Incidental Mutation 'R0411:Ern1'
ID36679
Institutional Source Beutler Lab
Gene Symbol Ern1
Ensembl Gene ENSMUSG00000020715
Gene Nameendoplasmic reticulum (ER) to nucleus signalling 1
SynonymsIre1a, Ire1alpha, 9030414B18Rik, Ire1p
MMRRC Submission 038613-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R0411 (G1)
Quality Score225
Status Validated
Chromosome11
Chromosomal Location106394650-106487852 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 106398586 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Lysine at position 964 (E964K)
Ref Sequence ENSEMBL: ENSMUSP00000001059 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000001059]
PDB Structure
Crystal structure of murine IRE1 in complex with MKC9989 inhibitor [X-RAY DIFFRACTION]
Crystal structure of murine IRE1 in complex with OICR464 inhibitor [X-RAY DIFFRACTION]
Crystal structure of murine IRE1 in complex with OICR573 inhibitor [X-RAY DIFFRACTION]
Predicted Effect probably benign
Transcript: ENSMUST00000001059
AA Change: E964K

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000001059
Gene: ENSMUSG00000020715
AA Change: E964K

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
PQQ 28 59 3.46e-5 SMART
PQQ 110 142 1.11e-3 SMART
PQQ 148 180 7.84e-4 SMART
PQQ 191 223 3.26e-1 SMART
PQQ 279 310 5.01e1 SMART
low complexity region 471 501 N/A INTRINSIC
low complexity region 513 551 N/A INTRINSIC
Pfam:Pkinase 571 832 1.8e-44 PFAM
Pfam:Pkinase_Tyr 572 829 8.7e-26 PFAM
PUG 895 952 5.25e-23 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000131895
Meta Mutation Damage Score 0.026 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 95.0%
Validation Efficiency 97% (66/68)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is the ER to nucleus signalling 1 protein, a human homologue of the yeast Ire1 gene product. This protein possesses intrinsic kinase activity and an endoribonuclease activity and it is important in altering gene expression as a response to endoplasmic reticulum-based stress signals. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for null mutations display embryonic lethality during organogenesis. Homozygous mice may also display decreased embryo size, impaired hematopoiesis, and/or placental abnormalities. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 66 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
0610040J01Rik A G 5: 63,896,491 probably benign Het
6030469F06Rik A T 12: 31,184,731 noncoding transcript Het
Acad11 T C 9: 104,116,296 F541L probably damaging Het
Acin1 G T 14: 54,646,774 R92S probably damaging Het
Appl1 A G 14: 26,940,256 S490P probably benign Het
Aqp9 C A 9: 71,130,444 V184L probably benign Het
Arih1 A T 9: 59,485,983 I122N possibly damaging Het
Bmi1 T C 2: 18,683,172 probably benign Het
Bmpr1a G A 14: 34,415,877 T391I possibly damaging Het
Cacna1s A G 1: 136,113,303 K1256E probably damaging Het
Cacng3 C T 7: 122,768,572 P225L probably damaging Het
Cd101 A T 3: 101,018,527 probably null Het
Cd55 A G 1: 130,462,557 probably benign Het
Cenpe T C 3: 135,222,255 I258T probably damaging Het
Cma2 A G 14: 55,973,678 probably benign Het
Ddost T A 4: 138,309,653 S176T probably benign Het
Ddx19b A T 8: 111,023,964 probably null Het
Dmxl2 A G 9: 54,378,939 I2681T probably damaging Het
Galntl5 C T 5: 25,220,174 R430C probably benign Het
Gga3 A G 11: 115,587,433 L511P probably damaging Het
Gm7271 G T 5: 76,500,487 V47L possibly damaging Het
Gria2 C T 3: 80,710,858 probably benign Het
Hmbs A T 9: 44,341,652 L28* probably null Het
Iffo2 A G 4: 139,603,221 E220G probably damaging Het
Ifi30 A G 8: 70,764,918 probably benign Het
Irf2 T A 8: 46,846,061 C297S probably benign Het
Izumo4 T C 10: 80,703,084 Y94H probably damaging Het
Klhdc9 A G 1: 171,359,785 V215A probably benign Het
Kmt2a T C 9: 44,819,964 probably benign Het
Kmt2c A T 5: 25,375,957 C513S probably damaging Het
Lyg1 A T 1: 37,949,896 M81K possibly damaging Het
Maip1 T G 1: 57,415,693 W279G probably damaging Het
Myo7a T C 7: 98,071,937 T1263A probably benign Het
Naa15 T A 3: 51,465,639 I701N possibly damaging Het
Ncoa3 A G 2: 166,068,543 N1292S probably benign Het
Necab2 T A 8: 119,454,240 probably benign Het
Nfatc1 T A 18: 80,698,042 I234F possibly damaging Het
Olfm1 G A 2: 28,208,211 R95K possibly damaging Het
Olfr1118 A G 2: 87,309,058 T90A probably benign Het
Olfr1329 A T 4: 118,916,626 N280K possibly damaging Het
Otoa T C 7: 121,156,527 probably null Het
Padi4 GCTGCGTACCTCCAC GC 4: 140,748,449 probably benign Het
Pard6g A G 18: 80,117,122 D150G probably damaging Het
Pax5 A G 4: 44,609,783 L215S probably damaging Het
Pja2 A T 17: 64,287,521 probably benign Het
Plk4 T A 3: 40,811,219 probably benign Het
Polr1a A T 6: 71,978,421 H1687L possibly damaging Het
Ptcd2 G A 13: 99,343,391 L41F probably damaging Het
Ropn1 T A 16: 34,669,964 S62T probably benign Het
Setd1a T C 7: 127,796,051 probably benign Het
Setdb1 T C 3: 95,327,686 D902G probably damaging Het
Sik3 T A 9: 46,208,770 L719Q probably damaging Het
Slc36a1 G T 11: 55,232,507 V433F probably benign Het
Slc6a3 T C 13: 73,557,050 V220A possibly damaging Het
Slc6a5 A T 7: 49,911,791 R24W probably damaging Het
Smox G T 2: 131,520,644 R281L probably benign Het
Sulf2 G T 2: 166,093,516 H226N probably damaging Het
Syne2 C T 12: 76,059,584 probably null Het
Tenm3 C T 8: 48,287,791 S1210N possibly damaging Het
Tns1 A T 1: 73,925,761 V1237E probably damaging Het
Trf C T 9: 103,217,501 V92M probably damaging Het
Ttn A G 2: 76,709,373 V34423A possibly damaging Het
Vmn2r118 A G 17: 55,611,021 probably benign Het
Vmn2r19 A G 6: 123,309,744 Y112C probably damaging Het
Wdr66 C T 5: 123,290,054 T538M probably damaging Het
Zfp326 G T 5: 105,878,775 A15S possibly damaging Het
Other mutations in Ern1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00825:Ern1 APN 11 106421967 missense probably benign 0.02
IGL01938:Ern1 APN 11 106411657 missense probably benign
IGL02813:Ern1 APN 11 106423425 missense probably damaging 1.00
IGL02928:Ern1 APN 11 106405879 splice site probably benign
IGL02931:Ern1 APN 11 106423440 missense probably damaging 1.00
IGL03153:Ern1 APN 11 106410098 missense possibly damaging 0.63
Immoderate UTSW 11 106420042 missense possibly damaging 0.93
Militant UTSW 11 106411652 missense probably damaging 1.00
K7371:Ern1 UTSW 11 106400275 missense probably damaging 1.00
R0090:Ern1 UTSW 11 106405823 missense probably damaging 1.00
R0391:Ern1 UTSW 11 106407178 nonsense probably null
R0627:Ern1 UTSW 11 106398693 missense probably benign 0.00
R1416:Ern1 UTSW 11 106421980 splice site probably benign
R1831:Ern1 UTSW 11 106399842 splice site probably null
R1837:Ern1 UTSW 11 106458957 missense probably damaging 1.00
R1944:Ern1 UTSW 11 106421950 missense probably damaging 1.00
R1945:Ern1 UTSW 11 106421950 missense probably damaging 1.00
R1954:Ern1 UTSW 11 106421974 splice site probably benign
R1957:Ern1 UTSW 11 106426897 missense probably damaging 1.00
R2192:Ern1 UTSW 11 106409924 missense probably benign
R4276:Ern1 UTSW 11 106407181 missense probably benign
R4277:Ern1 UTSW 11 106407181 missense probably benign
R4471:Ern1 UTSW 11 106420042 missense possibly damaging 0.93
R4583:Ern1 UTSW 11 106407205 missense probably damaging 1.00
R4731:Ern1 UTSW 11 106434850 intron probably benign
R5177:Ern1 UTSW 11 106411775 missense probably benign 0.01
R5489:Ern1 UTSW 11 106407529 missense probably damaging 1.00
R5538:Ern1 UTSW 11 106421901 missense possibly damaging 0.83
R5806:Ern1 UTSW 11 106398705 missense probably damaging 0.96
R5922:Ern1 UTSW 11 106421730 missense probably damaging 0.97
R5931:Ern1 UTSW 11 106426873 missense possibly damaging 0.86
R5990:Ern1 UTSW 11 106411769 missense probably benign
R6149:Ern1 UTSW 11 106405815 nonsense probably null
R6253:Ern1 UTSW 11 106426908 missense possibly damaging 0.89
R6721:Ern1 UTSW 11 106411652 missense probably damaging 1.00
R6957:Ern1 UTSW 11 106403539 missense probably damaging 1.00
R7362:Ern1 UTSW 11 106437123 missense probably damaging 1.00
R7387:Ern1 UTSW 11 106421952 missense probably damaging 0.98
R7494:Ern1 UTSW 11 106407535 missense probably damaging 1.00
R7514:Ern1 UTSW 11 106409893 critical splice donor site probably null
X0021:Ern1 UTSW 11 106398606 missense probably damaging 1.00
X0022:Ern1 UTSW 11 106458919 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CGGTGAAAGGCTGATGCTGTTTCC -3'
(R):5'- GCCTGTTAAAGCTGTGTCTCTGCTC -3'

Sequencing Primer
(F):5'- TCACTACAAGGTTTCAGGGC -3'
(R):5'- GTGTCTCTGCTCATTCACAGAAAC -3'
Posted On2013-05-09