Incidental Mutation 'R4784:Fam178b'
ID 366778
Institutional Source Beutler Lab
Gene Symbol Fam178b
Ensembl Gene ENSMUSG00000046337
Gene Name family with sequence similarity 178, member B
Synonyms LOC381337, 1700024G10Rik
MMRRC Submission 041994-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.075) question?
Stock # R4784 (G1)
Quality Score 215
Status Not validated
Chromosome 1
Chromosomal Location 36601773-36722264 bp(-) (GRCm39)
Type of Mutation splice site (5 bp from exon)
DNA Base Change (assembly) C to A at 36671496 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000132846 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000114981] [ENSMUST00000170295]
AlphaFold no structure available at present
Predicted Effect probably null
Transcript: ENSMUST00000114981
SMART Domains Protein: ENSMUSP00000124023
Gene: ENSMUSG00000046337

DomainStartEndE-ValueType
low complexity region 22 31 N/A INTRINSIC
low complexity region 33 44 N/A INTRINSIC
Pfam:FAM178 89 371 3.4e-115 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000170295
SMART Domains Protein: ENSMUSP00000132846
Gene: ENSMUSG00000046337

DomainStartEndE-ValueType
low complexity region 22 31 N/A INTRINSIC
low complexity region 33 44 N/A INTRINSIC
Pfam:FAM178 86 385 1e-130 PFAM
low complexity region 395 410 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 94.3%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 106 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adra1a T A 14: 66,875,273 (GRCm39) S83T probably damaging Het
Aff1 T A 5: 103,994,905 (GRCm39) Y1034* probably null Het
Ago3 A T 4: 126,262,296 (GRCm39) M418K probably benign Het
Alpk1 G T 3: 127,481,241 (GRCm39) N175K possibly damaging Het
Als2 A G 1: 59,254,472 (GRCm39) V295A probably benign Het
Arhgap32 A G 9: 32,040,949 (GRCm39) D67G probably damaging Het
Arhgap32 T C 9: 32,172,076 (GRCm39) C1619R probably damaging Het
Asns T G 6: 7,678,029 (GRCm39) K350Q probably benign Het
Atp8b5 A T 4: 43,356,980 (GRCm39) D576V probably damaging Het
Atrnl1 A G 19: 57,617,590 (GRCm39) I122V probably damaging Het
Baz1b T G 5: 135,246,267 (GRCm39) L572R possibly damaging Het
C4b T C 17: 34,952,380 (GRCm39) T1220A probably benign Het
Carmil3 T C 14: 55,738,778 (GRCm39) probably null Het
Ccndbp1 A T 2: 120,839,003 (GRCm39) T5S probably benign Het
Chaf1b T C 16: 93,681,430 (GRCm39) V16A probably damaging Het
Chd8 C A 14: 52,442,825 (GRCm39) C575F probably damaging Het
Chrna10 G A 7: 101,762,426 (GRCm39) P255S possibly damaging Het
Clip1 T C 5: 123,717,356 (GRCm39) D1387G probably damaging Het
Col12a1 C A 9: 79,585,776 (GRCm39) V1228F possibly damaging Het
Cxcr5 T C 9: 44,424,638 (GRCm39) T340A probably benign Het
Cyp2e1 G A 7: 140,343,821 (GRCm39) V20I possibly damaging Het
Dchs1 A G 7: 105,415,133 (GRCm39) Y684H probably damaging Het
Dcun1d3 T C 7: 119,456,887 (GRCm39) E275G probably damaging Het
Dgcr8 G A 16: 18,076,174 (GRCm39) R4* probably null Het
Dglucy A T 12: 100,804,923 (GRCm39) D168V probably damaging Het
Dnah1 T A 14: 30,985,436 (GRCm39) K3818N probably damaging Het
Dnajc17 T C 2: 119,009,909 (GRCm39) D239G probably benign Het
Dok2 C T 14: 71,015,314 (GRCm39) P347L probably benign Het
Elavl2 T C 4: 91,142,379 (GRCm39) R265G probably null Het
Elf1 T A 14: 79,818,183 (GRCm39) N567K probably benign Het
Epha8 A T 4: 136,660,633 (GRCm39) I695N probably damaging Het
Fam76a A T 4: 132,629,428 (GRCm39) probably null Het
Fam76a A G 4: 132,643,501 (GRCm39) Y78H probably damaging Het
Fbn1 A T 2: 125,166,839 (GRCm39) C2026S probably damaging Het
Fbxo4 T C 15: 3,998,523 (GRCm39) T312A probably benign Het
Fscn2 T C 11: 120,258,813 (GRCm39) F453L possibly damaging Het
Gabrb2 T C 11: 42,488,469 (GRCm39) C312R probably damaging Het
Gba2 A C 4: 43,568,315 (GRCm39) L684R probably damaging Het
Golga2 T A 2: 32,187,168 (GRCm39) N89K probably damaging Het
Gpx6 C T 13: 21,496,434 (GRCm39) Q3* probably null Het
Grin1 T A 2: 25,182,393 (GRCm39) H956L possibly damaging Het
H2-Q7 T G 17: 35,658,914 (GRCm39) C122G probably damaging Het
Hcar2 C G 5: 124,002,513 (GRCm39) G330A probably benign Het
Hes3 A G 4: 152,372,289 (GRCm39) S37P probably damaging Het
Hs3st3b1 T C 11: 63,780,086 (GRCm39) H347R probably benign Het
Il1rl1 A G 1: 40,489,348 (GRCm39) R367G probably damaging Het
Kcnc1 G T 7: 46,086,711 (GRCm39) S570I probably benign Het
Kctd3 T C 1: 188,706,665 (GRCm39) I523M probably damaging Het
Klk14 G A 7: 43,341,501 (GRCm39) C51Y probably damaging Het
Kntc1 T G 5: 123,954,825 (GRCm39) M2081R possibly damaging Het
Krt87 A G 15: 101,385,837 (GRCm39) S253P probably damaging Het
Ktn1 T A 14: 47,930,953 (GRCm39) probably null Het
Lair1 T A 7: 4,012,731 (GRCm39) M251L probably benign Het
Lama3 A T 18: 12,582,601 (GRCm39) H631L probably benign Het
Lamc1 T C 1: 153,107,486 (GRCm39) N1231S probably damaging Het
Lin54 A G 5: 100,607,597 (GRCm39) I250T probably damaging Het
Lrit1 C T 14: 36,784,193 (GRCm39) T507M possibly damaging Het
Lrp11 A G 10: 7,479,965 (GRCm39) H345R possibly damaging Het
Lrp6 A C 6: 134,456,502 (GRCm39) S921A probably benign Het
Lrrc27 A G 7: 138,822,614 (GRCm39) T502A probably benign Het
Marf1 A C 16: 13,970,321 (GRCm39) S133A probably benign Het
Mga C T 2: 119,733,538 (GRCm39) P129S probably damaging Het
Mgat4e T C 1: 134,469,063 (GRCm39) N327S probably damaging Het
Mlh1 A G 9: 111,068,866 (GRCm39) Y499H probably benign Het
Mrgpra1 A G 7: 46,985,218 (GRCm39) S154P probably damaging Het
Myo1h A G 5: 114,498,660 (GRCm39) I919V possibly damaging Het
Naalad2 T C 9: 18,262,214 (GRCm39) R442G probably damaging Het
Nat8f4 T C 6: 85,878,481 (GRCm39) H14R probably benign Het
Nav1 A G 1: 135,386,477 (GRCm39) S1184P probably damaging Het
Nckap1 T A 2: 80,337,278 (GRCm39) N986I probably benign Het
Ndufaf2 C G 13: 108,189,314 (GRCm39) A145P probably damaging Het
Nop9 AGAGGAGGAGGAGGAGGA AGAGGAGGAGGAGGA 14: 55,983,859 (GRCm39) probably benign Het
Nphp4 G A 4: 152,639,003 (GRCm39) R878K probably benign Het
Nutm1 G A 2: 112,079,281 (GRCm39) A878V probably benign Het
Or4f56 A T 2: 111,703,395 (GRCm39) D268E possibly damaging Het
Or52e8b A C 7: 104,673,737 (GRCm39) I150S probably damaging Het
Or5k1b G T 16: 58,580,911 (GRCm39) F209L probably damaging Het
Orc6 T A 8: 86,029,579 (GRCm39) I41K probably damaging Het
Pikfyve A G 1: 65,307,005 (GRCm39) T1798A probably benign Het
Ppp1r14a A T 7: 28,991,486 (GRCm39) E98V possibly damaging Het
Prpf8 T A 11: 75,383,331 (GRCm39) D521E probably damaging Het
Pudp A G 18: 50,701,136 (GRCm39) V199A probably damaging Het
Rab3c T C 13: 110,198,434 (GRCm39) E198G probably benign Het
Ramac T A 7: 81,418,163 (GRCm39) W73R probably damaging Het
Rbl2 A G 8: 91,812,196 (GRCm39) Y255C probably damaging Het
Rbm12 T C 2: 155,938,484 (GRCm39) D596G possibly damaging Het
Sipa1l3 A G 7: 29,077,066 (GRCm39) V902A probably damaging Het
Slc37a3 T G 6: 39,314,157 (GRCm39) Q485P probably benign Het
Slc44a3 T C 3: 121,320,723 (GRCm39) T93A possibly damaging Het
Slc66a1 G T 4: 139,027,312 (GRCm39) H343Q probably benign Het
Sun3 G A 11: 8,988,266 (GRCm39) L19F probably benign Het
Tas2r125 A G 6: 132,886,866 (GRCm39) I85V probably benign Het
Tenm4 A C 7: 96,423,253 (GRCm39) K683Q probably damaging Het
Tmprss11d C T 5: 86,454,140 (GRCm39) V222M probably damaging Het
Tnip1 A C 11: 54,806,365 (GRCm39) S570A possibly damaging Het
Top1mt G A 15: 75,529,552 (GRCm39) P554S probably damaging Het
Top1mt A G 15: 75,547,880 (GRCm39) F69L possibly damaging Het
Ttc7 A G 17: 87,648,325 (GRCm39) K508R probably benign Het
Ttll4 A T 1: 74,718,166 (GRCm39) T6S possibly damaging Het
Xpo5 T C 17: 46,533,643 (GRCm39) Y500H possibly damaging Het
Xpot C T 10: 121,450,968 (GRCm39) probably null Het
Zbbx T C 3: 74,992,348 (GRCm39) I268V probably benign Het
Zbtb40 G A 4: 136,734,408 (GRCm39) P360S probably damaging Het
Zfp324 T C 7: 12,705,233 (GRCm39) L474P probably damaging Het
Zfp398 A G 6: 47,817,186 (GRCm39) T9A probably benign Het
Zfp692 A C 11: 58,200,997 (GRCm39) S293R probably null Het
Other mutations in Fam178b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01070:Fam178b APN 1 36,603,484 (GRCm39) missense possibly damaging 0.90
IGL01128:Fam178b APN 1 36,683,435 (GRCm39) missense probably damaging 1.00
IGL01859:Fam178b APN 1 36,698,446 (GRCm39) missense probably damaging 1.00
R0398:Fam178b UTSW 1 36,671,487 (GRCm39) splice site probably benign
R1116:Fam178b UTSW 1 36,617,669 (GRCm39) nonsense probably null
R1613:Fam178b UTSW 1 36,639,273 (GRCm39) missense probably benign 0.01
R1623:Fam178b UTSW 1 36,683,405 (GRCm39) missense probably damaging 1.00
R2276:Fam178b UTSW 1 36,671,539 (GRCm39) missense probably damaging 1.00
R3706:Fam178b UTSW 1 36,647,529 (GRCm39) missense probably damaging 1.00
R4535:Fam178b UTSW 1 36,639,606 (GRCm39) missense probably benign 0.43
R5372:Fam178b UTSW 1 36,603,929 (GRCm39) missense possibly damaging 0.95
R5431:Fam178b UTSW 1 36,671,566 (GRCm39) missense probably damaging 1.00
R6808:Fam178b UTSW 1 36,639,216 (GRCm39) missense probably damaging 1.00
R7117:Fam178b UTSW 1 36,639,548 (GRCm39) missense probably benign 0.04
R7308:Fam178b UTSW 1 36,698,488 (GRCm39) missense probably benign
R7573:Fam178b UTSW 1 36,671,533 (GRCm39) missense probably damaging 1.00
R7678:Fam178b UTSW 1 36,603,532 (GRCm39) missense probably damaging 1.00
R9786:Fam178b UTSW 1 36,603,517 (GRCm39) missense probably damaging 0.97
Predicted Primers PCR Primer
(F):5'- TCAGTCATTGAGAACTGGACTTC -3'
(R):5'- CTTGGAAGCATTAAGATGAGTCC -3'

Sequencing Primer
(F):5'- TGGACTTCAGGCTGGCGAAG -3'
(R):5'- TACCCAGGTCTACAGAGTGAGTTC -3'
Posted On 2015-12-29