk4 T A 3: 40,765,654 (GRCm39) probably benign Het
Polr1a A T 6: 71,955,405 (GRCm39) H1687L possibly damaging Het
Ptcd2 G A 13: 99,479,899 (GRCm39) L41F probably damaging Het
Ropn1 T A 16: 34,490,334 (GRCm39) S62T probably benign Het
Setdb1 T C 3: 95,234,997 (GRCm39) D902G probably damaging Het
Sik3 T A 9: 46,120,068 (GRCm39) L719Q probably damaging Het
Slc36a1 G T 11: 55,123,333 (GRCm39) V433F probably benign Het
Slc6a3 T C 13: 73,705,169 (GRCm39) V220A possibly damaging Het
Slc6a5 A T 7: 49,561,539 (GRCm39) R24W probably damaging Het
Smox G T 2: 131,362,564 (GRCm39) R281L probably benign Het
Sulf2 G T 2: 165,935,436 (GRCm39) H226N probably damaging Het
Syne2 C T 12: 76,106,358 (GRCm39) probably null Het
Tenm3 C T 8: 48,740,826 (GRCm39) S1210N possibly damaging Het
Tns1 A T 1: 73,964,920 (GRCm39) V1237E probably damaging Het
Trf C T 9: 103,094,700 (GRCm39) V92M probably damaging Het
Ttn A G 2: 76,539,717 (GRCm39) V34423A possibly damaging Het
Vmn2r118 A G 17: 55,918,021 (GRCm39) probably benign Het
Vmn2r19 A G 6: 123,286,703 (GRCm39) Y112C probably damaging Het
Zfp326 G T 5: 106,026,641 (GRCm39) A15S possibly damaging Het
Other mutations in Setd1a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02508:Setd1a APN 7 127,396,870 (GRCm39) unclassified probably benign
IGL02657:Setd1a APN 7 127,394,997 (GRCm39) unclassified probably benign
IGL02792:Setd1a APN 7 127,390,522 (GRCm39) missense unknown
IGL02876:Setd1a APN 7 127,377,673 (GRCm39) splice site probably benign
IGL02967:Setd1a APN 7 127,384,349 (GRCm39) unclassified probably benign
IGL03090:Setd1a APN 7 127,385,672 (GRCm39) missense possibly damaging 0.83
IGL03238:Setd1a APN 7 127,384,718 (GRCm39) missense possibly damaging 0.86
FR4449:Setd1a UTSW 7 127,384,498 (GRCm39) unclassified probably benign
FR4548:Setd1a UTSW 7 127,384,485 (GRCm39) unclassified probably benign
FR4548:Setd1a UTSW 7 127,384,479 (GRCm39) unclassified probably benign
FR4589:Setd1a UTSW 7 127,384,469 (GRCm39) unclassified probably benign
FR4737:Setd1a UTSW 7 127,384,484 (GRCm39) unclassified probably benign
FR4976:Setd1a UTSW 7 127,384,488 (GRCm39) unclassified probably benign
FR4976:Setd1a UTSW 7 127,384,479 (GRCm39) unclassified probably benign
R0367:Setd1a UTSW 7 127,387,358 (GRCm39) splice site probably benign
R0416:Setd1a UTSW 7 127,384,469 (GRCm39) unclassified probably benign
R0470:Setd1a UTSW 7 127,384,229 (GRCm39) unclassified probably benign
R0645:Setd1a UTSW 7 127,386,382 (GRCm39) missense probably damaging 0.96
R0667:Setd1a UTSW 7 127,385,765 (GRCm39) missense probably damaging 0.99
R1251:Setd1a UTSW 7 127,396,596 (GRCm39) unclassified probably benign
R1465:Setd1a UTSW 7 127,387,512 (GRCm39) unclassified probably benign
R1465:Setd1a UTSW 7 127,387,512 (GRCm39) unclassified probably benign
R1660:Setd1a UTSW 7 127,395,841 (GRCm39) unclassified probably benign
R1730:Setd1a UTSW 7 127,384,296 (GRCm39) nonsense probably null
R1760:Setd1a UTSW 7 127,385,062 (GRCm39) missense possibly damaging 0.68
R1783:Setd1a UTSW 7 127,384,296 (GRCm39) nonsense probably null
R2149:Setd1a UTSW 7 127,385,690 (GRCm39) missense possibly damaging 0.75
R2159:Setd1a UTSW 7 127,384,661 (GRCm39) missense possibly damaging 0.91
R2303:Setd1a UTSW 7 127,398,327 (GRCm39) unclassified probably benign
R2679:Setd1a UTSW 7 127,394,896 (GRCm39) unclassified probably benign
R3428:Setd1a UTSW 7 127,384,493 (GRCm39) unclassified probably benign
R4108:Setd1a UTSW 7 127,398,374 (GRCm39) unclassified probably benign
R4227:Setd1a UTSW 7 127,395,819 (GRCm39) unclassified probably benign
R4438:Setd1a UTSW 7 127,384,903 (GRCm39) missense possibly damaging 0.83
R4730:Setd1a UTSW 7 127,396,502 (GRCm39) unclassified probably benign
R4869:Setd1a UTSW 7 127,396,776 (GRCm39) unclassified probably benign
R4892:Setd1a UTSW 7 127,377,696 (GRCm39) missense probably damaging 0.99
R5152:Setd1a UTSW 7 127,383,197 (GRCm39) missense probably benign
R5502:Setd1a UTSW 7 127,396,420 (GRCm39) critical splice donor site probably null
R5527:Setd1a UTSW 7 127,384,801 (GRCm39) missense probably damaging 0.99
R6189:Setd1a UTSW 7 127,377,455 (GRCm39) splice site probably null
R6250:Setd1a UTSW 7 127,390,471 (GRCm39) missense unknown
R7131:Setd1a UTSW 7 127,395,590 (GRCm39) small deletion probably benign
R7988:Setd1a UTSW 7 127,385,366 (GRCm39) missense probably benign 0.02
R8029:Setd1a UTSW 7 127,385,386 (GRCm39) missense probably benign 0.08
R8079:Setd1a UTSW 7 127,384,225 (GRCm39) missense unknown
R8171:Setd1a UTSW 7 127,390,399 (GRCm39) missense unknown
R8175:Setd1a UTSW 7 127,395,415 (GRCm39) missense unknown
R8286:Setd1a UTSW 7 127,385,356 (GRCm39) missense possibly damaging 0.96
R8327:Setd1a UTSW 7 127,390,669 (GRCm39) missense unknown
R8460:Setd1a UTSW 7 127,383,292 (GRCm39) missense unknown
R8547:Setd1a UTSW 7 127,395,676 (GRCm39) unclassified probably benign
R8699:Setd1a UTSW 7 127,385,774 (GRCm39) missense possibly damaging 0.53
R8822:Setd1a UTSW 7 127,385,332 (GRCm39) missense possibly damaging 0.86
R8968:Setd1a UTSW 7 127,385,279 (GRCm39) missense possibly damaging 0.93
R9063:Setd1a UTSW 7 127,385,558 (GRCm39) missense possibly damaging 0.91
R9178:Setd1a UTSW 7 127,385,590 (GRCm39) missense possibly damaging 0.93
R9672:Setd1a UTSW 7 127,385,237 (GRCm39) missense possibly damaging 0.96
R9700:Setd1a UTSW 7 127,385,752 (GRCm39) missense possibly damaging 0.53
RF001:Setd1a UTSW 7 127,384,486 (GRCm39) unclassified probably benign
RF008:Setd1a UTSW 7 127,384,486 (GRCm39) unclassified probably benign
RF011:Setd1a UTSW 7 127,384,515 (GRCm39) unclassified probably benign
RF014:Setd1a UTSW 7 127,384,518 (GRCm39) unclassified probably benign
RF030:Setd1a UTSW 7 127,384,483 (GRCm39) unclassified probably benign
RF030:Setd1a UTSW 7 127,384,473 (GRCm39) unclassified probably benign
RF031:Setd1a UTSW 7 127,384,483 (GRCm39) unclassified probably benign
RF036:Setd1a UTSW 7 127,384,472 (GRCm39) unclassified probably benign
RF041:Setd1a UTSW 7 127,384,504 (GRCm39) unclassified probably benign
RF052:Setd1a UTSW 7 127,384,529 (GRCm39) unclassified probably benign
RF055:Setd1a UTSW 7 127,384,471 (GRCm39) unclassified probably benign
RF056:Setd1a UTSW 7 127,384,500 (GRCm39) unclassified probably benign
RF056:Setd1a UTSW 7 127,384,475 (GRCm39) unclassified probably benign
RF058:Setd1a UTSW 7 127,384,490 (GRCm39) unclassified probably benign
Z1176:Setd1a UTSW 7 127,398,266 (GRCm39) missense unknown
Predicted Primers PCR Primer
(F):5'- ACGCCGGAAAACTGTTTCCTTCTC -3'
(R):5'- TGCTTTCTGAAGACTCGGACTCCTC -3'

Sequencing Primer
(F):5'- TGGTCCAGTCTCTCGAAAAG -3'
(R):5'- tcttcctcctcctcttctcc -3'
Posted On 2013-05-09