Incidental Mutation 'R4783:Olfr398'
ID 366739
Institutional Source Beutler Lab
Gene Symbol Olfr398
Ensembl Gene ENSMUSG00000049041
Gene Name olfactory receptor 398
Synonyms GA_x6K02T2P1NL-4141430-4140486, MOR157-1
MMRRC Submission 042416-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.158) question?
Stock # R4783 (G1)
Quality Score 183
Status Validated
Chromosome 11
Chromosomal Location 73979967-73990407 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to G at 73984008 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Phenylalanine to Serine at position 200 (F200S)
Ref Sequence ENSEMBL: ENSMUSP00000149170 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000053874] [ENSMUST00000117510] [ENSMUST00000214334]
AlphaFold Q8VFY0
Predicted Effect probably damaging
Transcript: ENSMUST00000053874
AA Change: F200S

PolyPhen 2 Score 0.967 (Sensitivity: 0.77; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000059548
Gene: ENSMUSG00000049041
AA Change: F200S

DomainStartEndE-ValueType
Pfam:7tm_4 31 307 4e-50 PFAM
Pfam:7TM_GPCR_Srsx 35 305 3.5e-5 PFAM
Pfam:7tm_1 41 290 1.3e-17 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000117510
AA Change: F200S

PolyPhen 2 Score 0.967 (Sensitivity: 0.77; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000113005
Gene: ENSMUSG00000049041
AA Change: F200S

DomainStartEndE-ValueType
Pfam:7TM_GPCR_Srsx 35 305 3.5e-5 PFAM
Pfam:7tm_1 41 290 6.4e-28 PFAM
Pfam:7tm_4 140 283 4.7e-35 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000214334
AA Change: F200S

PolyPhen 2 Score 0.967 (Sensitivity: 0.77; Specificity: 0.95)
Meta Mutation Damage Score 0.2548 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 94.6%
Validation Efficiency 100% (99/99)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 95 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
3110082J24Rik G A 5: 30,105,200 R54* probably null Het
Acsl6 A T 11: 54,336,993 M350L probably damaging Het
Adgrv1 T C 13: 81,095,445 T6279A probably damaging Het
Ago3 A T 4: 126,368,503 M418K probably benign Het
Ascc2 G A 11: 4,646,653 R58H probably benign Het
Brinp3 A G 1: 146,727,640 probably benign Het
Carmil3 T C 14: 55,501,321 probably null Het
Ccdc47 T A 11: 106,203,604 H7L probably benign Het
Ccndbp1 A T 2: 121,008,522 T5S probably benign Het
Cdr2 A T 7: 120,958,421 F294I probably benign Het
Chd8 C A 14: 52,205,368 C575F probably damaging Het
Ctsll3 G A 13: 60,800,395 T156I probably damaging Het
Dgcr8 G A 16: 18,258,310 R4* probably null Het
Dnah1 T A 14: 31,263,479 K3818N probably damaging Het
Dok2 C T 14: 70,777,874 P347L probably benign Het
Elf1 T A 14: 79,580,743 N567K probably benign Het
Emsy T C 7: 98,646,479 N72S possibly damaging Het
Fam155a T C 8: 9,208,026 Y374C probably damaging Het
Fam160a1 G T 3: 85,688,570 T115K probably damaging Het
Fam76a A T 4: 132,902,117 probably null Het
Fam76a A G 4: 132,916,190 Y78H probably damaging Het
Fbn1 A T 2: 125,324,919 C2026S probably damaging Het
Fbxo4 T C 15: 3,969,041 T312A probably benign Het
Flnb A T 14: 7,905,701 E1150D probably benign Het
Galt T C 4: 41,758,189 V318A probably damaging Het
Git1 T G 11: 77,499,837 L133R probably damaging Het
Gm11168 G A 9: 3,006,915 M213I probably benign Het
Gm7233 A G 14: 43,179,966 E25G probably benign Het
Golga2 T A 2: 32,297,156 N89K probably damaging Het
Grin1 T A 2: 25,292,381 H956L possibly damaging Het
Hlcs C T 16: 94,268,539 V164I possibly damaging Het
Hmgcr G A 13: 96,666,193 T66M probably damaging Het
Ifi206 A T 1: 173,480,866 H521Q probably benign Het
Lgals3bp G A 11: 118,393,514 T413I probably damaging Het
Lrrc7 A G 3: 158,127,213 probably null Het
Mapk11 T C 15: 89,149,488 Y9C probably damaging Het
Mccc1 C A 3: 35,975,873 M429I probably damaging Het
Metrnl A G 11: 121,707,924 E40G probably benign Het
Mrgpra1 A G 7: 47,335,470 S154P probably damaging Het
Myh13 A T 11: 67,341,270 I459F probably damaging Het
Nedd4l C A 18: 65,172,927 D424E probably damaging Het
Nid1 C T 13: 13,499,741 R902W probably damaging Het
Nphp4 G A 4: 152,554,546 R878K probably benign Het
Numa1 A G 7: 102,013,566 T1997A probably damaging Het
Nutm1 G A 2: 112,248,936 A878V probably benign Het
Nxf1 G A 19: 8,766,798 A339T probably benign Het
Oas1b C A 5: 120,814,513 Q90K probably benign Het
Olfr1175-ps A G 2: 88,323,156 I183T probably damaging Het
Olfr1305 A T 2: 111,873,050 D268E possibly damaging Het
Olfr186 G T 16: 59,027,897 D3E probably benign Het
Olfr199 G T 16: 59,215,859 F251L probably damaging Het
Olfr721-ps1 A C 14: 14,407,729 Y167S possibly damaging Het
Olfr998 A G 2: 85,590,938 T133A probably benign Het
Optn T C 2: 5,054,627 M27V probably benign Het
Oxgr1 T C 14: 120,022,364 I144V probably benign Het
Pax5 T A 4: 44,570,086 T127S probably damaging Het
Pcsk2 T C 2: 143,687,679 probably null Het
Pdxk A G 10: 78,464,792 V19A possibly damaging Het
Pik3c2a A T 7: 116,417,825 S232R probably damaging Het
Ppip5k1 T C 2: 121,340,848 D620G possibly damaging Het
Ppp4r4 T A 12: 103,590,858 probably null Het
Pqlc2 G T 4: 139,300,001 H343Q probably benign Het
Psmd1 A G 1: 86,078,712 N267D probably damaging Het
Pudp A G 18: 50,568,065 V199A probably damaging Het
Rasal3 T A 17: 32,396,781 D361V probably damaging Het
Rbm12 T C 2: 156,096,564 D596G possibly damaging Het
Rbm6 T C 9: 107,852,903 D182G probably damaging Het
Rif1 T C 2: 52,112,747 V2071A probably damaging Het
Rilp C T 11: 75,510,641 A110V possibly damaging Het
Rprd2 A G 3: 95,774,333 V332A probably benign Het
Sbpl T A 17: 23,953,330 D205V unknown Het
Scn9a T C 2: 66,540,623 I538V probably benign Het
Serpina1d T C 12: 103,767,824 S74G possibly damaging Het
Serpina3n T C 12: 104,409,110 I147T possibly damaging Het
Serpinb8 A G 1: 107,604,742 N188S probably benign Het
Sipa1l3 A G 7: 29,377,641 V902A probably damaging Het
Slc25a47 T A 12: 108,855,334 L123Q probably damaging Het
Slc30a2 A T 4: 134,344,006 probably null Het
Snx13 T A 12: 35,098,286 D271E probably damaging Het
Tbc1d9b A G 11: 50,171,298 N1211S probably benign Het
Tdrd3 T A 14: 87,472,101 I67N probably damaging Het
Thbs1 T C 2: 118,114,792 V282A probably benign Het
Tmc8 A G 11: 117,791,605 probably null Het
Trim11 T A 11: 58,988,924 F284Y probably null Het
Ttn G T 2: 76,721,797 Y29419* probably null Het
Ttn A G 2: 76,769,603 Y19076H probably damaging Het
Ubr4 T C 4: 139,421,733 S448P possibly damaging Het
Ugt2b34 T C 5: 86,891,473 E443G probably damaging Het
Usp29 A G 7: 6,961,391 T78A probably damaging Het
Vmn1r227 A G 17: 20,735,134 noncoding transcript Het
Vmn1r85 A T 7: 13,084,861 W119R probably damaging Het
Vmn2r12 A T 5: 109,086,513 V611E probably damaging Het
Vmn2r97 A T 17: 18,929,288 M313L probably benign Het
Zap70 T C 1: 36,779,173 Y314H probably damaging Het
Zfp667 T A 7: 6,305,685 F451I possibly damaging Het
Other mutations in Olfr398
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01084:Olfr398 APN 11 73984527 missense probably damaging 1.00
IGL01116:Olfr398 APN 11 73984318 missense probably damaging 1.00
R0242:Olfr398 UTSW 11 73983712 missense probably benign
R0242:Olfr398 UTSW 11 73983712 missense probably benign
R0647:Olfr398 UTSW 11 73983771 missense probably damaging 0.99
R0906:Olfr398 UTSW 11 73983859 missense probably damaging 0.99
R1581:Olfr398 UTSW 11 73984521 missense probably damaging 1.00
R1792:Olfr398 UTSW 11 73983847 missense probably benign 0.34
R1832:Olfr398 UTSW 11 73984493 missense probably damaging 0.98
R1879:Olfr398 UTSW 11 73984542 missense probably benign 0.00
R2138:Olfr398 UTSW 11 73984303 missense probably damaging 1.00
R2988:Olfr398 UTSW 11 73983801 missense probably benign 0.13
R4557:Olfr398 UTSW 11 73984599 missense probably benign 0.25
R4606:Olfr398 UTSW 11 73983892 missense probably damaging 1.00
R4777:Olfr398 UTSW 11 73984395 missense probably benign 0.01
R5047:Olfr398 UTSW 11 73984378 missense probably damaging 1.00
R5696:Olfr398 UTSW 11 73984536 missense possibly damaging 0.90
R6379:Olfr398 UTSW 11 73984273 missense probably damaging 1.00
R7166:Olfr398 UTSW 11 73984295 missense possibly damaging 0.81
R7254:Olfr398 UTSW 11 73983777 missense probably benign 0.40
R7324:Olfr398 UTSW 11 73983843 missense probably benign 0.06
R7444:Olfr398 UTSW 11 73983750 missense probably damaging 1.00
R7831:Olfr398 UTSW 11 73984431 missense probably damaging 1.00
R8540:Olfr398 UTSW 11 73984327 missense probably damaging 1.00
X0012:Olfr398 UTSW 11 73984294 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- CGGTCATAACGAGCTGAGTAG -3'
(R):5'- ATGGTGCAGTCATGACACCC -3'

Sequencing Primer
(F):5'- TCATAACGAGCTGAGTAGGCAGATG -3'
(R):5'- AGTCATGACACCCTGGCG -3'
Posted On 2015-12-29