Incidental Mutation 'R4783:Myh13'
ID366738
Institutional Source Beutler Lab
Gene Symbol Myh13
Ensembl Gene ENSMUSG00000060180
Gene Namemyosin, heavy polypeptide 13, skeletal muscle
SynonymsEO Myosin, extraocular myosin, MyHC-eo
MMRRC Submission 042416-MU
Accession Numbers

Genbank: NM_001081250; MGI: 1339967

Is this an essential gene? Probably non essential (E-score: 0.210) question?
Stock #R4783 (G1)
Quality Score225
Status Validated
Chromosome11
Chromosomal Location67321658-67371586 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 67341270 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Phenylalanine at position 459 (I459F)
Ref Sequence ENSEMBL: ENSMUSP00000137731 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000081911] [ENSMUST00000108684] [ENSMUST00000180845]
Predicted Effect probably damaging
Transcript: ENSMUST00000081911
AA Change: I459F

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000080584
Gene: ENSMUSG00000060180
AA Change: I459F

DomainStartEndE-ValueType
Pfam:Myosin_N 35 74 8e-13 PFAM
MYSc 80 783 N/A SMART
IQ 784 806 4.6e-1 SMART
Pfam:Myosin_tail_1 847 1928 4.6e-159 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000108684
AA Change: I459F

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000104324
Gene: ENSMUSG00000060180
AA Change: I459F

DomainStartEndE-ValueType
Pfam:Myosin_N 35 76 2.8e-14 PFAM
MYSc 80 783 N/A SMART
IQ 784 806 4.6e-1 SMART
low complexity region 847 858 N/A INTRINSIC
low complexity region 925 940 N/A INTRINSIC
Pfam:Myosin_tail_1 1072 1930 N/A PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000180845
AA Change: I459F

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000137731
Gene: ENSMUSG00000060180
AA Change: I459F

DomainStartEndE-ValueType
Pfam:Myosin_N 35 76 2.8e-14 PFAM
MYSc 80 783 N/A SMART
IQ 784 806 4.6e-1 SMART
low complexity region 847 858 N/A INTRINSIC
low complexity region 925 940 N/A INTRINSIC
Pfam:Myosin_tail_1 1072 1930 N/A PFAM
Meta Mutation Damage Score 0.6953 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 94.6%
Validation Efficiency 100% (99/99)
Allele List at MGI

All alleles(4) : Gene trapped(4)

Other mutations in this stock
Total: 95 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
3110082J24Rik G A 5: 30,105,200 R54* probably null Het
Acsl6 A T 11: 54,336,993 M350L probably damaging Het
Adgrv1 T C 13: 81,095,445 T6279A probably damaging Het
Ago3 A T 4: 126,368,503 M418K probably benign Het
Ascc2 G A 11: 4,646,653 R58H probably benign Het
Brinp3 A G 1: 146,727,640 probably benign Het
Carmil3 T C 14: 55,501,321 probably null Het
Ccdc47 T A 11: 106,203,604 H7L probably benign Het
Ccndbp1 A T 2: 121,008,522 T5S probably benign Het
Cdr2 A T 7: 120,958,421 F294I probably benign Het
Chd8 C A 14: 52,205,368 C575F probably damaging Het
Ctsll3 G A 13: 60,800,395 T156I probably damaging Het
Dgcr8 G A 16: 18,258,310 R4* probably null Het
Dnah1 T A 14: 31,263,479 K3818N probably damaging Het
Dok2 C T 14: 70,777,874 P347L probably benign Het
Elf1 T A 14: 79,580,743 N567K probably benign Het
Emsy T C 7: 98,646,479 N72S possibly damaging Het
Fam155a T C 8: 9,208,026 Y374C probably damaging Het
Fam160a1 G T 3: 85,688,570 T115K probably damaging Het
Fam76a A T 4: 132,902,117 probably null Het
Fam76a A G 4: 132,916,190 Y78H probably damaging Het
Fbn1 A T 2: 125,324,919 C2026S probably damaging Het
Fbxo4 T C 15: 3,969,041 T312A probably benign Het
Flnb A T 14: 7,905,701 E1150D probably benign Het
Galt T C 4: 41,758,189 V318A probably damaging Het
Git1 T G 11: 77,499,837 L133R probably damaging Het
Gm11168 G A 9: 3,006,915 M213I probably benign Het
Gm7233 A G 14: 43,179,966 E25G probably benign Het
Golga2 T A 2: 32,297,156 N89K probably damaging Het
Grin1 T A 2: 25,292,381 H956L possibly damaging Het
Hlcs C T 16: 94,268,539 V164I possibly damaging Het
Hmgcr G A 13: 96,666,193 T66M probably damaging Het
Ifi206 A T 1: 173,480,866 H521Q probably benign Het
Lgals3bp G A 11: 118,393,514 T413I probably damaging Het
Lrrc7 A G 3: 158,127,213 probably null Het
Mapk11 T C 15: 89,149,488 Y9C probably damaging Het
Mccc1 C A 3: 35,975,873 M429I probably damaging Het
Metrnl A G 11: 121,707,924 E40G probably benign Het
Mrgpra1 A G 7: 47,335,470 S154P probably damaging Het
Nedd4l C A 18: 65,172,927 D424E probably damaging Het
Nid1 C T 13: 13,499,741 R902W probably damaging Het
Nphp4 G A 4: 152,554,546 R878K probably benign Het
Numa1 A G 7: 102,013,566 T1997A probably damaging Het
Nutm1 G A 2: 112,248,936 A878V probably benign Het
Nxf1 G A 19: 8,766,798 A339T probably benign Het
Oas1b C A 5: 120,814,513 Q90K probably benign Het
Olfr1175-ps A G 2: 88,323,156 I183T probably damaging Het
Olfr1305 A T 2: 111,873,050 D268E possibly damaging Het
Olfr186 G T 16: 59,027,897 D3E probably benign Het
Olfr199 G T 16: 59,215,859 F251L probably damaging Het
Olfr398 A G 11: 73,984,008 F200S probably damaging Het
Olfr721-ps1 A C 14: 14,407,729 Y167S possibly damaging Het
Olfr998 A G 2: 85,590,938 T133A probably benign Het
Optn T C 2: 5,054,627 M27V probably benign Het
Oxgr1 T C 14: 120,022,364 I144V probably benign Het
Pax5 T A 4: 44,570,086 T127S probably damaging Het
Pcsk2 T C 2: 143,687,679 probably null Het
Pdxk A G 10: 78,464,792 V19A possibly damaging Het
Pik3c2a A T 7: 116,417,825 S232R probably damaging Het
Ppip5k1 T C 2: 121,340,848 D620G possibly damaging Het
Ppp4r4 T A 12: 103,590,858 probably null Het
Pqlc2 G T 4: 139,300,001 H343Q probably benign Het
Psmd1 A G 1: 86,078,712 N267D probably damaging Het
Pudp A G 18: 50,568,065 V199A probably damaging Het
Rasal3 T A 17: 32,396,781 D361V probably damaging Het
Rbm12 T C 2: 156,096,564 D596G possibly damaging Het
Rbm6 T C 9: 107,852,903 D182G probably damaging Het
Rif1 T C 2: 52,112,747 V2071A probably damaging Het
Rilp C T 11: 75,510,641 A110V possibly damaging Het
Rprd2 A G 3: 95,774,333 V332A probably benign Het
Sbpl T A 17: 23,953,330 D205V unknown Het
Scn9a T C 2: 66,540,623 I538V probably benign Het
Serpina1d T C 12: 103,767,824 S74G possibly damaging Het
Serpina3n T C 12: 104,409,110 I147T possibly damaging Het
Serpinb8 A G 1: 107,604,742 N188S probably benign Het
Sipa1l3 A G 7: 29,377,641 V902A probably damaging Het
Slc25a47 T A 12: 108,855,334 L123Q probably damaging Het
Slc30a2 A T 4: 134,344,006 probably null Het
Snx13 T A 12: 35,098,286 D271E probably damaging Het
Tbc1d9b A G 11: 50,171,298 N1211S probably benign Het
Tdrd3 T A 14: 87,472,101 I67N probably damaging Het
Thbs1 T C 2: 118,114,792 V282A probably benign Het
Tmc8 A G 11: 117,791,605 probably null Het
Trim11 T A 11: 58,988,924 F284Y probably null Het
Ttn G T 2: 76,721,797 Y29419* probably null Het
Ttn A G 2: 76,769,603 Y19076H probably damaging Het
Ubr4 T C 4: 139,421,733 S448P possibly damaging Het
Ugt2b34 T C 5: 86,891,473 E443G probably damaging Het
Usp29 A G 7: 6,961,391 T78A probably damaging Het
Vmn1r227 A G 17: 20,735,134 noncoding transcript Het
Vmn1r85 A T 7: 13,084,861 W119R probably damaging Het
Vmn2r12 A T 5: 109,086,513 V611E probably damaging Het
Vmn2r97 A T 17: 18,929,288 M313L probably benign Het
Zap70 T C 1: 36,779,173 Y314H probably damaging Het
Zfp667 T A 7: 6,305,685 F451I possibly damaging Het
Other mutations in Myh13
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00497:Myh13 APN 11 67342488 missense probably damaging 1.00
IGL00808:Myh13 APN 11 67335004 critical splice donor site probably null
IGL00822:Myh13 APN 11 67361328 missense probably damaging 0.98
IGL00823:Myh13 APN 11 67355947 missense probably benign 0.00
IGL00945:Myh13 APN 11 67348006 missense probably null 1.00
IGL01414:Myh13 APN 11 67342472 missense probably benign 0.02
IGL01482:Myh13 APN 11 67352068 missense probably benign
IGL01523:Myh13 APN 11 67347943 missense possibly damaging 0.73
IGL01723:Myh13 APN 11 67369219 unclassified probably benign
IGL01997:Myh13 APN 11 67367166 missense probably benign 0.14
IGL02369:Myh13 APN 11 67360274 unclassified probably benign
IGL02478:Myh13 APN 11 67369378 missense probably benign
IGL02663:Myh13 APN 11 67354927 nonsense probably null
IGL02851:Myh13 APN 11 67348916 missense possibly damaging 0.92
IGL02863:Myh13 APN 11 67332541 missense probably damaging 1.00
IGL02929:Myh13 APN 11 67367165 missense probably damaging 1.00
IGL02979:Myh13 APN 11 67334962 missense possibly damaging 0.72
IGL03065:Myh13 APN 11 67344853 missense probably damaging 0.99
IGL03214:Myh13 APN 11 67353585 missense possibly damaging 0.79
IGL03223:Myh13 APN 11 67350242 missense probably benign 0.39
IGL03231:Myh13 APN 11 67351991 missense possibly damaging 0.94
IGL03407:Myh13 APN 11 67352152 missense probably damaging 1.00
3-1:Myh13 UTSW 11 67351951 splice site probably benign
P0042:Myh13 UTSW 11 67334991 missense probably benign 0.00
R0047:Myh13 UTSW 11 67367237 missense probably benign 0.00
R0047:Myh13 UTSW 11 67367237 missense probably benign 0.00
R0379:Myh13 UTSW 11 67369295 unclassified probably benign
R0496:Myh13 UTSW 11 67348815 missense probably damaging 1.00
R0584:Myh13 UTSW 11 67360374 nonsense probably null
R0595:Myh13 UTSW 11 67344846 missense probably benign 0.03
R0621:Myh13 UTSW 11 67341232 missense probably damaging 0.98
R0834:Myh13 UTSW 11 67349610 missense possibly damaging 0.88
R0893:Myh13 UTSW 11 67334601 missense probably damaging 1.00
R0964:Myh13 UTSW 11 67345002 missense probably benign 0.02
R0973:Myh13 UTSW 11 67332520 missense probably damaging 1.00
R0973:Myh13 UTSW 11 67332520 missense probably damaging 1.00
R0974:Myh13 UTSW 11 67332520 missense probably damaging 1.00
R1028:Myh13 UTSW 11 67356181 missense possibly damaging 0.71
R1112:Myh13 UTSW 11 67354750 missense probably damaging 1.00
R1283:Myh13 UTSW 11 67370921 missense probably damaging 1.00
R1288:Myh13 UTSW 11 67353718 missense probably benign 0.00
R1386:Myh13 UTSW 11 67370950 missense possibly damaging 0.79
R1457:Myh13 UTSW 11 67331046 missense probably damaging 0.97
R1503:Myh13 UTSW 11 67353674 missense probably benign 0.43
R1574:Myh13 UTSW 11 67362581 unclassified probably benign
R1673:Myh13 UTSW 11 67352119 missense possibly damaging 0.79
R1693:Myh13 UTSW 11 67341484 missense possibly damaging 0.95
R1763:Myh13 UTSW 11 67334576 missense probably benign
R2029:Myh13 UTSW 11 67361289 missense probably benign 0.03
R2030:Myh13 UTSW 11 67350238 missense probably benign
R2247:Myh13 UTSW 11 67334558 missense probably damaging 0.96
R2393:Myh13 UTSW 11 67340358 missense possibly damaging 0.93
R2395:Myh13 UTSW 11 67364922 missense probably benign 0.12
R2884:Myh13 UTSW 11 67337643 missense probably benign 0.27
R3696:Myh13 UTSW 11 67345044 missense possibly damaging 0.55
R3786:Myh13 UTSW 11 67327188 missense probably benign 0.01
R3875:Myh13 UTSW 11 67358194 missense probably benign 0.26
R3918:Myh13 UTSW 11 67329238 missense probably benign 0.00
R4061:Myh13 UTSW 11 67330889 missense possibly damaging 0.71
R4160:Myh13 UTSW 11 67364810 intron probably benign
R4183:Myh13 UTSW 11 67349610 missense possibly damaging 0.88
R4392:Myh13 UTSW 11 67344881 splice site probably null
R4639:Myh13 UTSW 11 67341551 missense possibly damaging 0.91
R4670:Myh13 UTSW 11 67364738 nonsense probably null
R4877:Myh13 UTSW 11 67337651 missense probably damaging 0.99
R5250:Myh13 UTSW 11 67327259 nonsense probably null
R5278:Myh13 UTSW 11 67334564 missense probably benign 0.00
R5371:Myh13 UTSW 11 67344790 splice site probably null
R5479:Myh13 UTSW 11 67348822 missense probably damaging 0.97
R5510:Myh13 UTSW 11 67337723 missense probably benign 0.05
R5690:Myh13 UTSW 11 67329275 missense probably damaging 1.00
R5797:Myh13 UTSW 11 67335002 missense possibly damaging 0.66
R5823:Myh13 UTSW 11 67360468 missense probably damaging 1.00
R5877:Myh13 UTSW 11 67353658 missense possibly damaging 0.78
R6041:Myh13 UTSW 11 67364730 missense probably damaging 1.00
R6175:Myh13 UTSW 11 67354762 missense probably benign 0.00
R6244:Myh13 UTSW 11 67362501 missense probably benign 0.00
R6454:Myh13 UTSW 11 67350365 missense probably benign 0.03
R6617:Myh13 UTSW 11 67361400 missense probably benign 0.00
R6707:Myh13 UTSW 11 67350260 missense probably damaging 1.00
R6747:Myh13 UTSW 11 67350419 missense probably damaging 0.99
R6823:Myh13 UTSW 11 67356158 missense probably benign
R6911:Myh13 UTSW 11 67354927 nonsense probably null
R6997:Myh13 UTSW 11 67327154 nonsense probably null
R7033:Myh13 UTSW 11 67369316 missense possibly damaging 0.92
R7145:Myh13 UTSW 11 67354740 missense probably benign 0.08
R7232:Myh13 UTSW 11 67348846 missense probably damaging 1.00
R7428:Myh13 UTSW 11 67332564 missense probably damaging 1.00
R7448:Myh13 UTSW 11 67364460 critical splice acceptor site probably null
R7474:Myh13 UTSW 11 67327164 missense possibly damaging 0.93
R7474:Myh13 UTSW 11 67367711 missense
R7766:Myh13 UTSW 11 67358329 missense probably benign 0.37
R7809:Myh13 UTSW 11 67350341 missense probably benign 0.14
R7813:Myh13 UTSW 11 67327230 missense probably benign 0.27
R7953:Myh13 UTSW 11 67340380 missense probably damaging 1.00
R8085:Myh13 UTSW 11 67334787 missense probably benign 0.00
R8397:Myh13 UTSW 11 67350287 missense possibly damaging 0.62
R8434:Myh13 UTSW 11 67363185 critical splice acceptor site probably null
R8490:Myh13 UTSW 11 67364525 missense probably damaging 0.98
R8676:Myh13 UTSW 11 67342485 missense probably damaging 1.00
R8681:Myh13 UTSW 11 67352134 missense possibly damaging 0.49
R8777:Myh13 UTSW 11 67361335 missense possibly damaging 0.92
R8777-TAIL:Myh13 UTSW 11 67361335 missense possibly damaging 0.92
Z1176:Myh13 UTSW 11 67329295 missense possibly damaging 0.93
Z1177:Myh13 UTSW 11 67350452 missense possibly damaging 0.55
Z1177:Myh13 UTSW 11 67364591 missense possibly damaging 0.93
Predicted Primers PCR Primer
(F):5'- GGCAACACTCAATTACTTTTGACC -3'
(R):5'- AAGTTGATGCACAGCTGCTC -3'

Sequencing Primer
(F):5'- GACCATCATGATGTCAATTTGATGC -3'
(R):5'- TGCTCCAGGCTGTTGAAC -3'
Posted On2015-12-29