Incidental Mutation 'R4783:Mrgpra1'
ID366724
Institutional Source Beutler Lab
Gene Symbol Mrgpra1
Ensembl Gene ENSMUSG00000050650
Gene NameMAS-related GPR, member A1
SynonymsMrgA1
MMRRC Submission 042416-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.056) question?
Stock #R4783 (G1)
Quality Score225
Status Validated
Chromosome7
Chromosomal Location47334875-47354240 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 47335470 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 154 (S154P)
Ref Sequence ENSEMBL: ENSMUSP00000129978 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000098438]
Predicted Effect probably damaging
Transcript: ENSMUST00000098438
AA Change: S154P

PolyPhen 2 Score 0.980 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000129978
Gene: ENSMUSG00000050650
AA Change: S154P

DomainStartEndE-ValueType
low complexity region 14 27 N/A INTRINSIC
low complexity region 36 49 N/A INTRINSIC
Pfam:7tm_1 57 225 2.1e-8 PFAM
Meta Mutation Damage Score 0.6467 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 94.6%
Validation Efficiency 100% (99/99)
Allele List at MGI
Other mutations in this stock
Total: 95 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
3110082J24Rik G A 5: 30,105,200 R54* probably null Het
Acsl6 A T 11: 54,336,993 M350L probably damaging Het
Adgrv1 T C 13: 81,095,445 T6279A probably damaging Het
Ago3 A T 4: 126,368,503 M418K probably benign Het
Ascc2 G A 11: 4,646,653 R58H probably benign Het
Brinp3 A G 1: 146,727,640 probably benign Het
Carmil3 T C 14: 55,501,321 probably null Het
Ccdc47 T A 11: 106,203,604 H7L probably benign Het
Ccndbp1 A T 2: 121,008,522 T5S probably benign Het
Cdr2 A T 7: 120,958,421 F294I probably benign Het
Chd8 C A 14: 52,205,368 C575F probably damaging Het
Ctsll3 G A 13: 60,800,395 T156I probably damaging Het
Dgcr8 G A 16: 18,258,310 R4* probably null Het
Dnah1 T A 14: 31,263,479 K3818N probably damaging Het
Dok2 C T 14: 70,777,874 P347L probably benign Het
Elf1 T A 14: 79,580,743 N567K probably benign Het
Emsy T C 7: 98,646,479 N72S possibly damaging Het
Fam155a T C 8: 9,208,026 Y374C probably damaging Het
Fam160a1 G T 3: 85,688,570 T115K probably damaging Het
Fam76a A T 4: 132,902,117 probably null Het
Fam76a A G 4: 132,916,190 Y78H probably damaging Het
Fbn1 A T 2: 125,324,919 C2026S probably damaging Het
Fbxo4 T C 15: 3,969,041 T312A probably benign Het
Flnb A T 14: 7,905,701 E1150D probably benign Het
Galt T C 4: 41,758,189 V318A probably damaging Het
Git1 T G 11: 77,499,837 L133R probably damaging Het
Gm11168 G A 9: 3,006,915 M213I probably benign Het
Gm7233 A G 14: 43,179,966 E25G probably benign Het
Golga2 T A 2: 32,297,156 N89K probably damaging Het
Grin1 T A 2: 25,292,381 H956L possibly damaging Het
Hlcs C T 16: 94,268,539 V164I possibly damaging Het
Hmgcr G A 13: 96,666,193 T66M probably damaging Het
Ifi206 A T 1: 173,480,866 H521Q probably benign Het
Lgals3bp G A 11: 118,393,514 T413I probably damaging Het
Lrrc7 A G 3: 158,127,213 probably null Het
Mapk11 T C 15: 89,149,488 Y9C probably damaging Het
Mccc1 C A 3: 35,975,873 M429I probably damaging Het
Metrnl A G 11: 121,707,924 E40G probably benign Het
Myh13 A T 11: 67,341,270 I459F probably damaging Het
Nedd4l C A 18: 65,172,927 D424E probably damaging Het
Nid1 C T 13: 13,499,741 R902W probably damaging Het
Nphp4 G A 4: 152,554,546 R878K probably benign Het
Numa1 A G 7: 102,013,566 T1997A probably damaging Het
Nutm1 G A 2: 112,248,936 A878V probably benign Het
Nxf1 G A 19: 8,766,798 A339T probably benign Het
Oas1b C A 5: 120,814,513 Q90K probably benign Het
Olfr1175-ps A G 2: 88,323,156 I183T probably damaging Het
Olfr1305 A T 2: 111,873,050 D268E possibly damaging Het
Olfr186 G T 16: 59,027,897 D3E probably benign Het
Olfr199 G T 16: 59,215,859 F251L probably damaging Het
Olfr398 A G 11: 73,984,008 F200S probably damaging Het
Olfr721-ps1 A C 14: 14,407,729 Y167S possibly damaging Het
Olfr998 A G 2: 85,590,938 T133A probably benign Het
Optn T C 2: 5,054,627 M27V probably benign Het
Oxgr1 T C 14: 120,022,364 I144V probably benign Het
Pax5 T A 4: 44,570,086 T127S probably damaging Het
Pcsk2 T C 2: 143,687,679 probably null Het
Pdxk A G 10: 78,464,792 V19A possibly damaging Het
Pik3c2a A T 7: 116,417,825 S232R probably damaging Het
Ppip5k1 T C 2: 121,340,848 D620G possibly damaging Het
Ppp4r4 T A 12: 103,590,858 probably null Het
Pqlc2 G T 4: 139,300,001 H343Q probably benign Het
Psmd1 A G 1: 86,078,712 N267D probably damaging Het
Pudp A G 18: 50,568,065 V199A probably damaging Het
Rasal3 T A 17: 32,396,781 D361V probably damaging Het
Rbm12 T C 2: 156,096,564 D596G possibly damaging Het
Rbm6 T C 9: 107,852,903 D182G probably damaging Het
Rif1 T C 2: 52,112,747 V2071A probably damaging Het
Rilp C T 11: 75,510,641 A110V possibly damaging Het
Rprd2 A G 3: 95,774,333 V332A probably benign Het
Sbpl T A 17: 23,953,330 D205V unknown Het
Scn9a T C 2: 66,540,623 I538V probably benign Het
Serpina1d T C 12: 103,767,824 S74G possibly damaging Het
Serpina3n T C 12: 104,409,110 I147T possibly damaging Het
Serpinb8 A G 1: 107,604,742 N188S probably benign Het
Sipa1l3 A G 7: 29,377,641 V902A probably damaging Het
Slc25a47 T A 12: 108,855,334 L123Q probably damaging Het
Slc30a2 A T 4: 134,344,006 probably null Het
Snx13 T A 12: 35,098,286 D271E probably damaging Het
Tbc1d9b A G 11: 50,171,298 N1211S probably benign Het
Tdrd3 T A 14: 87,472,101 I67N probably damaging Het
Thbs1 T C 2: 118,114,792 V282A probably benign Het
Tmc8 A G 11: 117,791,605 probably null Het
Trim11 T A 11: 58,988,924 F284Y probably null Het
Ttn G T 2: 76,721,797 Y29419* probably null Het
Ttn A G 2: 76,769,603 Y19076H probably damaging Het
Ubr4 T C 4: 139,421,733 S448P possibly damaging Het
Ugt2b34 T C 5: 86,891,473 E443G probably damaging Het
Usp29 A G 7: 6,961,391 T78A probably damaging Het
Vmn1r227 A G 17: 20,735,134 noncoding transcript Het
Vmn1r85 A T 7: 13,084,861 W119R probably damaging Het
Vmn2r12 A T 5: 109,086,513 V611E probably damaging Het
Vmn2r97 A T 17: 18,929,288 M313L probably benign Het
Zap70 T C 1: 36,779,173 Y314H probably damaging Het
Zfp667 T A 7: 6,305,685 F451I possibly damaging Het
Other mutations in Mrgpra1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00903:Mrgpra1 APN 7 47335578 missense probably benign 0.00
IGL01317:Mrgpra1 APN 7 47335624 missense probably benign 0.00
IGL01718:Mrgpra1 APN 7 47335927 splice site probably null
IGL02252:Mrgpra1 APN 7 47335164 missense probably benign 0.00
IGL03301:Mrgpra1 APN 7 47335416 missense probably benign
R0012:Mrgpra1 UTSW 7 47335470 missense probably damaging 0.98
R1019:Mrgpra1 UTSW 7 47335085 missense probably benign 0.00
R2224:Mrgpra1 UTSW 7 47335106 missense possibly damaging 0.50
R2520:Mrgpra1 UTSW 7 47335272 missense possibly damaging 0.75
R2924:Mrgpra1 UTSW 7 47334870 unclassified probably null
R3038:Mrgpra1 UTSW 7 47334996 nonsense probably null
R3900:Mrgpra1 UTSW 7 47335527 missense possibly damaging 0.76
R4692:Mrgpra1 UTSW 7 47335698 missense probably damaging 1.00
R4784:Mrgpra1 UTSW 7 47335470 missense probably damaging 0.98
R4785:Mrgpra1 UTSW 7 47335470 missense probably damaging 0.98
R4981:Mrgpra1 UTSW 7 47335211 missense probably damaging 1.00
R5031:Mrgpra1 UTSW 7 47335237 nonsense probably null
R6760:Mrgpra1 UTSW 7 47335041 missense probably benign 0.03
R7305:Mrgpra1 UTSW 7 47335455 missense probably benign 0.38
R7348:Mrgpra1 UTSW 7 47335409 missense probably benign 0.09
R7837:Mrgpra1 UTSW 7 47335328 missense possibly damaging 0.68
R7920:Mrgpra1 UTSW 7 47335328 missense possibly damaging 0.68
R8158:Mrgpra1 UTSW 7 47335456 nonsense probably null
X0012:Mrgpra1 UTSW 7 47335875 missense probably benign
Predicted Primers PCR Primer
(F):5'- TTTATCTGCCCAGTACCACAG -3'
(R):5'- ACAGGAACGCCTTCTCAGTC -3'

Sequencing Primer
(F):5'- CAGAGCCAGGCTGGACAGAC -3'
(R):5'- GGTCACATCATAGATTCCATACTGC -3'
Posted On2015-12-29