Incidental Mutation 'R4783:Or1r1'
ID 366739
Institutional Source Beutler Lab
Gene Symbol Or1r1
Ensembl Gene ENSMUSG00000049041
Gene Name olfactory receptor family 1 subfamily JRmember 1
Synonyms GA_x6K02T2P1NL-4141430-4140486, Olfr398, MOR157-1
MMRRC Submission 042416-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.154) question?
Stock # R4783 (G1)
Quality Score 183
Status Validated
Chromosome 11
Chromosomal Location 73874488-73875432 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 73874834 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Phenylalanine to Serine at position 200 (F200S)
Ref Sequence ENSEMBL: ENSMUSP00000149170 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000053874] [ENSMUST00000117510] [ENSMUST00000214334]
AlphaFold Q8VFY0
Predicted Effect probably damaging
Transcript: ENSMUST00000053874
AA Change: F200S

PolyPhen 2 Score 0.967 (Sensitivity: 0.77; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000059548
Gene: ENSMUSG00000049041
AA Change: F200S

DomainStartEndE-ValueType
Pfam:7tm_4 31 307 4e-50 PFAM
Pfam:7TM_GPCR_Srsx 35 305 3.5e-5 PFAM
Pfam:7tm_1 41 290 1.3e-17 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000117510
AA Change: F200S

PolyPhen 2 Score 0.967 (Sensitivity: 0.77; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000113005
Gene: ENSMUSG00000049041
AA Change: F200S

DomainStartEndE-ValueType
Pfam:7TM_GPCR_Srsx 35 305 3.5e-5 PFAM
Pfam:7tm_1 41 290 6.4e-28 PFAM
Pfam:7tm_4 140 283 4.7e-35 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000214334
AA Change: F200S

PolyPhen 2 Score 0.967 (Sensitivity: 0.77; Specificity: 0.95)
Meta Mutation Damage Score 0.2548 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 94.6%
Validation Efficiency 100% (99/99)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 95 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
3110082J24Rik G A 5: 30,310,198 (GRCm39) R54* probably null Het
Acsl6 A T 11: 54,227,819 (GRCm39) M350L probably damaging Het
Adgrv1 T C 13: 81,243,564 (GRCm39) T6279A probably damaging Het
Ago3 A T 4: 126,262,296 (GRCm39) M418K probably benign Het
Ascc2 G A 11: 4,596,653 (GRCm39) R58H probably benign Het
Brinp3 A G 1: 146,603,378 (GRCm39) probably benign Het
Carmil3 T C 14: 55,738,778 (GRCm39) probably null Het
Ccdc47 T A 11: 106,094,430 (GRCm39) H7L probably benign Het
Ccndbp1 A T 2: 120,839,003 (GRCm39) T5S probably benign Het
Cdr2 A T 7: 120,557,644 (GRCm39) F294I probably benign Het
Chd8 C A 14: 52,442,825 (GRCm39) C575F probably damaging Het
Ctsll3 G A 13: 60,948,209 (GRCm39) T156I probably damaging Het
Dgcr8 G A 16: 18,076,174 (GRCm39) R4* probably null Het
Dnah1 T A 14: 30,985,436 (GRCm39) K3818N probably damaging Het
Dok2 C T 14: 71,015,314 (GRCm39) P347L probably benign Het
Elf1 T A 14: 79,818,183 (GRCm39) N567K probably benign Het
Emsy T C 7: 98,295,686 (GRCm39) N72S possibly damaging Het
Fam76a A G 4: 132,643,501 (GRCm39) Y78H probably damaging Het
Fam76a A T 4: 132,629,428 (GRCm39) probably null Het
Fbn1 A T 2: 125,166,839 (GRCm39) C2026S probably damaging Het
Fbxo4 T C 15: 3,998,523 (GRCm39) T312A probably benign Het
Fhip1a G T 3: 85,595,877 (GRCm39) T115K probably damaging Het
Flnb A T 14: 7,905,701 (GRCm38) E1150D probably benign Het
Galt T C 4: 41,758,189 (GRCm39) V318A probably damaging Het
Git1 T G 11: 77,390,663 (GRCm39) L133R probably damaging Het
Gm11168 G A 9: 3,006,915 (GRCm39) M213I probably benign Het
Gm7233 A G 14: 43,037,423 (GRCm39) E25G probably benign Het
Golga2 T A 2: 32,187,168 (GRCm39) N89K probably damaging Het
Grin1 T A 2: 25,182,393 (GRCm39) H956L possibly damaging Het
Hlcs C T 16: 94,069,398 (GRCm39) V164I possibly damaging Het
Hmgcr G A 13: 96,802,701 (GRCm39) T66M probably damaging Het
Ifi206 A T 1: 173,308,432 (GRCm39) H521Q probably benign Het
Lgals3bp G A 11: 118,284,340 (GRCm39) T413I probably damaging Het
Lrrc7 A G 3: 157,832,850 (GRCm39) probably null Het
Mapk11 T C 15: 89,033,691 (GRCm39) Y9C probably damaging Het
Mccc1 C A 3: 36,030,022 (GRCm39) M429I probably damaging Het
Metrnl A G 11: 121,598,750 (GRCm39) E40G probably benign Het
Mrgpra1 A G 7: 46,985,218 (GRCm39) S154P probably damaging Het
Myh13 A T 11: 67,232,096 (GRCm39) I459F probably damaging Het
Nalf1 T C 8: 9,258,026 (GRCm39) Y374C probably damaging Het
Nedd4l C A 18: 65,305,998 (GRCm39) D424E probably damaging Het
Nid1 C T 13: 13,674,326 (GRCm39) R902W probably damaging Het
Nphp4 G A 4: 152,639,003 (GRCm39) R878K probably benign Het
Numa1 A G 7: 101,662,773 (GRCm39) T1997A probably damaging Het
Nutm1 G A 2: 112,079,281 (GRCm39) A878V probably benign Het
Nxf1 G A 19: 8,744,162 (GRCm39) A339T probably benign Het
Oas1b C A 5: 120,952,578 (GRCm39) Q90K probably benign Het
Optn T C 2: 5,059,438 (GRCm39) M27V probably benign Het
Or2t35 A C 14: 14,407,729 (GRCm38) Y167S possibly damaging Het
Or4f56 A T 2: 111,703,395 (GRCm39) D268E possibly damaging Het
Or5ac17 G T 16: 59,036,222 (GRCm39) F251L probably damaging Het
Or5d45 A G 2: 88,153,500 (GRCm39) I183T probably damaging Het
Or5g29 A G 2: 85,421,282 (GRCm39) T133A probably benign Het
Or5h18 G T 16: 58,848,260 (GRCm39) D3E probably benign Het
Oxgr1 T C 14: 120,259,776 (GRCm39) I144V probably benign Het
Pax5 T A 4: 44,570,086 (GRCm39) T127S probably damaging Het
Pcsk2 T C 2: 143,529,599 (GRCm39) probably null Het
Pdxk A G 10: 78,300,626 (GRCm39) V19A possibly damaging Het
Pik3c2a A T 7: 116,017,060 (GRCm39) S232R probably damaging Het
Ppip5k1 T C 2: 121,171,329 (GRCm39) D620G possibly damaging Het
Ppp4r4 T A 12: 103,557,117 (GRCm39) probably null Het
Psmd1 A G 1: 86,006,434 (GRCm39) N267D probably damaging Het
Pudp A G 18: 50,701,136 (GRCm39) V199A probably damaging Het
Rasal3 T A 17: 32,615,755 (GRCm39) D361V probably damaging Het
Rbm12 T C 2: 155,938,484 (GRCm39) D596G possibly damaging Het
Rbm6 T C 9: 107,730,102 (GRCm39) D182G probably damaging Het
Rif1 T C 2: 52,002,759 (GRCm39) V2071A probably damaging Het
Rilp C T 11: 75,401,467 (GRCm39) A110V possibly damaging Het
Rprd2 A G 3: 95,681,645 (GRCm39) V332A probably benign Het
Sbpl T A 17: 24,172,304 (GRCm39) D205V unknown Het
Scn9a T C 2: 66,370,967 (GRCm39) I538V probably benign Het
Serpina1d T C 12: 103,734,083 (GRCm39) S74G possibly damaging Het
Serpina3n T C 12: 104,375,369 (GRCm39) I147T possibly damaging Het
Serpinb8 A G 1: 107,532,472 (GRCm39) N188S probably benign Het
Sipa1l3 A G 7: 29,077,066 (GRCm39) V902A probably damaging Het
Slc25a47 T A 12: 108,821,260 (GRCm39) L123Q probably damaging Het
Slc30a2 A T 4: 134,071,317 (GRCm39) probably null Het
Slc66a1 G T 4: 139,027,312 (GRCm39) H343Q probably benign Het
Snx13 T A 12: 35,148,285 (GRCm39) D271E probably damaging Het
Tbc1d9b A G 11: 50,062,125 (GRCm39) N1211S probably benign Het
Tdrd3 T A 14: 87,709,537 (GRCm39) I67N probably damaging Het
Thbs1 T C 2: 117,945,273 (GRCm39) V282A probably benign Het
Tmc8 A G 11: 117,682,431 (GRCm39) probably null Het
Trim11 T A 11: 58,879,750 (GRCm39) F284Y probably null Het
Ttn G T 2: 76,552,141 (GRCm39) Y29419* probably null Het
Ttn A G 2: 76,599,947 (GRCm39) Y19076H probably damaging Het
Ubr4 T C 4: 139,149,044 (GRCm39) S448P possibly damaging Het
Ugt2b34 T C 5: 87,039,332 (GRCm39) E443G probably damaging Het
Usp29 A G 7: 6,964,390 (GRCm39) T78A probably damaging Het
Vmn1r227 A G 17: 20,955,396 (GRCm39) noncoding transcript Het
Vmn1r85 A T 7: 12,818,788 (GRCm39) W119R probably damaging Het
Vmn2r12 A T 5: 109,234,379 (GRCm39) V611E probably damaging Het
Vmn2r97 A T 17: 19,149,550 (GRCm39) M313L probably benign Het
Zap70 T C 1: 36,818,254 (GRCm39) Y314H probably damaging Het
Zfp667 T A 7: 6,308,684 (GRCm39) F451I possibly damaging Het
Other mutations in Or1r1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01084:Or1r1 APN 11 73,875,353 (GRCm39) missense probably damaging 1.00
IGL01116:Or1r1 APN 11 73,875,144 (GRCm39) missense probably damaging 1.00
R0242:Or1r1 UTSW 11 73,874,538 (GRCm39) missense probably benign
R0242:Or1r1 UTSW 11 73,874,538 (GRCm39) missense probably benign
R0647:Or1r1 UTSW 11 73,874,597 (GRCm39) missense probably damaging 0.99
R0906:Or1r1 UTSW 11 73,874,685 (GRCm39) missense probably damaging 0.99
R1581:Or1r1 UTSW 11 73,875,347 (GRCm39) missense probably damaging 1.00
R1792:Or1r1 UTSW 11 73,874,673 (GRCm39) missense probably benign 0.34
R1832:Or1r1 UTSW 11 73,875,319 (GRCm39) missense probably damaging 0.98
R1879:Or1r1 UTSW 11 73,875,368 (GRCm39) missense probably benign 0.00
R2138:Or1r1 UTSW 11 73,875,129 (GRCm39) missense probably damaging 1.00
R2988:Or1r1 UTSW 11 73,874,627 (GRCm39) missense probably benign 0.13
R4557:Or1r1 UTSW 11 73,875,425 (GRCm39) missense probably benign 0.25
R4606:Or1r1 UTSW 11 73,874,718 (GRCm39) missense probably damaging 1.00
R4777:Or1r1 UTSW 11 73,875,221 (GRCm39) missense probably benign 0.01
R5047:Or1r1 UTSW 11 73,875,204 (GRCm39) missense probably damaging 1.00
R5696:Or1r1 UTSW 11 73,875,362 (GRCm39) missense possibly damaging 0.90
R6379:Or1r1 UTSW 11 73,875,099 (GRCm39) missense probably damaging 1.00
R7166:Or1r1 UTSW 11 73,875,121 (GRCm39) missense possibly damaging 0.81
R7254:Or1r1 UTSW 11 73,874,603 (GRCm39) missense probably benign 0.40
R7324:Or1r1 UTSW 11 73,874,669 (GRCm39) missense probably benign 0.06
R7444:Or1r1 UTSW 11 73,874,576 (GRCm39) missense probably damaging 1.00
R7831:Or1r1 UTSW 11 73,875,257 (GRCm39) missense probably damaging 1.00
R8540:Or1r1 UTSW 11 73,875,153 (GRCm39) missense probably damaging 1.00
X0012:Or1r1 UTSW 11 73,875,120 (GRCm39) missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- CGGTCATAACGAGCTGAGTAG -3'
(R):5'- ATGGTGCAGTCATGACACCC -3'

Sequencing Primer
(F):5'- TCATAACGAGCTGAGTAGGCAGATG -3'
(R):5'- AGTCATGACACCCTGGCG -3'
Posted On 2015-12-29