Incidental Mutation 'R4783:Flnb'
ID 366755
Institutional Source Beutler Lab
Gene Symbol Flnb
Ensembl Gene ENSMUSG00000025278
Gene Name filamin, beta
Synonyms
MMRRC Submission 042416-MU
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R4783 (G1)
Quality Score 225
Status Validated
Chromosome 14
Chromosomal Location 14518185-14651816 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to T at 7905701 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Glutamic Acid to Aspartic acid at position 1150 (E1150D)
Ref Sequence ENSEMBL: ENSMUSP00000052020 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000052678]
AlphaFold Q80X90
Predicted Effect probably benign
Transcript: ENSMUST00000052678
AA Change: E1150D

PolyPhen 2 Score 0.123 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000052020
Gene: ENSMUSG00000025278
AA Change: E1150D

DomainStartEndE-ValueType
CH 18 120 2.38e-26 SMART
CH 141 237 1.83e-18 SMART
IG_FLMN 253 350 1.17e-33 SMART
IG_FLMN 353 449 2.08e-34 SMART
IG_FLMN 451 546 3.42e-35 SMART
IG_FLMN 548 639 6.06e-27 SMART
IG_FLMN 644 739 1.94e-34 SMART
IG_FLMN 741 842 4.25e-31 SMART
IG_FLMN 844 941 5.16e-30 SMART
IG_FLMN 943 1037 5.12e-25 SMART
IG_FLMN 1039 1130 5.31e-41 SMART
IG_FLMN 1132 1225 1.4e-31 SMART
IG_FLMN 1227 1325 1.42e-32 SMART
IG_FLMN 1327 1418 5.19e-35 SMART
IG_FLMN 1420 1514 2.48e-41 SMART
IG_FLMN 1516 1611 3.15e-34 SMART
IG_FLMN 1613 1707 4.99e-37 SMART
IG_FLMN 1730 1819 4.44e-11 SMART
IG_FLMN 1820 1911 5.82e-38 SMART
IG_FLMN 1914 1997 5.68e-9 SMART
IG_FLMN 2001 2092 4.45e-34 SMART
IG_FLMN 2101 2188 1.24e-9 SMART
IG_FLMN 2192 2283 4.48e-39 SMART
IG_FLMN 2286 2378 2.94e-25 SMART
IG_FLMN 2383 2474 5.66e-27 SMART
IG_FLMN 2511 2602 1.63e-27 SMART
Meta Mutation Damage Score 0.1423 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 94.6%
Validation Efficiency 100% (99/99)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the filamin family. The encoded protein interacts with glycoprotein Ib alpha as part of the process to repair vascular injuries. The platelet glycoprotein Ib complex includes glycoprotein Ib alpha, and it binds the actin cytoskeleton. Mutations in this gene have been found in several conditions: atelosteogenesis type 1 and type 3; boomerang dysplasia; autosomal dominant Larsen syndrome; and spondylocarpotarsal synostosis syndrome. Multiple alternatively spliced transcript variants that encode different protein isoforms have been described for this gene. [provided by RefSeq, Nov 2009]
PHENOTYPE: Mutations in this gene cause skeletal defects including runting, premature mineralization, and bone fusion. Nullizygous mice show a delay and reduction in long bone growth. Truncation mutations cause early fusion of spinal vertebrae due to enhanced chondrocyte hypertrophy and early differentiation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 95 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
3110082J24Rik G A 5: 30,310,198 (GRCm39) R54* probably null Het
Acsl6 A T 11: 54,227,819 (GRCm39) M350L probably damaging Het
Adgrv1 T C 13: 81,243,564 (GRCm39) T6279A probably damaging Het
Ago3 A T 4: 126,262,296 (GRCm39) M418K probably benign Het
Ascc2 G A 11: 4,596,653 (GRCm39) R58H probably benign Het
Brinp3 A G 1: 146,603,378 (GRCm39) probably benign Het
Carmil3 T C 14: 55,738,778 (GRCm39) probably null Het
Ccdc47 T A 11: 106,094,430 (GRCm39) H7L probably benign Het
Ccndbp1 A T 2: 120,839,003 (GRCm39) T5S probably benign Het
Cdr2 A T 7: 120,557,644 (GRCm39) F294I probably benign Het
Chd8 C A 14: 52,442,825 (GRCm39) C575F probably damaging Het
Ctsll3 G A 13: 60,948,209 (GRCm39) T156I probably damaging Het
Dgcr8 G A 16: 18,076,174 (GRCm39) R4* probably null Het
Dnah1 T A 14: 30,985,436 (GRCm39) K3818N probably damaging Het
Dok2 C T 14: 71,015,314 (GRCm39) P347L probably benign Het
Elf1 T A 14: 79,818,183 (GRCm39) N567K probably benign Het
Emsy T C 7: 98,295,686 (GRCm39) N72S possibly damaging Het
Fam76a A G 4: 132,643,501 (GRCm39) Y78H probably damaging Het
Fam76a A T 4: 132,629,428 (GRCm39) probably null Het
Fbn1 A T 2: 125,166,839 (GRCm39) C2026S probably damaging Het
Fbxo4 T C 15: 3,998,523 (GRCm39) T312A probably benign Het
Fhip1a G T 3: 85,595,877 (GRCm39) T115K probably damaging Het
Galt T C 4: 41,758,189 (GRCm39) V318A probably damaging Het
Git1 T G 11: 77,390,663 (GRCm39) L133R probably damaging Het
Gm11168 G A 9: 3,006,915 (GRCm39) M213I probably benign Het
Gm7233 A G 14: 43,037,423 (GRCm39) E25G probably benign Het
Golga2 T A 2: 32,187,168 (GRCm39) N89K probably damaging Het
Grin1 T A 2: 25,182,393 (GRCm39) H956L possibly damaging Het
Hlcs C T 16: 94,069,398 (GRCm39) V164I possibly damaging Het
Hmgcr G A 13: 96,802,701 (GRCm39) T66M probably damaging Het
Ifi206 A T 1: 173,308,432 (GRCm39) H521Q probably benign Het
Lgals3bp G A 11: 118,284,340 (GRCm39) T413I probably damaging Het
Lrrc7 A G 3: 157,832,850 (GRCm39) probably null Het
Mapk11 T C 15: 89,033,691 (GRCm39) Y9C probably damaging Het
Mccc1 C A 3: 36,030,022 (GRCm39) M429I probably damaging Het
Metrnl A G 11: 121,598,750 (GRCm39) E40G probably benign Het
Mrgpra1 A G 7: 46,985,218 (GRCm39) S154P probably damaging Het
Myh13 A T 11: 67,232,096 (GRCm39) I459F probably damaging Het
Nalf1 T C 8: 9,258,026 (GRCm39) Y374C probably damaging Het
Nedd4l C A 18: 65,305,998 (GRCm39) D424E probably damaging Het
Nid1 C T 13: 13,674,326 (GRCm39) R902W probably damaging Het
Nphp4 G A 4: 152,639,003 (GRCm39) R878K probably benign Het
Numa1 A G 7: 101,662,773 (GRCm39) T1997A probably damaging Het
Nutm1 G A 2: 112,079,281 (GRCm39) A878V probably benign Het
Nxf1 G A 19: 8,744,162 (GRCm39) A339T probably benign Het
Oas1b C A 5: 120,952,578 (GRCm39) Q90K probably benign Het
Optn T C 2: 5,059,438 (GRCm39) M27V probably benign Het
Or1r1 A G 11: 73,874,834 (GRCm39) F200S probably damaging Het
Or2t35 A C 14: 14,407,729 (GRCm38) Y167S possibly damaging Het
Or4f56 A T 2: 111,703,395 (GRCm39) D268E possibly damaging Het
Or5ac17 G T 16: 59,036,222 (GRCm39) F251L probably damaging Het
Or5d45 A G 2: 88,153,500 (GRCm39) I183T probably damaging Het
Or5g29 A G 2: 85,421,282 (GRCm39) T133A probably benign Het
Or5h18 G T 16: 58,848,260 (GRCm39) D3E probably benign Het
Oxgr1 T C 14: 120,259,776 (GRCm39) I144V probably benign Het
Pax5 T A 4: 44,570,086 (GRCm39) T127S probably damaging Het
Pcsk2 T C 2: 143,529,599 (GRCm39) probably null Het
Pdxk A G 10: 78,300,626 (GRCm39) V19A possibly damaging Het
Pik3c2a A T 7: 116,017,060 (GRCm39) S232R probably damaging Het
Ppip5k1 T C 2: 121,171,329 (GRCm39) D620G possibly damaging Het
Ppp4r4 T A 12: 103,557,117 (GRCm39) probably null Het
Psmd1 A G 1: 86,006,434 (GRCm39) N267D probably damaging Het
Pudp A G 18: 50,701,136 (GRCm39) V199A probably damaging Het
Rasal3 T A 17: 32,615,755 (GRCm39) D361V probably damaging Het
Rbm12 T C 2: 155,938,484 (GRCm39) D596G possibly damaging Het
Rbm6 T C 9: 107,730,102 (GRCm39) D182G probably damaging Het
Rif1 T C 2: 52,002,759 (GRCm39) V2071A probably damaging Het
Rilp C T 11: 75,401,467 (GRCm39) A110V possibly damaging Het
Rprd2 A G 3: 95,681,645 (GRCm39) V332A probably benign Het
Sbpl T A 17: 24,172,304 (GRCm39) D205V unknown Het
Scn9a T C 2: 66,370,967 (GRCm39) I538V probably benign Het
Serpina1d T C 12: 103,734,083 (GRCm39) S74G possibly damaging Het
Serpina3n T C 12: 104,375,369 (GRCm39) I147T possibly damaging Het
Serpinb8 A G 1: 107,532,472 (GRCm39) N188S probably benign Het
Sipa1l3 A G 7: 29,077,066 (GRCm39) V902A probably damaging Het
Slc25a47 T A 12: 108,821,260 (GRCm39) L123Q probably damaging Het
Slc30a2 A T 4: 134,071,317 (GRCm39) probably null Het
Slc66a1 G T 4: 139,027,312 (GRCm39) H343Q probably benign Het
Snx13 T A 12: 35,148,285 (GRCm39) D271E probably damaging Het
Tbc1d9b A G 11: 50,062,125 (GRCm39) N1211S probably benign Het
Tdrd3 T A 14: 87,709,537 (GRCm39) I67N probably damaging Het
Thbs1 T C 2: 117,945,273 (GRCm39) V282A probably benign Het
Tmc8 A G 11: 117,682,431 (GRCm39) probably null Het
Trim11 T A 11: 58,879,750 (GRCm39) F284Y probably null Het
Ttn G T 2: 76,552,141 (GRCm39) Y29419* probably null Het
Ttn A G 2: 76,599,947 (GRCm39) Y19076H probably damaging Het
Ubr4 T C 4: 139,149,044 (GRCm39) S448P possibly damaging Het
Ugt2b34 T C 5: 87,039,332 (GRCm39) E443G probably damaging Het
Usp29 A G 7: 6,964,390 (GRCm39) T78A probably damaging Het
Vmn1r227 A G 17: 20,955,396 (GRCm39) noncoding transcript Het
Vmn1r85 A T 7: 12,818,788 (GRCm39) W119R probably damaging Het
Vmn2r12 A T 5: 109,234,379 (GRCm39) V611E probably damaging Het
Vmn2r97 A T 17: 19,149,550 (GRCm39) M313L probably benign Het
Zap70 T C 1: 36,818,254 (GRCm39) Y314H probably damaging Het
Zfp667 T A 7: 6,308,684 (GRCm39) F451I possibly damaging Het
Other mutations in Flnb
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01017:Flnb APN 14 7,917,390 (GRCm38) splice site probably benign
IGL01063:Flnb APN 14 7,926,518 (GRCm38) splice site probably benign
IGL01135:Flnb APN 14 7,909,736 (GRCm38) missense probably benign
IGL01139:Flnb APN 14 7,945,989 (GRCm38) missense probably damaging 1.00
IGL01364:Flnb APN 14 7,934,562 (GRCm38) critical splice acceptor site probably null
IGL01417:Flnb APN 14 7,905,513 (GRCm38) missense probably damaging 0.99
IGL01505:Flnb APN 14 7,902,003 (GRCm38) critical splice donor site probably null
IGL01560:Flnb APN 14 7,893,829 (GRCm38) missense probably benign 0.07
IGL01621:Flnb APN 14 7,950,470 (GRCm38) missense probably damaging 1.00
IGL01656:Flnb APN 14 7,902,010 (GRCm38) splice site probably benign
IGL01889:Flnb APN 14 7,935,967 (GRCm38) missense possibly damaging 0.85
IGL01987:Flnb APN 14 7,922,748 (GRCm38) critical splice donor site probably null
IGL02322:Flnb APN 14 7,894,676 (GRCm38) missense probably damaging 1.00
IGL02496:Flnb APN 14 7,930,919 (GRCm38) splice site probably benign
IGL02752:Flnb APN 14 7,917,338 (GRCm38) missense probably benign
IGL03001:Flnb APN 14 7,934,680 (GRCm38) missense probably damaging 0.99
IGL03076:Flnb APN 14 7,901,988 (GRCm38) missense probably benign 0.01
IGL03085:Flnb APN 14 7,882,211 (GRCm38) missense probably benign
IGL03170:Flnb APN 14 7,818,261 (GRCm38) missense possibly damaging 0.90
IGL03373:Flnb APN 14 7,890,867 (GRCm38) critical splice donor site probably null
Boomerang UTSW 14 7,901,945 (GRCm38) missense probably damaging 1.00
Queensland UTSW 14 7,927,352 (GRCm38) missense probably damaging 1.00
R3437_Flnb_252 UTSW 14 7,942,057 (GRCm38) missense probably damaging 0.97
R8441_Flnb_221 UTSW 14 7,896,488 (GRCm38) missense probably benign 0.15
Rhodelinda UTSW 14 7,887,682 (GRCm38) splice site probably benign
saul UTSW 14 7,889,183 (GRCm38) missense probably damaging 0.99
Xerxes UTSW 14 7,867,551 (GRCm38) missense probably damaging 1.00
R0068:Flnb UTSW 14 7,915,290 (GRCm38) missense possibly damaging 0.49
R0068:Flnb UTSW 14 7,915,290 (GRCm38) missense possibly damaging 0.49
R0084:Flnb UTSW 14 7,935,979 (GRCm38) missense probably benign
R0128:Flnb UTSW 14 7,901,951 (GRCm38) missense probably damaging 0.99
R0130:Flnb UTSW 14 7,901,951 (GRCm38) missense probably damaging 0.99
R0148:Flnb UTSW 14 7,939,077 (GRCm38) missense probably benign 0.01
R0166:Flnb UTSW 14 7,896,115 (GRCm38) missense probably damaging 1.00
R0376:Flnb UTSW 14 7,946,014 (GRCm38) critical splice donor site probably null
R0547:Flnb UTSW 14 7,912,943 (GRCm38) splice site probably null
R0612:Flnb UTSW 14 7,887,682 (GRCm38) splice site probably benign
R0656:Flnb UTSW 14 7,927,352 (GRCm38) missense probably damaging 1.00
R0691:Flnb UTSW 14 7,890,810 (GRCm38) missense probably benign 0.16
R1241:Flnb UTSW 14 7,896,503 (GRCm38) missense probably benign 0.06
R1572:Flnb UTSW 14 7,883,908 (GRCm38) missense probably damaging 0.97
R1682:Flnb UTSW 14 7,913,121 (GRCm38) missense probably benign 0.04
R1807:Flnb UTSW 14 7,934,645 (GRCm38) missense probably benign 0.26
R1848:Flnb UTSW 14 7,892,113 (GRCm38) missense probably damaging 1.00
R1959:Flnb UTSW 14 7,884,735 (GRCm38) nonsense probably null
R2078:Flnb UTSW 14 7,927,466 (GRCm38) missense probably damaging 1.00
R2132:Flnb UTSW 14 7,873,376 (GRCm38) missense probably benign 0.04
R2209:Flnb UTSW 14 7,905,507 (GRCm38) nonsense probably null
R2212:Flnb UTSW 14 7,881,652 (GRCm38) small deletion probably benign
R2213:Flnb UTSW 14 7,881,652 (GRCm38) small deletion probably benign
R2363:Flnb UTSW 14 7,945,950 (GRCm38) missense possibly damaging 0.95
R2415:Flnb UTSW 14 7,929,932 (GRCm38) missense probably benign 0.07
R2983:Flnb UTSW 14 7,882,250 (GRCm38) missense probably damaging 1.00
R3001:Flnb UTSW 14 7,907,162 (GRCm38) missense probably benign 0.22
R3002:Flnb UTSW 14 7,907,162 (GRCm38) missense probably benign 0.22
R3436:Flnb UTSW 14 7,942,057 (GRCm38) missense probably damaging 0.97
R3437:Flnb UTSW 14 7,942,057 (GRCm38) missense probably damaging 0.97
R3778:Flnb UTSW 14 7,915,353 (GRCm38) missense probably benign 0.06
R3783:Flnb UTSW 14 7,889,236 (GRCm38) missense probably benign 0.04
R4162:Flnb UTSW 14 7,915,374 (GRCm38) missense possibly damaging 0.81
R4163:Flnb UTSW 14 7,915,374 (GRCm38) missense possibly damaging 0.81
R4164:Flnb UTSW 14 7,915,374 (GRCm38) missense possibly damaging 0.81
R4356:Flnb UTSW 14 7,922,700 (GRCm38) missense probably benign
R4369:Flnb UTSW 14 7,942,216 (GRCm38) missense probably benign
R4785:Flnb UTSW 14 7,905,701 (GRCm38) missense probably benign 0.12
R4790:Flnb UTSW 14 7,905,661 (GRCm38) missense probably benign 0.34
R4828:Flnb UTSW 14 7,919,238 (GRCm38) missense probably benign 0.13
R4882:Flnb UTSW 14 7,929,936 (GRCm38) missense possibly damaging 0.56
R5002:Flnb UTSW 14 7,945,882 (GRCm38) missense probably damaging 1.00
R5058:Flnb UTSW 14 7,924,262 (GRCm38) nonsense probably null
R5184:Flnb UTSW 14 7,901,945 (GRCm38) missense probably damaging 1.00
R5186:Flnb UTSW 14 7,909,748 (GRCm38) missense probably damaging 1.00
R5395:Flnb UTSW 14 7,883,881 (GRCm38) missense probably benign 0.02
R5421:Flnb UTSW 14 7,926,494 (GRCm38) missense probably damaging 1.00
R5667:Flnb UTSW 14 7,890,843 (GRCm38) missense probably benign 0.00
R5671:Flnb UTSW 14 7,890,843 (GRCm38) missense probably benign 0.00
R5714:Flnb UTSW 14 7,929,073 (GRCm38) missense probably damaging 1.00
R5860:Flnb UTSW 14 7,931,135 (GRCm38) missense probably damaging 1.00
R5892:Flnb UTSW 14 7,907,183 (GRCm38) missense probably damaging 1.00
R5924:Flnb UTSW 14 7,890,765 (GRCm38) missense probably benign 0.00
R6131:Flnb UTSW 14 7,894,635 (GRCm38) missense possibly damaging 0.79
R6244:Flnb UTSW 14 7,892,092 (GRCm38) missense probably damaging 1.00
R6489:Flnb UTSW 14 7,867,551 (GRCm38) missense probably damaging 1.00
R6582:Flnb UTSW 14 7,892,275 (GRCm38) critical splice donor site probably null
R6586:Flnb UTSW 14 7,929,138 (GRCm38) missense possibly damaging 0.93
R6611:Flnb UTSW 14 7,915,318 (GRCm38) missense probably damaging 1.00
R6626:Flnb UTSW 14 7,929,012 (GRCm38) missense probably damaging 1.00
R6700:Flnb UTSW 14 7,892,189 (GRCm38) missense probably damaging 0.99
R6738:Flnb UTSW 14 7,904,536 (GRCm38) missense probably benign 0.01
R6864:Flnb UTSW 14 7,905,640 (GRCm38) missense possibly damaging 0.84
R6916:Flnb UTSW 14 7,907,171 (GRCm38) missense probably damaging 0.99
R7117:Flnb UTSW 14 7,894,214 (GRCm38) missense probably benign 0.02
R7164:Flnb UTSW 14 7,915,944 (GRCm38) splice site probably null
R7328:Flnb UTSW 14 7,894,660 (GRCm38) nonsense probably null
R7328:Flnb UTSW 14 7,883,788 (GRCm38) missense possibly damaging 0.95
R7687:Flnb UTSW 14 7,924,224 (GRCm38) missense probably damaging 1.00
R7716:Flnb UTSW 14 7,917,274 (GRCm38) missense possibly damaging 0.64
R7763:Flnb UTSW 14 7,926,478 (GRCm38) missense probably benign 0.00
R7821:Flnb UTSW 14 7,939,113 (GRCm38) missense probably benign 0.00
R7921:Flnb UTSW 14 7,933,800 (GRCm38) missense possibly damaging 0.57
R8008:Flnb UTSW 14 7,892,155 (GRCm38) missense probably damaging 1.00
R8075:Flnb UTSW 14 7,913,048 (GRCm38) missense probably benign 0.00
R8084:Flnb UTSW 14 7,907,243 (GRCm38) missense probably benign 0.00
R8259:Flnb UTSW 14 7,889,183 (GRCm38) missense probably damaging 0.99
R8441:Flnb UTSW 14 7,896,488 (GRCm38) missense probably benign 0.15
R8493:Flnb UTSW 14 7,869,822 (GRCm38) missense probably damaging 0.97
R8508:Flnb UTSW 14 7,950,394 (GRCm38) missense probably damaging 0.98
R8531:Flnb UTSW 14 7,929,939 (GRCm38) missense probably damaging 1.00
R8812:Flnb UTSW 14 7,887,624 (GRCm38) missense probably benign 0.06
R8814:Flnb UTSW 14 7,927,409 (GRCm38) missense probably damaging 1.00
R8825:Flnb UTSW 14 7,887,566 (GRCm38) missense probably damaging 1.00
R8868:Flnb UTSW 14 7,908,671 (GRCm38) missense probably benign 0.02
R8955:Flnb UTSW 14 7,904,688 (GRCm38) nonsense probably null
R8955:Flnb UTSW 14 7,892,874 (GRCm38) missense probably damaging 1.00
R8976:Flnb UTSW 14 7,901,882 (GRCm38) critical splice acceptor site probably null
R9055:Flnb UTSW 14 7,908,553 (GRCm38) missense probably benign 0.00
R9148:Flnb UTSW 14 7,817,996 (GRCm38) start gained probably benign
R9179:Flnb UTSW 14 7,887,541 (GRCm38) nonsense probably null
R9180:Flnb UTSW 14 7,818,219 (GRCm38) missense probably damaging 1.00
R9189:Flnb UTSW 14 7,892,976 (GRCm38) missense possibly damaging 0.90
R9286:Flnb UTSW 14 7,873,414 (GRCm38) missense probably damaging 0.98
R9288:Flnb UTSW 14 7,904,498 (GRCm38) missense probably benign 0.43
R9354:Flnb UTSW 14 7,818,411 (GRCm38) missense probably benign 0.13
R9484:Flnb UTSW 14 7,929,004 (GRCm38) missense probably benign 0.06
R9505:Flnb UTSW 14 7,904,665 (GRCm38) missense probably benign
R9525:Flnb UTSW 14 7,905,481 (GRCm38) missense probably damaging 1.00
R9621:Flnb UTSW 14 7,926,421 (GRCm38) missense probably damaging 0.99
R9630:Flnb UTSW 14 7,926,438 (GRCm38) nonsense probably null
R9739:Flnb UTSW 14 7,935,954 (GRCm38) nonsense probably null
R9760:Flnb UTSW 14 7,929,846 (GRCm38) missense probably damaging 0.98
X0066:Flnb UTSW 14 7,908,636 (GRCm38) missense probably damaging 1.00
Z1088:Flnb UTSW 14 7,905,871 (GRCm38) missense probably benign 0.04
Z1176:Flnb UTSW 14 7,942,066 (GRCm38) missense probably benign 0.25
Predicted Primers PCR Primer
(F):5'- GGCCAAAATCGAATGCTCG -3'
(R):5'- GTGTGGTACAAGCTCACCAC -3'

Sequencing Primer
(F):5'- TCGAATGCTCGGATAACGGTGAC -3'
(R):5'- TGTGGTACAAGCTCACCACCATAC -3'
Posted On 2015-12-29