Incidental Mutation 'R4783:Rbm12'
ID366703
Institutional Source Beutler Lab
Gene Symbol Rbm12
Ensembl Gene ENSMUSG00000089824
Gene NameRNA binding motif protein 12
SynonymsSWAN, 5730420G12Rik, 9430070C08Rik
MMRRC Submission 042416-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.910) question?
Stock #R4783 (G1)
Quality Score225
Status Validated
Chromosome2
Chromosomal Location156091958-156111978 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 156096564 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 596 (D596G)
Ref Sequence ENSEMBL: ENSMUSP00000105233 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000059647] [ENSMUST00000079312] [ENSMUST00000109604] [ENSMUST00000109607] [ENSMUST00000109608] [ENSMUST00000128499] [ENSMUST00000131377] [ENSMUST00000132494] [ENSMUST00000133921] [ENSMUST00000136296] [ENSMUST00000138068] [ENSMUST00000142960] [ENSMUST00000147627] [ENSMUST00000153634] [ENSMUST00000154889] [ENSMUST00000183518] [ENSMUST00000183972] [ENSMUST00000184152] [ENSMUST00000184265] [ENSMUST00000184899]
Predicted Effect possibly damaging
Transcript: ENSMUST00000059647
AA Change: D596G

PolyPhen 2 Score 0.950 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000050461
Gene: ENSMUSG00000089824
AA Change: D596G

DomainStartEndE-ValueType
Pfam:RRM_6 5 70 5e-5 PFAM
low complexity region 98 116 N/A INTRINSIC
low complexity region 161 260 N/A INTRINSIC
RRM 305 375 1.05e-1 SMART
RRM 431 503 2.73e-7 SMART
RRM 545 617 8.73e-6 SMART
low complexity region 655 767 N/A INTRINSIC
low complexity region 781 812 N/A INTRINSIC
low complexity region 866 908 N/A INTRINSIC
RRM 917 990 1.03e-7 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000079312
SMART Domains Protein: ENSMUSP00000078292
Gene: ENSMUSG00000074643

DomainStartEndE-ValueType
C2 6 112 3.64e-9 SMART
C2 137 242 8.76e-12 SMART
VWA 282 468 8.96e-2 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000109604
AA Change: D596G

PolyPhen 2 Score 0.950 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000105233
Gene: ENSMUSG00000089824
AA Change: D596G

DomainStartEndE-ValueType
Pfam:RRM_6 5 70 1.1e-5 PFAM
low complexity region 98 116 N/A INTRINSIC
low complexity region 161 260 N/A INTRINSIC
RRM 305 375 1.05e-1 SMART
RRM 431 503 2.73e-7 SMART
RRM 545 617 8.73e-6 SMART
low complexity region 655 767 N/A INTRINSIC
low complexity region 781 812 N/A INTRINSIC
low complexity region 866 908 N/A INTRINSIC
RRM 917 990 1.03e-7 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000109607
SMART Domains Protein: ENSMUSP00000105236
Gene: ENSMUSG00000074643

DomainStartEndE-ValueType
C2 6 112 3.64e-9 SMART
C2 137 242 8.76e-12 SMART
VWA 282 484 9.5e-15 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000109608
SMART Domains Protein: ENSMUSP00000105237
Gene: ENSMUSG00000074643

DomainStartEndE-ValueType
C2 6 112 3.64e-9 SMART
C2 137 242 8.76e-12 SMART
VWA 282 484 9.5e-15 SMART
Predicted Effect unknown
Transcript: ENSMUST00000127956
AA Change: D507G
SMART Domains Protein: ENSMUSP00000114923
Gene: ENSMUSG00000098950
AA Change: D507G

DomainStartEndE-ValueType
low complexity region 10 28 N/A INTRINSIC
low complexity region 73 172 N/A INTRINSIC
RRM 217 287 1.05e-1 SMART
RRM 343 415 2.73e-7 SMART
RRM 457 529 8.73e-6 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000128499
SMART Domains Protein: ENSMUSP00000118067
Gene: ENSMUSG00000089824

DomainStartEndE-ValueType
PDB:2DB1|A 2 86 6e-8 PDB
Blast:RRM_2 4 72 1e-30 BLAST
low complexity region 98 116 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000131377
SMART Domains Protein: ENSMUSP00000120731
Gene: ENSMUSG00000089824

DomainStartEndE-ValueType
PDB:2DB1|A 2 86 1e-7 PDB
Blast:RRM_2 4 72 4e-29 BLAST
low complexity region 98 116 N/A INTRINSIC
low complexity region 161 260 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000132494
AA Change: D596G

PolyPhen 2 Score 0.631 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000139175
Gene: ENSMUSG00000098950
AA Change: D596G

DomainStartEndE-ValueType
Pfam:RRM_6 5 70 1.5e-5 PFAM
low complexity region 98 116 N/A INTRINSIC
low complexity region 161 260 N/A INTRINSIC
RRM 305 375 1.05e-1 SMART
RRM 431 503 2.73e-7 SMART
RRM 545 617 8.73e-6 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000133921
SMART Domains Protein: ENSMUSP00000122644
Gene: ENSMUSG00000074643

DomainStartEndE-ValueType
C2 6 112 3.64e-9 SMART
Pfam:C2 139 178 3.3e-3 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000136296
SMART Domains Protein: ENSMUSP00000122994
Gene: ENSMUSG00000074643

DomainStartEndE-ValueType
C2 6 112 3.64e-9 SMART
C2 123 218 7.88e-5 SMART
Pfam:Copine 279 378 2.3e-41 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000138068
SMART Domains Protein: ENSMUSP00000119519
Gene: ENSMUSG00000089824

DomainStartEndE-ValueType
PDB:2DB1|A 2 86 5e-8 PDB
Blast:RRM_2 4 72 1e-30 BLAST
low complexity region 98 116 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000142960
SMART Domains Protein: ENSMUSP00000121299
Gene: ENSMUSG00000074643

DomainStartEndE-ValueType
C2 6 112 2.4e-11 SMART
C2 123 206 3e-2 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000142975
Predicted Effect probably benign
Transcript: ENSMUST00000147627
SMART Domains Protein: ENSMUSP00000116982
Gene: ENSMUSG00000074643

DomainStartEndE-ValueType
C2 6 112 3.64e-9 SMART
C2 137 242 8.76e-12 SMART
Pfam:Copine 303 350 1.3e-16 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000153634
SMART Domains Protein: ENSMUSP00000115167
Gene: ENSMUSG00000074643

DomainStartEndE-ValueType
C2 6 112 3.64e-9 SMART
C2 123 218 7.88e-5 SMART
Pfam:Copine 279 325 4.1e-16 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000154889
SMART Domains Protein: ENSMUSP00000118140
Gene: ENSMUSG00000074643

DomainStartEndE-ValueType
C2 6 112 3.64e-9 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000159952
SMART Domains Protein: ENSMUSP00000124101
Gene: ENSMUSG00000098950

DomainStartEndE-ValueType
SCOP:d1eg5a_ 3 82 2e-15 SMART
PDB:1P3W|A 3 86 3e-34 PDB
low complexity region 93 106 N/A INTRINSIC
Blast:RRM_2 124 160 2e-14 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000160165
SMART Domains Protein: ENSMUSP00000124858
Gene: ENSMUSG00000098950

DomainStartEndE-ValueType
PDB:1P3W|A 3 28 1e-6 PDB
low complexity region 36 50 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000162612
SMART Domains Protein: ENSMUSP00000125190
Gene: ENSMUSG00000098950

DomainStartEndE-ValueType
SCOP:d1eg5a_ 3 82 1e-15 SMART
PDB:1P3W|A 3 86 2e-34 PDB
low complexity region 93 106 N/A INTRINSIC
Blast:RRM_2 124 161 1e-14 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000183518
SMART Domains Protein: ENSMUSP00000139010
Gene: ENSMUSG00000098950

DomainStartEndE-ValueType
Blast:RRM_2 4 40 4e-15 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000183972
Predicted Effect probably benign
Transcript: ENSMUST00000184152
SMART Domains Protein: ENSMUSP00000139035
Gene: ENSMUSG00000074643

DomainStartEndE-ValueType
C2 6 112 3.64e-9 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000184265
SMART Domains Protein: ENSMUSP00000138888
Gene: ENSMUSG00000074643

DomainStartEndE-ValueType
C2 6 112 3.64e-9 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000184899
SMART Domains Protein: ENSMUSP00000139177
Gene: ENSMUSG00000098950

DomainStartEndE-ValueType
Blast:RRM_2 4 54 2e-25 BLAST
SCOP:d2u1a__ 9 68 6e-3 SMART
Meta Mutation Damage Score 0.2278 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 94.6%
Validation Efficiency 100% (99/99)
MGI Phenotype FUNCTION: This gene encodes a protein that contains several RNA-binding motifs, potential transmembrane domains, and proline-rich regions. This gene and the gene for copine I overlap at map location 2 H2. Two alternatively spliced transcript variants have been identified for this gene. Both variants encode the same protein. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for an ENU mutation exhibit open neural tube and embryonic growth retardation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 95 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
3110082J24Rik G A 5: 30,105,200 R54* probably null Het
Acsl6 A T 11: 54,336,993 M350L probably damaging Het
Adgrv1 T C 13: 81,095,445 T6279A probably damaging Het
Ago3 A T 4: 126,368,503 M418K probably benign Het
Ascc2 G A 11: 4,646,653 R58H probably benign Het
Brinp3 A G 1: 146,727,640 probably benign Het
Carmil3 T C 14: 55,501,321 probably null Het
Ccdc47 T A 11: 106,203,604 H7L probably benign Het
Ccndbp1 A T 2: 121,008,522 T5S probably benign Het
Cdr2 A T 7: 120,958,421 F294I probably benign Het
Chd8 C A 14: 52,205,368 C575F probably damaging Het
Ctsll3 G A 13: 60,800,395 T156I probably damaging Het
Dgcr8 G A 16: 18,258,310 R4* probably null Het
Dnah1 T A 14: 31,263,479 K3818N probably damaging Het
Dok2 C T 14: 70,777,874 P347L probably benign Het
Elf1 T A 14: 79,580,743 N567K probably benign Het
Emsy T C 7: 98,646,479 N72S possibly damaging Het
Fam155a T C 8: 9,208,026 Y374C probably damaging Het
Fam160a1 G T 3: 85,688,570 T115K probably damaging Het
Fam76a A T 4: 132,902,117 probably null Het
Fam76a A G 4: 132,916,190 Y78H probably damaging Het
Fbn1 A T 2: 125,324,919 C2026S probably damaging Het
Fbxo4 T C 15: 3,969,041 T312A probably benign Het
Flnb A T 14: 7,905,701 E1150D probably benign Het
Galt T C 4: 41,758,189 V318A probably damaging Het
Git1 T G 11: 77,499,837 L133R probably damaging Het
Gm11168 G A 9: 3,006,915 M213I probably benign Het
Gm7233 A G 14: 43,179,966 E25G probably benign Het
Golga2 T A 2: 32,297,156 N89K probably damaging Het
Grin1 T A 2: 25,292,381 H956L possibly damaging Het
Hlcs C T 16: 94,268,539 V164I possibly damaging Het
Hmgcr G A 13: 96,666,193 T66M probably damaging Het
Ifi206 A T 1: 173,480,866 H521Q probably benign Het
Lgals3bp G A 11: 118,393,514 T413I probably damaging Het
Lrrc7 A G 3: 158,127,213 probably null Het
Mapk11 T C 15: 89,149,488 Y9C probably damaging Het
Mccc1 C A 3: 35,975,873 M429I probably damaging Het
Metrnl A G 11: 121,707,924 E40G probably benign Het
Mrgpra1 A G 7: 47,335,470 S154P probably damaging Het
Myh13 A T 11: 67,341,270 I459F probably damaging Het
Nedd4l C A 18: 65,172,927 D424E probably damaging Het
Nid1 C T 13: 13,499,741 R902W probably damaging Het
Nphp4 G A 4: 152,554,546 R878K probably benign Het
Numa1 A G 7: 102,013,566 T1997A probably damaging Het
Nutm1 G A 2: 112,248,936 A878V probably benign Het
Nxf1 G A 19: 8,766,798 A339T probably benign Het
Oas1b C A 5: 120,814,513 Q90K probably benign Het
Olfr1175-ps A G 2: 88,323,156 I183T probably damaging Het
Olfr1305 A T 2: 111,873,050 D268E possibly damaging Het
Olfr186 G T 16: 59,027,897 D3E probably benign Het
Olfr199 G T 16: 59,215,859 F251L probably damaging Het
Olfr398 A G 11: 73,984,008 F200S probably damaging Het
Olfr721-ps1 A C 14: 14,407,729 Y167S possibly damaging Het
Olfr998 A G 2: 85,590,938 T133A probably benign Het
Optn T C 2: 5,054,627 M27V probably benign Het
Oxgr1 T C 14: 120,022,364 I144V probably benign Het
Pax5 T A 4: 44,570,086 T127S probably damaging Het
Pcsk2 T C 2: 143,687,679 probably null Het
Pdxk A G 10: 78,464,792 V19A possibly damaging Het
Pik3c2a A T 7: 116,417,825 S232R probably damaging Het
Ppip5k1 T C 2: 121,340,848 D620G possibly damaging Het
Ppp4r4 T A 12: 103,590,858 probably null Het
Pqlc2 G T 4: 139,300,001 H343Q probably benign Het
Psmd1 A G 1: 86,078,712 N267D probably damaging Het
Pudp A G 18: 50,568,065 V199A probably damaging Het
Rasal3 T A 17: 32,396,781 D361V probably damaging Het
Rbm6 T C 9: 107,852,903 D182G probably damaging Het
Rif1 T C 2: 52,112,747 V2071A probably damaging Het
Rilp C T 11: 75,510,641 A110V possibly damaging Het
Rprd2 A G 3: 95,774,333 V332A probably benign Het
Sbpl T A 17: 23,953,330 D205V unknown Het
Scn9a T C 2: 66,540,623 I538V probably benign Het
Serpina1d T C 12: 103,767,824 S74G possibly damaging Het
Serpina3n T C 12: 104,409,110 I147T possibly damaging Het
Serpinb8 A G 1: 107,604,742 N188S probably benign Het
Sipa1l3 A G 7: 29,377,641 V902A probably damaging Het
Slc25a47 T A 12: 108,855,334 L123Q probably damaging Het
Slc30a2 A T 4: 134,344,006 probably null Het
Snx13 T A 12: 35,098,286 D271E probably damaging Het
Tbc1d9b A G 11: 50,171,298 N1211S probably benign Het
Tdrd3 T A 14: 87,472,101 I67N probably damaging Het
Thbs1 T C 2: 118,114,792 V282A probably benign Het
Tmc8 A G 11: 117,791,605 probably null Het
Trim11 T A 11: 58,988,924 F284Y probably null Het
Ttn G T 2: 76,721,797 Y29419* probably null Het
Ttn A G 2: 76,769,603 Y19076H probably damaging Het
Ubr4 T C 4: 139,421,733 S448P possibly damaging Het
Ugt2b34 T C 5: 86,891,473 E443G probably damaging Het
Usp29 A G 7: 6,961,391 T78A probably damaging Het
Vmn1r227 A G 17: 20,735,134 noncoding transcript Het
Vmn1r85 A T 7: 13,084,861 W119R probably damaging Het
Vmn2r12 A T 5: 109,086,513 V611E probably damaging Het
Vmn2r97 A T 17: 18,929,288 M313L probably benign Het
Zap70 T C 1: 36,779,173 Y314H probably damaging Het
Zfp667 T A 7: 6,305,685 F451I possibly damaging Het
Other mutations in Rbm12
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00578:Rbm12 APN 2 156096041 intron probably benign
IGL01307:Rbm12 APN 2 156095382 intron probably benign
IGL02474:Rbm12 APN 2 156098097 missense probably damaging 1.00
IGL02596:Rbm12 APN 2 156095560 intron probably benign
IGL02601:Rbm12 APN 2 156095560 intron probably benign
IGL02603:Rbm12 APN 2 156095560 intron probably benign
IGL02608:Rbm12 APN 2 156095898 intron probably benign
IGL02679:Rbm12 APN 2 156095560 intron probably benign
IGL02691:Rbm12 APN 2 156095560 intron probably benign
IGL02693:Rbm12 APN 2 156095560 intron probably benign
IGL02702:Rbm12 APN 2 156095560 intron probably benign
IGL02703:Rbm12 APN 2 156095560 intron probably benign
IGL03407:Rbm12 APN 2 156097564 nonsense probably null
IGL02991:Rbm12 UTSW 2 156095560 intron probably benign
R0310:Rbm12 UTSW 2 156095724 intron probably benign
R1213:Rbm12 UTSW 2 156097492 nonsense probably null
R1280:Rbm12 UTSW 2 156096829 missense probably damaging 1.00
R1511:Rbm12 UTSW 2 156097536 missense probably damaging 0.98
R1951:Rbm12 UTSW 2 156097213 missense probably damaging 0.99
R2131:Rbm12 UTSW 2 156095510 nonsense probably null
R2133:Rbm12 UTSW 2 156095510 nonsense probably null
R2883:Rbm12 UTSW 2 156097075 missense probably damaging 0.98
R4760:Rbm12 UTSW 2 156097128 missense probably damaging 0.99
R4784:Rbm12 UTSW 2 156096564 missense possibly damaging 0.95
R4785:Rbm12 UTSW 2 156096564 missense possibly damaging 0.95
R4794:Rbm12 UTSW 2 156095569 intron probably benign
R5057:Rbm12 UTSW 2 156096886 missense probably benign 0.18
R5383:Rbm12 UTSW 2 156103365 utr 5 prime probably benign
R5599:Rbm12 UTSW 2 156096793 nonsense probably null
R5979:Rbm12 UTSW 2 156097759 intron probably benign
R6083:Rbm12 UTSW 2 156097726 intron probably benign
R6769:Rbm12 UTSW 2 156097455 missense possibly damaging 0.95
R6771:Rbm12 UTSW 2 156097455 missense possibly damaging 0.95
R7233:Rbm12 UTSW 2 156095974 missense unknown
R7424:Rbm12 UTSW 2 156097303 missense possibly damaging 0.57
R7483:Rbm12 UTSW 2 156098218 missense unknown
R7643:Rbm12 UTSW 2 156098217 missense unknown
R7848:Rbm12 UTSW 2 156096216 missense probably benign 0.01
R7931:Rbm12 UTSW 2 156096216 missense probably benign 0.01
RF001:Rbm12 UTSW 2 156096075 intron probably benign
RF021:Rbm12 UTSW 2 156096106 intron probably benign
RF028:Rbm12 UTSW 2 156096130 frame shift probably null
RF029:Rbm12 UTSW 2 156096095 intron probably benign
RF033:Rbm12 UTSW 2 156096079 intron probably benign
RF033:Rbm12 UTSW 2 156096080 intron probably benign
RF033:Rbm12 UTSW 2 156096082 intron probably benign
RF033:Rbm12 UTSW 2 156096083 intron probably benign
RF033:Rbm12 UTSW 2 156096084 intron probably benign
RF038:Rbm12 UTSW 2 156096106 intron probably benign
Predicted Primers PCR Primer
(F):5'- CCTGCACTAGGTATCACTGG -3'
(R):5'- ACTTCAGCTATGACCAGAGGG -3'

Sequencing Primer
(F):5'- CACTAGGTATCACTGGTACTGCAG -3'
(R):5'- CTTCAGCTATGACCAGAGGGAACTG -3'
Posted On2015-12-29