Incidental Mutation 'R4783:Ifi206'
ID 366685
Institutional Source Beutler Lab
Gene Symbol Ifi206
Ensembl Gene ENSMUSG00000037849
Gene Name interferon activated gene 206
Synonyms Pyblhin-C, Gm4955
MMRRC Submission 042416-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.175) question?
Stock # R4783 (G1)
Quality Score 225
Status Validated
Chromosome 1
Chromosomal Location 173296051-173318607 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to T at 173308432 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Histidine to Glutamine at position 521 (H521Q)
Ref Sequence ENSEMBL: ENSMUSP00000134646 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000160565]
AlphaFold G3UZV2
Predicted Effect probably benign
Transcript: ENSMUST00000160565
AA Change: H521Q

PolyPhen 2 Score 0.005 (Sensitivity: 0.97; Specificity: 0.74)
SMART Domains Protein: ENSMUSP00000134646
Gene: ENSMUSG00000037849
AA Change: H521Q

DomainStartEndE-ValueType
PYRIN 6 84 5.7e-21 SMART
low complexity region 97 108 N/A INTRINSIC
internal_repeat_1 154 349 6.25e-15 PROSPERO
internal_repeat_1 342 575 6.25e-15 PROSPERO
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 94.6%
Validation Efficiency 100% (99/99)
Allele List at MGI
Other mutations in this stock
Total: 95 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
3110082J24Rik G A 5: 30,310,198 (GRCm39) R54* probably null Het
Acsl6 A T 11: 54,227,819 (GRCm39) M350L probably damaging Het
Adgrv1 T C 13: 81,243,564 (GRCm39) T6279A probably damaging Het
Ago3 A T 4: 126,262,296 (GRCm39) M418K probably benign Het
Ascc2 G A 11: 4,596,653 (GRCm39) R58H probably benign Het
Brinp3 A G 1: 146,603,378 (GRCm39) probably benign Het
Carmil3 T C 14: 55,738,778 (GRCm39) probably null Het
Ccdc47 T A 11: 106,094,430 (GRCm39) H7L probably benign Het
Ccndbp1 A T 2: 120,839,003 (GRCm39) T5S probably benign Het
Cdr2 A T 7: 120,557,644 (GRCm39) F294I probably benign Het
Chd8 C A 14: 52,442,825 (GRCm39) C575F probably damaging Het
Ctsll3 G A 13: 60,948,209 (GRCm39) T156I probably damaging Het
Dgcr8 G A 16: 18,076,174 (GRCm39) R4* probably null Het
Dnah1 T A 14: 30,985,436 (GRCm39) K3818N probably damaging Het
Dok2 C T 14: 71,015,314 (GRCm39) P347L probably benign Het
Elf1 T A 14: 79,818,183 (GRCm39) N567K probably benign Het
Emsy T C 7: 98,295,686 (GRCm39) N72S possibly damaging Het
Fam76a A G 4: 132,643,501 (GRCm39) Y78H probably damaging Het
Fam76a A T 4: 132,629,428 (GRCm39) probably null Het
Fbn1 A T 2: 125,166,839 (GRCm39) C2026S probably damaging Het
Fbxo4 T C 15: 3,998,523 (GRCm39) T312A probably benign Het
Fhip1a G T 3: 85,595,877 (GRCm39) T115K probably damaging Het
Flnb A T 14: 7,905,701 (GRCm38) E1150D probably benign Het
Galt T C 4: 41,758,189 (GRCm39) V318A probably damaging Het
Git1 T G 11: 77,390,663 (GRCm39) L133R probably damaging Het
Gm11168 G A 9: 3,006,915 (GRCm39) M213I probably benign Het
Gm7233 A G 14: 43,037,423 (GRCm39) E25G probably benign Het
Golga2 T A 2: 32,187,168 (GRCm39) N89K probably damaging Het
Grin1 T A 2: 25,182,393 (GRCm39) H956L possibly damaging Het
Hlcs C T 16: 94,069,398 (GRCm39) V164I possibly damaging Het
Hmgcr G A 13: 96,802,701 (GRCm39) T66M probably damaging Het
Lgals3bp G A 11: 118,284,340 (GRCm39) T413I probably damaging Het
Lrrc7 A G 3: 157,832,850 (GRCm39) probably null Het
Mapk11 T C 15: 89,033,691 (GRCm39) Y9C probably damaging Het
Mccc1 C A 3: 36,030,022 (GRCm39) M429I probably damaging Het
Metrnl A G 11: 121,598,750 (GRCm39) E40G probably benign Het
Mrgpra1 A G 7: 46,985,218 (GRCm39) S154P probably damaging Het
Myh13 A T 11: 67,232,096 (GRCm39) I459F probably damaging Het
Nalf1 T C 8: 9,258,026 (GRCm39) Y374C probably damaging Het
Nedd4l C A 18: 65,305,998 (GRCm39) D424E probably damaging Het
Nid1 C T 13: 13,674,326 (GRCm39) R902W probably damaging Het
Nphp4 G A 4: 152,639,003 (GRCm39) R878K probably benign Het
Numa1 A G 7: 101,662,773 (GRCm39) T1997A probably damaging Het
Nutm1 G A 2: 112,079,281 (GRCm39) A878V probably benign Het
Nxf1 G A 19: 8,744,162 (GRCm39) A339T probably benign Het
Oas1b C A 5: 120,952,578 (GRCm39) Q90K probably benign Het
Optn T C 2: 5,059,438 (GRCm39) M27V probably benign Het
Or1r1 A G 11: 73,874,834 (GRCm39) F200S probably damaging Het
Or2t35 A C 14: 14,407,729 (GRCm38) Y167S possibly damaging Het
Or4f56 A T 2: 111,703,395 (GRCm39) D268E possibly damaging Het
Or5ac17 G T 16: 59,036,222 (GRCm39) F251L probably damaging Het
Or5d45 A G 2: 88,153,500 (GRCm39) I183T probably damaging Het
Or5g29 A G 2: 85,421,282 (GRCm39) T133A probably benign Het
Or5h18 G T 16: 58,848,260 (GRCm39) D3E probably benign Het
Oxgr1 T C 14: 120,259,776 (GRCm39) I144V probably benign Het
Pax5 T A 4: 44,570,086 (GRCm39) T127S probably damaging Het
Pcsk2 T C 2: 143,529,599 (GRCm39) probably null Het
Pdxk A G 10: 78,300,626 (GRCm39) V19A possibly damaging Het
Pik3c2a A T 7: 116,017,060 (GRCm39) S232R probably damaging Het
Ppip5k1 T C 2: 121,171,329 (GRCm39) D620G possibly damaging Het
Ppp4r4 T A 12: 103,557,117 (GRCm39) probably null Het
Psmd1 A G 1: 86,006,434 (GRCm39) N267D probably damaging Het
Pudp A G 18: 50,701,136 (GRCm39) V199A probably damaging Het
Rasal3 T A 17: 32,615,755 (GRCm39) D361V probably damaging Het
Rbm12 T C 2: 155,938,484 (GRCm39) D596G possibly damaging Het
Rbm6 T C 9: 107,730,102 (GRCm39) D182G probably damaging Het
Rif1 T C 2: 52,002,759 (GRCm39) V2071A probably damaging Het
Rilp C T 11: 75,401,467 (GRCm39) A110V possibly damaging Het
Rprd2 A G 3: 95,681,645 (GRCm39) V332A probably benign Het
Sbpl T A 17: 24,172,304 (GRCm39) D205V unknown Het
Scn9a T C 2: 66,370,967 (GRCm39) I538V probably benign Het
Serpina1d T C 12: 103,734,083 (GRCm39) S74G possibly damaging Het
Serpina3n T C 12: 104,375,369 (GRCm39) I147T possibly damaging Het
Serpinb8 A G 1: 107,532,472 (GRCm39) N188S probably benign Het
Sipa1l3 A G 7: 29,077,066 (GRCm39) V902A probably damaging Het
Slc25a47 T A 12: 108,821,260 (GRCm39) L123Q probably damaging Het
Slc30a2 A T 4: 134,071,317 (GRCm39) probably null Het
Slc66a1 G T 4: 139,027,312 (GRCm39) H343Q probably benign Het
Snx13 T A 12: 35,148,285 (GRCm39) D271E probably damaging Het
Tbc1d9b A G 11: 50,062,125 (GRCm39) N1211S probably benign Het
Tdrd3 T A 14: 87,709,537 (GRCm39) I67N probably damaging Het
Thbs1 T C 2: 117,945,273 (GRCm39) V282A probably benign Het
Tmc8 A G 11: 117,682,431 (GRCm39) probably null Het
Trim11 T A 11: 58,879,750 (GRCm39) F284Y probably null Het
Ttn G T 2: 76,552,141 (GRCm39) Y29419* probably null Het
Ttn A G 2: 76,599,947 (GRCm39) Y19076H probably damaging Het
Ubr4 T C 4: 139,149,044 (GRCm39) S448P possibly damaging Het
Ugt2b34 T C 5: 87,039,332 (GRCm39) E443G probably damaging Het
Usp29 A G 7: 6,964,390 (GRCm39) T78A probably damaging Het
Vmn1r227 A G 17: 20,955,396 (GRCm39) noncoding transcript Het
Vmn1r85 A T 7: 12,818,788 (GRCm39) W119R probably damaging Het
Vmn2r12 A T 5: 109,234,379 (GRCm39) V611E probably damaging Het
Vmn2r97 A T 17: 19,149,550 (GRCm39) M313L probably benign Het
Zap70 T C 1: 36,818,254 (GRCm39) Y314H probably damaging Het
Zfp667 T A 7: 6,308,684 (GRCm39) F451I possibly damaging Het
Other mutations in Ifi206
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01509:Ifi206 APN 1 173,313,142 (GRCm39) missense probably benign 0.00
IGL02044:Ifi206 APN 1 173,308,557 (GRCm39) missense probably benign 0.41
IGL02118:Ifi206 APN 1 173,309,334 (GRCm39) missense probably benign 0.05
IGL02476:Ifi206 APN 1 173,309,132 (GRCm39) missense probably benign 0.02
IGL02824:Ifi206 APN 1 173,309,438 (GRCm39) missense possibly damaging 0.95
IGL03375:Ifi206 APN 1 173,308,344 (GRCm39) missense probably benign 0.06
PIT4142001:Ifi206 UTSW 1 173,308,730 (GRCm39) missense probably benign 0.02
R0069:Ifi206 UTSW 1 173,314,413 (GRCm39) missense probably damaging 1.00
R0741:Ifi206 UTSW 1 173,301,315 (GRCm39) missense probably benign 0.41
R1572:Ifi206 UTSW 1 173,314,419 (GRCm39) missense probably benign 0.10
R1742:Ifi206 UTSW 1 173,309,537 (GRCm39) missense probably benign 0.06
R4109:Ifi206 UTSW 1 173,308,554 (GRCm39) missense probably benign 0.00
R4707:Ifi206 UTSW 1 173,308,432 (GRCm39) missense probably benign 0.00
R4785:Ifi206 UTSW 1 173,308,432 (GRCm39) missense probably benign 0.00
R4805:Ifi206 UTSW 1 173,308,952 (GRCm39) missense possibly damaging 0.55
R4918:Ifi206 UTSW 1 173,309,610 (GRCm39) missense possibly damaging 0.73
R5043:Ifi206 UTSW 1 173,314,284 (GRCm39) missense probably damaging 1.00
R5080:Ifi206 UTSW 1 173,301,414 (GRCm39) missense possibly damaging 0.61
R5419:Ifi206 UTSW 1 173,308,797 (GRCm39) missense probably benign 0.05
R5420:Ifi206 UTSW 1 173,308,599 (GRCm39) missense possibly damaging 0.84
R5777:Ifi206 UTSW 1 173,308,928 (GRCm39) missense possibly damaging 0.55
R5988:Ifi206 UTSW 1 173,308,906 (GRCm39) missense possibly damaging 0.90
R6772:Ifi206 UTSW 1 173,308,773 (GRCm39) missense unknown
R6782:Ifi206 UTSW 1 173,308,923 (GRCm39) missense unknown
R6806:Ifi206 UTSW 1 173,309,137 (GRCm39) missense probably benign 0.06
R7042:Ifi206 UTSW 1 173,308,808 (GRCm39) missense
R7091:Ifi206 UTSW 1 173,301,441 (GRCm39) missense unknown
R7292:Ifi206 UTSW 1 173,301,428 (GRCm39) missense unknown
R7429:Ifi206 UTSW 1 173,308,157 (GRCm39) missense
R7499:Ifi206 UTSW 1 173,309,607 (GRCm39) missense
R7772:Ifi206 UTSW 1 173,308,640 (GRCm39) missense
R7853:Ifi206 UTSW 1 173,299,100 (GRCm39) nonsense probably null
R7971:Ifi206 UTSW 1 173,298,976 (GRCm39) missense unknown
R8079:Ifi206 UTSW 1 173,308,724 (GRCm39) missense
R8205:Ifi206 UTSW 1 173,309,450 (GRCm39) missense
R8289:Ifi206 UTSW 1 173,308,032 (GRCm39) missense
R8390:Ifi206 UTSW 1 173,308,511 (GRCm39) missense
R8500:Ifi206 UTSW 1 173,314,311 (GRCm39) missense
R8712:Ifi206 UTSW 1 173,308,074 (GRCm39) missense
R8753:Ifi206 UTSW 1 173,301,223 (GRCm39) missense unknown
R8875:Ifi206 UTSW 1 173,301,353 (GRCm39) missense unknown
R9128:Ifi206 UTSW 1 173,299,022 (GRCm39) missense unknown
R9369:Ifi206 UTSW 1 173,301,489 (GRCm39) missense unknown
R9569:Ifi206 UTSW 1 173,314,209 (GRCm39) missense
R9676:Ifi206 UTSW 1 173,308,718 (GRCm39) missense
R9695:Ifi206 UTSW 1 173,301,249 (GRCm39) missense unknown
R9776:Ifi206 UTSW 1 173,308,075 (GRCm39) missense
X0052:Ifi206 UTSW 1 173,309,535 (GRCm39) missense possibly damaging 0.89
Z1088:Ifi206 UTSW 1 173,301,577 (GRCm39) missense probably damaging 1.00
Z1176:Ifi206 UTSW 1 173,309,614 (GRCm39) missense
Predicted Primers PCR Primer
(F):5'- TCATTTGAAAGGCACTGCTGGG -3'
(R):5'- GCCCATGGCTGTAATAGTCC -3'

Sequencing Primer
(F):5'- GGCACTGCTACTTGAGGAATC -3'
(R):5'- CATGGCTGTAATAGTCCTCAGATC -3'
Posted On 2015-12-29