Incidental Mutation 'R4783:Golga2'
ID366689
Institutional Source Beutler Lab
Gene Symbol Golga2
Ensembl Gene ENSMUSG00000002546
Gene Namegolgi autoantigen, golgin subfamily a, 2
SynonymsGM130
MMRRC Submission 042416-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.861) question?
Stock #R4783 (G1)
Quality Score225
Status Validated
Chromosome2
Chromosomal Location32287384-32307921 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 32297156 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Lysine at position 89 (N89K)
Ref Sequence ENSEMBL: ENSMUSP00000080374 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000081670] [ENSMUST00000100194] [ENSMUST00000113377] [ENSMUST00000129193] [ENSMUST00000139494]
Predicted Effect probably damaging
Transcript: ENSMUST00000081670
AA Change: N89K

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000080374
Gene: ENSMUSG00000002546
AA Change: N89K

DomainStartEndE-ValueType
low complexity region 33 39 N/A INTRINSIC
coiled coil region 105 173 N/A INTRINSIC
low complexity region 189 202 N/A INTRINSIC
low complexity region 301 313 N/A INTRINSIC
Pfam:GOLGA2L5 337 955 N/A PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000100194
AA Change: N159K

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000097768
Gene: ENSMUSG00000002546
AA Change: N159K

DomainStartEndE-ValueType
low complexity region 3 11 N/A INTRINSIC
low complexity region 45 51 N/A INTRINSIC
low complexity region 98 113 N/A INTRINSIC
coiled coil region 176 244 N/A INTRINSIC
low complexity region 260 273 N/A INTRINSIC
low complexity region 372 384 N/A INTRINSIC
Pfam:GOLGA2L5 408 1026 2.1e-299 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000113377
AA Change: N132K

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000109004
Gene: ENSMUSG00000002546
AA Change: N132K

DomainStartEndE-ValueType
low complexity region 3 11 N/A INTRINSIC
low complexity region 45 51 N/A INTRINSIC
low complexity region 71 86 N/A INTRINSIC
coiled coil region 149 217 N/A INTRINSIC
low complexity region 233 246 N/A INTRINSIC
low complexity region 345 357 N/A INTRINSIC
Pfam:GOLGA2L5 381 999 N/A PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000126276
Predicted Effect noncoding transcript
Transcript: ENSMUST00000127276
Predicted Effect probably damaging
Transcript: ENSMUST00000129193
AA Change: N118K

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000115003
Gene: ENSMUSG00000002546
AA Change: N118K

DomainStartEndE-ValueType
low complexity region 31 37 N/A INTRINSIC
low complexity region 57 72 N/A INTRINSIC
coiled coil region 136 176 N/A INTRINSIC
low complexity region 192 205 N/A INTRINSIC
coiled coil region 226 282 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000131712
AA Change: N93K
SMART Domains Protein: ENSMUSP00000114169
Gene: ENSMUSG00000002546
AA Change: N93K

DomainStartEndE-ValueType
low complexity region 33 39 N/A INTRINSIC
coiled coil region 106 146 N/A INTRINSIC
low complexity region 162 175 N/A INTRINSIC
coiled coil region 196 331 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000139494
AA Change: N169K
SMART Domains Protein: ENSMUSP00000117476
Gene: ENSMUSG00000002546
AA Change: N169K

DomainStartEndE-ValueType
low complexity region 55 61 N/A INTRINSIC
low complexity region 108 123 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000146544
Predicted Effect unknown
Transcript: ENSMUST00000147707
AA Change: N146K
SMART Domains Protein: ENSMUSP00000121886
Gene: ENSMUSG00000002546
AA Change: N146K

DomainStartEndE-ValueType
low complexity region 33 39 N/A INTRINSIC
low complexity region 86 101 N/A INTRINSIC
coiled coil region 165 205 N/A INTRINSIC
low complexity region 221 234 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000149141
Meta Mutation Damage Score 0.1029 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 94.6%
Validation Efficiency 100% (99/99)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The Golgi apparatus, which participates in glycosylation and transport of proteins and lipids in the secretory pathway, consists of a series of stacked cisternae (flattened membrane sacs). Interactions between the Golgi and microtubules are thought to be important for the reorganization of the Golgi after it fragments during mitosis. This gene encodes one of the golgins, a family of proteins localized to the Golgi. This encoded protein has been postulated to play roles in the stacking of Golgi cisternae and in vesicular transport. Several alternatively spliced transcript variants of this gene have been described, but the full-length nature of these variants has not been determined. [provided by RefSeq, Feb 2010]
Allele List at MGI
Other mutations in this stock
Total: 95 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
3110082J24Rik G A 5: 30,105,200 R54* probably null Het
Acsl6 A T 11: 54,336,993 M350L probably damaging Het
Adgrv1 T C 13: 81,095,445 T6279A probably damaging Het
Ago3 A T 4: 126,368,503 M418K probably benign Het
Ascc2 G A 11: 4,646,653 R58H probably benign Het
Brinp3 A G 1: 146,727,640 probably benign Het
Carmil3 T C 14: 55,501,321 probably null Het
Ccdc47 T A 11: 106,203,604 H7L probably benign Het
Ccndbp1 A T 2: 121,008,522 T5S probably benign Het
Cdr2 A T 7: 120,958,421 F294I probably benign Het
Chd8 C A 14: 52,205,368 C575F probably damaging Het
Ctsll3 G A 13: 60,800,395 T156I probably damaging Het
Dgcr8 G A 16: 18,258,310 R4* probably null Het
Dnah1 T A 14: 31,263,479 K3818N probably damaging Het
Dok2 C T 14: 70,777,874 P347L probably benign Het
Elf1 T A 14: 79,580,743 N567K probably benign Het
Emsy T C 7: 98,646,479 N72S possibly damaging Het
Fam155a T C 8: 9,208,026 Y374C probably damaging Het
Fam160a1 G T 3: 85,688,570 T115K probably damaging Het
Fam76a A T 4: 132,902,117 probably null Het
Fam76a A G 4: 132,916,190 Y78H probably damaging Het
Fbn1 A T 2: 125,324,919 C2026S probably damaging Het
Fbxo4 T C 15: 3,969,041 T312A probably benign Het
Flnb A T 14: 7,905,701 E1150D probably benign Het
Galt T C 4: 41,758,189 V318A probably damaging Het
Git1 T G 11: 77,499,837 L133R probably damaging Het
Gm11168 G A 9: 3,006,915 M213I probably benign Het
Gm7233 A G 14: 43,179,966 E25G probably benign Het
Grin1 T A 2: 25,292,381 H956L possibly damaging Het
Hlcs C T 16: 94,268,539 V164I possibly damaging Het
Hmgcr G A 13: 96,666,193 T66M probably damaging Het
Ifi206 A T 1: 173,480,866 H521Q probably benign Het
Lgals3bp G A 11: 118,393,514 T413I probably damaging Het
Lrrc7 A G 3: 158,127,213 probably null Het
Mapk11 T C 15: 89,149,488 Y9C probably damaging Het
Mccc1 C A 3: 35,975,873 M429I probably damaging Het
Metrnl A G 11: 121,707,924 E40G probably benign Het
Mrgpra1 A G 7: 47,335,470 S154P probably damaging Het
Myh13 A T 11: 67,341,270 I459F probably damaging Het
Nedd4l C A 18: 65,172,927 D424E probably damaging Het
Nid1 C T 13: 13,499,741 R902W probably damaging Het
Nphp4 G A 4: 152,554,546 R878K probably benign Het
Numa1 A G 7: 102,013,566 T1997A probably damaging Het
Nutm1 G A 2: 112,248,936 A878V probably benign Het
Nxf1 G A 19: 8,766,798 A339T probably benign Het
Oas1b C A 5: 120,814,513 Q90K probably benign Het
Olfr1175-ps A G 2: 88,323,156 I183T probably damaging Het
Olfr1305 A T 2: 111,873,050 D268E possibly damaging Het
Olfr186 G T 16: 59,027,897 D3E probably benign Het
Olfr199 G T 16: 59,215,859 F251L probably damaging Het
Olfr398 A G 11: 73,984,008 F200S probably damaging Het
Olfr721-ps1 A C 14: 14,407,729 Y167S possibly damaging Het
Olfr998 A G 2: 85,590,938 T133A probably benign Het
Optn T C 2: 5,054,627 M27V probably benign Het
Oxgr1 T C 14: 120,022,364 I144V probably benign Het
Pax5 T A 4: 44,570,086 T127S probably damaging Het
Pcsk2 T C 2: 143,687,679 probably null Het
Pdxk A G 10: 78,464,792 V19A possibly damaging Het
Pik3c2a A T 7: 116,417,825 S232R probably damaging Het
Ppip5k1 T C 2: 121,340,848 D620G possibly damaging Het
Ppp4r4 T A 12: 103,590,858 probably null Het
Pqlc2 G T 4: 139,300,001 H343Q probably benign Het
Psmd1 A G 1: 86,078,712 N267D probably damaging Het
Pudp A G 18: 50,568,065 V199A probably damaging Het
Rasal3 T A 17: 32,396,781 D361V probably damaging Het
Rbm12 T C 2: 156,096,564 D596G possibly damaging Het
Rbm6 T C 9: 107,852,903 D182G probably damaging Het
Rif1 T C 2: 52,112,747 V2071A probably damaging Het
Rilp C T 11: 75,510,641 A110V possibly damaging Het
Rprd2 A G 3: 95,774,333 V332A probably benign Het
Sbpl T A 17: 23,953,330 D205V unknown Het
Scn9a T C 2: 66,540,623 I538V probably benign Het
Serpina1d T C 12: 103,767,824 S74G possibly damaging Het
Serpina3n T C 12: 104,409,110 I147T possibly damaging Het
Serpinb8 A G 1: 107,604,742 N188S probably benign Het
Sipa1l3 A G 7: 29,377,641 V902A probably damaging Het
Slc25a47 T A 12: 108,855,334 L123Q probably damaging Het
Slc30a2 A T 4: 134,344,006 probably null Het
Snx13 T A 12: 35,098,286 D271E probably damaging Het
Tbc1d9b A G 11: 50,171,298 N1211S probably benign Het
Tdrd3 T A 14: 87,472,101 I67N probably damaging Het
Thbs1 T C 2: 118,114,792 V282A probably benign Het
Tmc8 A G 11: 117,791,605 probably null Het
Trim11 T A 11: 58,988,924 F284Y probably null Het
Ttn G T 2: 76,721,797 Y29419* probably null Het
Ttn A G 2: 76,769,603 Y19076H probably damaging Het
Ubr4 T C 4: 139,421,733 S448P possibly damaging Het
Ugt2b34 T C 5: 86,891,473 E443G probably damaging Het
Usp29 A G 7: 6,961,391 T78A probably damaging Het
Vmn1r227 A G 17: 20,735,134 noncoding transcript Het
Vmn1r85 A T 7: 13,084,861 W119R probably damaging Het
Vmn2r12 A T 5: 109,086,513 V611E probably damaging Het
Vmn2r97 A T 17: 18,929,288 M313L probably benign Het
Zap70 T C 1: 36,779,173 Y314H probably damaging Het
Zfp667 T A 7: 6,305,685 F451I possibly damaging Het
Other mutations in Golga2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00531:Golga2 APN 2 32305214 missense probably benign 0.01
IGL01561:Golga2 APN 2 32296677 missense probably benign 0.00
IGL02396:Golga2 APN 2 32298644 splice site probably benign
IGL02636:Golga2 APN 2 32296723 critical splice donor site probably null
IGL02712:Golga2 APN 2 32304213 missense probably damaging 1.00
IGL03172:Golga2 APN 2 32292156 missense probably benign 0.04
IGL03193:Golga2 APN 2 32305008 missense probably damaging 1.00
R0050:Golga2 UTSW 2 32292127 missense probably damaging 0.96
R0050:Golga2 UTSW 2 32292127 missense probably damaging 0.96
R0265:Golga2 UTSW 2 32304952 splice site probably null
R0440:Golga2 UTSW 2 32302933 missense probably damaging 1.00
R0644:Golga2 UTSW 2 32297521 missense probably damaging 1.00
R0825:Golga2 UTSW 2 32304791 missense probably damaging 1.00
R1179:Golga2 UTSW 2 32303695 missense possibly damaging 0.50
R1447:Golga2 UTSW 2 32297776 missense possibly damaging 0.69
R1459:Golga2 UTSW 2 32297795 unclassified probably null
R1517:Golga2 UTSW 2 32305984 nonsense probably null
R1522:Golga2 UTSW 2 32302204 missense probably benign 0.01
R1599:Golga2 UTSW 2 32303173 missense probably benign 0.00
R1702:Golga2 UTSW 2 32299275 missense probably damaging 1.00
R1716:Golga2 UTSW 2 32302897 missense probably damaging 1.00
R1777:Golga2 UTSW 2 32305470 splice site probably null
R1781:Golga2 UTSW 2 32306576 missense probably damaging 1.00
R2229:Golga2 UTSW 2 32306465 missense probably benign 0.06
R2484:Golga2 UTSW 2 32304770 missense probably benign 0.32
R2972:Golga2 UTSW 2 32305659 missense probably benign 0.16
R3411:Golga2 UTSW 2 32302942 missense probably damaging 0.98
R3851:Golga2 UTSW 2 32305611 missense probably benign 0.30
R3852:Golga2 UTSW 2 32305611 missense probably benign 0.30
R4130:Golga2 UTSW 2 32288166 missense probably benign 0.07
R4784:Golga2 UTSW 2 32297156 missense probably damaging 1.00
R4785:Golga2 UTSW 2 32297156 missense probably damaging 1.00
R4808:Golga2 UTSW 2 32303214 missense probably benign 0.00
R5103:Golga2 UTSW 2 32303746 missense probably benign 0.09
R5261:Golga2 UTSW 2 32304154 missense probably benign 0.02
R5315:Golga2 UTSW 2 32303761 missense probably damaging 1.00
R5508:Golga2 UTSW 2 32288187 nonsense probably null
R5627:Golga2 UTSW 2 32306047 nonsense probably null
R5921:Golga2 UTSW 2 32297755 missense probably benign 0.00
R6678:Golga2 UTSW 2 32299060 missense probably damaging 0.99
R7365:Golga2 UTSW 2 32303001 nonsense probably null
R7390:Golga2 UTSW 2 32288190 missense
R7395:Golga2 UTSW 2 32305587 missense possibly damaging 0.94
R7555:Golga2 UTSW 2 32288166 missense probably benign 0.07
R7640:Golga2 UTSW 2 32306239 missense probably benign
Predicted Primers PCR Primer
(F):5'- TACAGAGCCATGATGCTGGC -3'
(R):5'- AGCAGAATCTCCTTTCCTGC -3'

Sequencing Primer
(F):5'- GCAATTGCTCTAACCTCATGGAGG -3'
(R):5'- GCTCAACAGCTGTCACCTC -3'
Posted On2015-12-29