Incidental Mutation 'R4782:Ap3d1'
ID366631
Institutional Source Beutler Lab
Gene Symbol Ap3d1
Ensembl Gene ENSMUSG00000020198
Gene Nameadaptor-related protein complex 3, delta 1 subunit
SynonymsmBLVR1, Bolvr
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.920) question?
Stock #R4782 (G1)
Quality Score161
Status Not validated
Chromosome10
Chromosomal Location80706956-80742264 bp(-) (GRCm38)
Type of Mutationsplice site (5 bp from exon)
DNA Base Change (assembly) C to T at 80721586 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000020420 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000020420]
Predicted Effect probably null
Transcript: ENSMUST00000020420
SMART Domains Protein: ENSMUSP00000020420
Gene: ENSMUSG00000020198

DomainStartEndE-ValueType
Pfam:Adaptin_N 32 583 6.6e-153 PFAM
Pfam:Cnd1 130 292 2.1e-8 PFAM
low complexity region 629 642 N/A INTRINSIC
BLVR 660 803 5.3e-80 SMART
low complexity region 835 861 N/A INTRINSIC
low complexity region 871 881 N/A INTRINSIC
coiled coil region 910 933 N/A INTRINSIC
low complexity region 947 964 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000218125
Predicted Effect noncoding transcript
Transcript: ENSMUST00000219253
Predicted Effect probably benign
Transcript: ENSMUST00000219356
Predicted Effect noncoding transcript
Transcript: ENSMUST00000220183
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 94.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a subunit of the AP3 adaptor-like complex, which is not clathrin-associated, but is associated with the golgi region, as well as more peripheral structures. The AP-3 complex facilitates the budding of vesicles from the golgi membrane, and may be directly involved in trafficking to lysosomes. This subunit is implicated in intracellular biogenesis and trafficking of pigment granules, and possibly platelet dense granules and neurotransmitter vesicles. Defects in this gene are a cause of a new type of Hermansky-Pudlak syndrome. [provided by RefSeq, Feb 2017]
PHENOTYPE: Mutant mice show coat and eye color dilution, platelet defects, lysosomal abnormalities, inner ear degeneration and neurological defects and model Hermansky-Pudlak storage pool deficiency syndrome. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 121 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca13 A G 11: 9,328,096 E3092G probably damaging Het
Abhd12b C G 12: 70,169,064 S170C probably damaging Het
Abtb2 A T 2: 103,717,299 D1006V probably benign Het
Adgrl1 A G 8: 83,935,573 H1021R probably benign Het
Ago3 A T 4: 126,347,872 probably null Het
Ahnak A G 19: 9,012,499 probably benign Het
Akap6 CA C 12: 52,887,623 probably null Het
Amotl2 T G 9: 102,720,123 probably null Het
Ankrd34b T A 13: 92,438,305 I15N probably damaging Het
Appl2 A T 10: 83,600,991 D635E probably damaging Het
Arid1b C T 17: 5,339,221 P1681S probably damaging Het
Atp10a T C 7: 58,791,095 M496T probably benign Het
Atp2c2 A G 8: 119,749,152 K595E probably damaging Het
Atpaf2 T C 11: 60,404,412 H204R probably damaging Het
Atr G A 9: 95,862,797 V56I probably benign Het
Bod1l G A 5: 41,833,663 T183I probably benign Het
Btbd11 A C 10: 85,654,550 I1027L probably damaging Het
Ccdc171 A T 4: 83,681,016 E689D probably damaging Het
Cdc73 T A 1: 143,627,875 Q346L probably benign Het
Chd2 A T 7: 73,484,436 M721K possibly damaging Het
Col22a1 T A 15: 71,801,925 T981S unknown Het
Col4a3bp T C 13: 96,612,265 V281A probably benign Het
Cpox G A 16: 58,672,623 A207T probably damaging Het
Cym G A 3: 107,216,097 T160I possibly damaging Het
D130043K22Rik T C 13: 24,878,040 I664T probably damaging Het
Ddx4 C T 13: 112,613,696 probably null Het
Ddx4 A T 13: 112,651,360 V15E probably benign Het
Depdc1a G A 3: 159,526,636 E675K probably damaging Het
Dglucy A T 12: 100,850,343 M415L probably benign Het
Dlg4 C T 11: 70,026,954 P21L probably damaging Het
Dmxl1 A T 18: 49,862,992 N395I probably damaging Het
Dzank1 A T 2: 144,504,399 C249S probably damaging Het
Efnb2 A T 8: 8,623,104 probably null Het
Ercc6l2 T G 13: 63,834,738 I244S probably damaging Het
Ewsr1 A T 11: 5,070,423 M584K unknown Het
Fam193b A G 13: 55,543,471 S197P probably damaging Het
Fanca A G 8: 123,288,202 V689A probably damaging Het
Fbxo31 A T 8: 121,552,439 Y436* probably null Het
Fbxo31 A G 8: 121,552,441 Y436H probably damaging Het
Fcna T A 2: 25,625,326 D215V probably damaging Het
Foxj3 A T 4: 119,621,660 S438C unknown Het
Gcm2 T C 13: 41,103,494 K260E possibly damaging Het
Gcnt4 A T 13: 96,947,406 L403F possibly damaging Het
Gdf10 A G 14: 33,931,913 T126A probably benign Het
Ggcx A G 6: 72,428,892 K569E probably benign Het
Gm10250 C T 15: 5,121,096 probably benign Het
Gm8251 T C 1: 44,059,043 D965G possibly damaging Het
Gpnmb G T 6: 49,045,483 probably null Het
Ifi44 G A 3: 151,745,592 P241S probably damaging Het
Irs1 T C 1: 82,287,463 T1011A probably benign Het
Jag2 A T 12: 112,914,249 S595T probably benign Het
Kif5a T A 10: 127,230,954 Q960L probably benign Het
Kifc2 A G 15: 76,664,348 E430G possibly damaging Het
Lama3 T A 18: 12,411,570 C323* probably null Het
Lgsn T C 1: 31,203,742 Y302H probably benign Het
Lmbrd1 G A 1: 24,744,975 probably null Het
Lrpap1 A G 5: 35,099,278 V120A probably damaging Het
Macrod2 T A 2: 140,419,938 D46E possibly damaging Het
Mbd4 C A 6: 115,845,322 R63L possibly damaging Het
Mfsd10 T C 5: 34,634,949 probably benign Het
Mib2 G T 4: 155,659,772 S144R probably benign Het
Muc5b T A 7: 141,847,716 C566* probably null Het
Ndufs1 C A 1: 63,160,949 G268V probably damaging Het
Nfs1 A G 2: 156,134,449 V175A possibly damaging Het
Ngb G A 12: 87,100,225 H73Y probably benign Het
Npepps G A 11: 97,226,826 T549I probably damaging Het
Nr1h2 A G 7: 44,550,499 V329A possibly damaging Het
Nsun6 T C 2: 15,036,326 I151M possibly damaging Het
Ofcc1 T C 13: 40,001,892 probably null Het
Olfr1388 T A 11: 49,443,869 F6Y probably benign Het
Olfr262 C T 19: 12,241,572 V30I probably benign Het
Olfr372 A G 8: 72,058,094 N138S probably benign Het
Olfr391-ps C T 11: 73,798,839 C306Y probably benign Het
Olfr555 T A 7: 102,658,834 N4K possibly damaging Het
Olfr910 A G 9: 38,539,075 Y60C probably damaging Het
Parp6 A G 9: 59,634,984 probably null Het
Pcnt C A 10: 76,409,577 R1075S possibly damaging Het
Pla2g4f T C 2: 120,303,276 E548G probably damaging Het
Polrmt G T 10: 79,739,523 H725N probably benign Het
Pou2f3 T C 9: 43,139,858 T178A probably damaging Het
Prtn3 C A 10: 79,882,065 P169H probably damaging Het
Ptprd A G 4: 76,091,532 I764T probably benign Het
Ptprh A T 7: 4,569,577 H467Q probably benign Het
Raph1 A T 1: 60,489,114 I996N probably damaging Het
Rasa4 G A 5: 136,091,229 W53* probably null Het
Rasgrp1 C T 2: 117,284,875 R744Q probably benign Het
Rmnd5a T C 6: 71,413,349 E141G probably damaging Het
Rps12 T C 10: 23,786,790 I51M possibly damaging Het
Scn10a T G 9: 119,622,910 S1316R possibly damaging Het
Sdhb A G 4: 140,977,466 H246R possibly damaging Het
Setx G A 2: 29,144,046 R332Q probably damaging Het
Siglec1 A C 2: 131,075,923 S1011R probably damaging Het
Sin3b A C 8: 72,725,643 I126L probably benign Het
Slc11a1 T G 1: 74,384,088 L366R probably damaging Het
Slc12a1 C T 2: 125,161,079 R177* probably null Het
Slc30a1 A C 1: 191,909,048 K269Q probably benign Het
Slco1a5 T C 6: 142,248,807 Y370C possibly damaging Het
Slf2 T A 19: 44,934,925 probably null Het
Sltm A G 9: 70,589,057 H958R probably damaging Het
Snrnp40 A G 4: 130,362,756 I91M probably damaging Het
Spta1 A T 1: 174,230,666 Q1900L probably benign Het
Srgn C T 10: 62,497,852 E49K possibly damaging Het
Ssu2 A C 6: 112,376,450 C238G probably damaging Het
Terf2 G T 8: 107,076,675 H425Q probably benign Het
Thra G A 11: 98,756,164 S37N probably benign Het
Toporsl A G 4: 52,610,845 D246G probably damaging Het
Ubap2l G A 3: 90,020,903 T553M probably damaging Het
Usp10 A G 8: 119,941,191 Y77C probably benign Het
Utrn T C 10: 12,750,069 T123A probably damaging Het
Vmn1r204 T G 13: 22,556,697 F166C probably benign Het
Vmn2r14 T C 5: 109,221,504 I68V probably benign Het
Wls C T 3: 159,897,445 T165I probably benign Het
Wsb1 A G 11: 79,240,373 M399T probably benign Het
Xbp1 C T 11: 5,521,167 T58M probably damaging Het
Zbtb46 A T 2: 181,391,136 D577E probably benign Het
Zfp366 A G 13: 99,246,483 D718G probably damaging Het
Zfp408 A T 2: 91,645,024 V595E possibly damaging Het
Zfp493 T A 13: 67,786,203 W60R probably null Het
Zfp606 A T 7: 12,494,005 K626N probably damaging Het
Zfp820 A T 17: 21,818,985 L454Q probably benign Het
Zswim5 A G 4: 116,972,972 I515V probably benign Het
Other mutations in Ap3d1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00094:Ap3d1 APN 10 80741979 missense probably benign 0.00
IGL00827:Ap3d1 APN 10 80713559 missense possibly damaging 0.92
IGL01668:Ap3d1 APN 10 80719159 missense possibly damaging 0.95
IGL01934:Ap3d1 APN 10 80709258 nonsense probably null
IGL03404:Ap3d1 APN 10 80730037 missense probably damaging 1.00
christian UTSW 10 80730042 missense probably damaging 1.00
R0119:Ap3d1 UTSW 10 80723615 splice site probably benign
R0197:Ap3d1 UTSW 10 80730042 missense probably damaging 1.00
R0356:Ap3d1 UTSW 10 80727978 missense probably damaging 1.00
R0372:Ap3d1 UTSW 10 80723567 missense probably damaging 1.00
R0491:Ap3d1 UTSW 10 80719241 missense probably damaging 1.00
R0636:Ap3d1 UTSW 10 80719382 nonsense probably null
R0792:Ap3d1 UTSW 10 80708479 missense probably benign
R0942:Ap3d1 UTSW 10 80732955 splice site probably benign
R1015:Ap3d1 UTSW 10 80716489 missense probably damaging 1.00
R1023:Ap3d1 UTSW 10 80714258 missense probably damaging 1.00
R1170:Ap3d1 UTSW 10 80732840 splice site probably benign
R1540:Ap3d1 UTSW 10 80715941 missense probably benign 0.00
R1639:Ap3d1 UTSW 10 80730010 missense probably damaging 0.98
R1664:Ap3d1 UTSW 10 80717737 nonsense probably null
R1669:Ap3d1 UTSW 10 80710836 unclassified probably benign
R1839:Ap3d1 UTSW 10 80727108 missense probably damaging 1.00
R1940:Ap3d1 UTSW 10 80709773 missense probably benign 0.03
R2081:Ap3d1 UTSW 10 80732936 missense probably damaging 1.00
R2258:Ap3d1 UTSW 10 80721132 missense probably benign 0.03
R2281:Ap3d1 UTSW 10 80713998 missense probably damaging 0.96
R2398:Ap3d1 UTSW 10 80719172 nonsense probably null
R2849:Ap3d1 UTSW 10 80741908 missense possibly damaging 0.65
R3856:Ap3d1 UTSW 10 80712185 missense probably benign
R4350:Ap3d1 UTSW 10 80719285 missense probably benign 0.15
R4590:Ap3d1 UTSW 10 80719812 nonsense probably null
R4785:Ap3d1 UTSW 10 80712778 frame shift probably null
R4834:Ap3d1 UTSW 10 80719726 missense probably damaging 1.00
R4864:Ap3d1 UTSW 10 80712778 frame shift probably null
R5051:Ap3d1 UTSW 10 80719199 missense probably damaging 1.00
R5109:Ap3d1 UTSW 10 80709450 missense probably benign 0.11
R5219:Ap3d1 UTSW 10 80709817 missense probably benign 0.03
R5220:Ap3d1 UTSW 10 80727167 missense probably damaging 1.00
R5307:Ap3d1 UTSW 10 80723549 missense probably benign 0.29
R5586:Ap3d1 UTSW 10 80719130 missense possibly damaging 0.92
R5796:Ap3d1 UTSW 10 80714037 missense possibly damaging 0.70
R5905:Ap3d1 UTSW 10 80722927 missense possibly damaging 0.50
R6025:Ap3d1 UTSW 10 80710464 missense probably benign 0.01
R6028:Ap3d1 UTSW 10 80722927 missense possibly damaging 0.50
R6364:Ap3d1 UTSW 10 80710494 intron probably null
R6469:Ap3d1 UTSW 10 80712158 missense probably benign
R6603:Ap3d1 UTSW 10 80714047 missense probably benign 0.04
R6872:Ap3d1 UTSW 10 80714322 nonsense probably null
R6887:Ap3d1 UTSW 10 80723698 missense probably damaging 1.00
R7249:Ap3d1 UTSW 10 80741933 missense probably damaging 1.00
R7316:Ap3d1 UTSW 10 80717859 missense probably damaging 1.00
R7325:Ap3d1 UTSW 10 80723803 missense probably damaging 1.00
R7395:Ap3d1 UTSW 10 80730882 missense probably benign 0.11
R7405:Ap3d1 UTSW 10 80741900 missense probably benign 0.16
R7425:Ap3d1 UTSW 10 80721592 missense probably damaging 1.00
R7558:Ap3d1 UTSW 10 80722921 missense possibly damaging 0.92
X0019:Ap3d1 UTSW 10 80719102 missense probably damaging 1.00
X0026:Ap3d1 UTSW 10 80721147 missense possibly damaging 0.46
Z1088:Ap3d1 UTSW 10 80719237 missense possibly damaging 0.91
Predicted Primers PCR Primer
(F):5'- CATGTGGGAGCAAGTTCTGG -3'
(R):5'- ATCTGCCTTCTGAACGTGC -3'

Sequencing Primer
(F):5'- ACAGAGTGTCCACAGCAGCTG -3'
(R):5'- AGGGCTACTAACCTTGAC -3'
Posted On2015-12-29