Incidental Mutation 'R4784:Aff1'
ID 366816
Institutional Source Beutler Lab
Gene Symbol Aff1
Ensembl Gene ENSMUSG00000029313
Gene Name AF4/FMR2 family, member 1
Synonyms 9630032B01Rik, Af4, Rob, Mllt2h
MMRRC Submission 041994-MU
Accession Numbers
Essential gene? Possibly non essential (E-score: 0.381) question?
Stock # R4784 (G1)
Quality Score 225
Status Not validated
Chromosome 5
Chromosomal Location 103692374-103855322 bp(+) (GRCm38)
Type of Mutation nonsense
DNA Base Change (assembly) T to A at 103847039 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Tyrosine to Stop codon at position 1034 (Y1034*)
Ref Sequence ENSEMBL: ENSMUSP00000059744 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000031256] [ENSMUST00000054979] [ENSMUST00000153165]
AlphaFold no structure available at present
Predicted Effect probably null
Transcript: ENSMUST00000031256
AA Change: Y1042*
SMART Domains Protein: ENSMUSP00000031256
Gene: ENSMUSG00000029313
AA Change: Y1042*

DomainStartEndE-ValueType
Pfam:AF-4 16 1223 N/A PFAM
Predicted Effect probably null
Transcript: ENSMUST00000054979
AA Change: Y1034*
SMART Domains Protein: ENSMUSP00000059744
Gene: ENSMUSG00000029313
AA Change: Y1034*

DomainStartEndE-ValueType
Pfam:AF-4 8 1216 N/A PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000153165
SMART Domains Protein: ENSMUSP00000119631
Gene: ENSMUSG00000029313

DomainStartEndE-ValueType
Pfam:AF-4 16 871 N/A PFAM
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 94.3%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes a member of the AF4/ lymphoid nuclear protein related to AF4/Fragile X E mental retardation syndrome family of proteins, which have been implicated in human childhood lymphoblastic leukemia, Fragile X E site mental retardation, and ataxia. It is the prevalent mixed-lineage leukemia fusion gene associated with spontaneous acute lymphoblastic leukemia. Members of this family have three conserved domains: an N-terminal homology domain, an AF4/ lymphoid nuclear protein related to AF4/Fragile X E mental retardation syndrome domain, and a C-terminal homology domain. Knockout of the mouse gene by homologous recombination severely affects early events in lymphopoiesis, including precursor proliferation or recruitment, but is dispensable for terminal differentiation. In addition, an autosomal dominant missense mutation results in several phenotypes including ataxia and adult-onset Purkinje cell loss in the cerebellum, indicating a role in Purkinje cell maintenance and function. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Sep 2015]
PHENOTYPE: Homozygotes for a targeted null mutation exhibit impaired B and T cell development. Heterozygotes for an ENU-induced mutation exhibit small size, ataxia, adult-onset Purkinje cell loss, cataracts, reduced survival, and low fertility. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 106 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adra1a T A 14: 66,637,824 S83T probably damaging Het
Ago3 A T 4: 126,368,503 M418K probably benign Het
Alpk1 G T 3: 127,687,592 N175K possibly damaging Het
Als2 A G 1: 59,215,313 V295A probably benign Het
Arhgap32 A G 9: 32,129,653 D67G probably damaging Het
Arhgap32 T C 9: 32,260,780 C1619R probably damaging Het
Asns T G 6: 7,678,029 K350Q probably benign Het
Atp8b5 A T 4: 43,356,980 D576V probably damaging Het
Atrnl1 A G 19: 57,629,158 I122V probably damaging Het
Baz1b T G 5: 135,217,413 L572R possibly damaging Het
C4b T C 17: 34,733,406 T1220A probably benign Het
Carmil3 T C 14: 55,501,321 probably null Het
Ccndbp1 A T 2: 121,008,522 T5S probably benign Het
Chaf1b T C 16: 93,884,542 V16A probably damaging Het
Chd8 C A 14: 52,205,368 C575F probably damaging Het
Chrna10 G A 7: 102,113,219 P255S possibly damaging Het
Clip1 T C 5: 123,579,293 D1387G probably damaging Het
Col12a1 C A 9: 79,678,494 V1228F possibly damaging Het
Cxcr5 T C 9: 44,513,341 T340A probably benign Het
Cyp2e1 G A 7: 140,763,908 V20I possibly damaging Het
Dchs1 A G 7: 105,765,926 Y684H probably damaging Het
Dcun1d3 T C 7: 119,857,664 E275G probably damaging Het
Dgcr8 G A 16: 18,258,310 R4* probably null Het
Dglucy A T 12: 100,838,664 D168V probably damaging Het
Dnah1 T A 14: 31,263,479 K3818N probably damaging Het
Dnajc17 T C 2: 119,179,428 D239G probably benign Het
Dok2 C T 14: 70,777,874 P347L probably benign Het
Elavl2 T C 4: 91,254,142 R265G probably null Het
Elf1 T A 14: 79,580,743 N567K probably benign Het
Epha8 A T 4: 136,933,322 I695N probably damaging Het
Fam103a1 T A 7: 81,768,415 W73R probably damaging Het
Fam178b C A 1: 36,632,415 probably null Het
Fam76a A T 4: 132,902,117 probably null Het
Fam76a A G 4: 132,916,190 Y78H probably damaging Het
Fbn1 A T 2: 125,324,919 C2026S probably damaging Het
Fbxo4 T C 15: 3,969,041 T312A probably benign Het
Fscn2 T C 11: 120,367,987 F453L possibly damaging Het
Gabrb2 T C 11: 42,597,642 C312R probably damaging Het
Gba2 A C 4: 43,568,315 L684R probably damaging Het
Golga2 T A 2: 32,297,156 N89K probably damaging Het
Gpx6 C T 13: 21,312,264 Q3* probably null Het
Grin1 T A 2: 25,292,381 H956L possibly damaging Het
H2-Q7 T G 17: 35,439,938 C122G probably damaging Het
Hcar2 C G 5: 123,864,450 G330A probably benign Het
Hes3 A G 4: 152,287,832 S37P probably damaging Het
Hs3st3b1 T C 11: 63,889,260 H347R probably benign Het
Il1rl1 A G 1: 40,450,188 R367G probably damaging Het
Kcnc1 G T 7: 46,437,287 S570I probably benign Het
Kctd3 T C 1: 188,974,468 I523M probably damaging Het
Klk14 G A 7: 43,692,077 C51Y probably damaging Het
Kntc1 T G 5: 123,816,762 M2081R possibly damaging Het
Krt83 A G 15: 101,487,956 S253P probably damaging Het
Ktn1 T A 14: 47,693,496 probably null Het
Lair1 T A 7: 4,009,732 M251L probably benign Het
Lama3 A T 18: 12,449,544 H631L probably benign Het
Lamc1 T C 1: 153,231,740 N1231S probably damaging Het
Lin54 A G 5: 100,459,738 I250T probably damaging Het
Lrit1 C T 14: 37,062,236 T507M possibly damaging Het
Lrp11 A G 10: 7,604,201 H345R possibly damaging Het
Lrp6 A C 6: 134,479,539 S921A probably benign Het
Lrrc27 A G 7: 139,242,698 T502A probably benign Het
Marf1 A C 16: 14,152,457 S133A probably benign Het
Mga C T 2: 119,903,057 P129S probably damaging Het
Mgat4e T C 1: 134,541,325 N327S probably damaging Het
Mlh1 A G 9: 111,239,798 Y499H probably benign Het
Mrgpra1 A G 7: 47,335,470 S154P probably damaging Het
Myo1h A G 5: 114,360,599 I919V possibly damaging Het
Naalad2 T C 9: 18,350,918 R442G probably damaging Het
Nat8f4 T C 6: 85,901,499 H14R probably benign Het
Nav1 A G 1: 135,458,739 S1184P probably damaging Het
Nckap1 T A 2: 80,506,934 N986I probably benign Het
Ndufaf2 C G 13: 108,052,780 A145P probably damaging Het
Nop9 AGAGGAGGAGGAGGAGGA AGAGGAGGAGGAGGA 14: 55,746,402 probably benign Het
Nphp4 G A 4: 152,554,546 R878K probably benign Het
Nutm1 G A 2: 112,248,936 A878V probably benign Het
Olfr1305 A T 2: 111,873,050 D268E possibly damaging Het
Olfr172 G T 16: 58,760,548 F209L probably damaging Het
Olfr675 A C 7: 105,024,530 I150S probably damaging Het
Orc6 T A 8: 85,302,950 I41K probably damaging Het
Pikfyve A G 1: 65,267,846 T1798A probably benign Het
Ppp1r14a A T 7: 29,292,061 E98V possibly damaging Het
Pqlc2 G T 4: 139,300,001 H343Q probably benign Het
Prpf8 T A 11: 75,492,505 D521E probably damaging Het
Pudp A G 18: 50,568,065 V199A probably damaging Het
Rab3c T C 13: 110,061,900 E198G probably benign Het
Rbl2 A G 8: 91,085,568 Y255C probably damaging Het
Rbm12 T C 2: 156,096,564 D596G possibly damaging Het
Sipa1l3 A G 7: 29,377,641 V902A probably damaging Het
Slc37a3 T G 6: 39,337,223 Q485P probably benign Het
Slc44a3 T C 3: 121,527,074 T93A possibly damaging Het
Sun3 G A 11: 9,038,266 L19F probably benign Het
Tas2r125 A G 6: 132,909,903 I85V probably benign Het
Tenm4 A C 7: 96,774,046 K683Q probably damaging Het
Tmprss11d C T 5: 86,306,281 V222M probably damaging Het
Tnip1 A C 11: 54,915,539 S570A possibly damaging Het
Top1mt G A 15: 75,657,703 P554S probably damaging Het
Top1mt A G 15: 75,676,031 F69L possibly damaging Het
Ttc7 A G 17: 87,340,897 K508R probably benign Het
Ttll4 A T 1: 74,679,007 T6S possibly damaging Het
Xpo5 T C 17: 46,222,717 Y500H possibly damaging Het
Xpot C T 10: 121,615,063 probably null Het
Zbbx T C 3: 75,085,041 I268V probably benign Het
Zbtb40 G A 4: 137,007,097 P360S probably damaging Het
Zfp324 T C 7: 12,971,306 L474P probably damaging Het
Zfp398 A G 6: 47,840,252 T9A probably benign Het
Zfp692 A C 11: 58,310,171 S293R probably null Het
Other mutations in Aff1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00773:Aff1 APN 5 103784077 missense probably damaging 1.00
IGL02060:Aff1 APN 5 103783849 missense possibly damaging 0.51
IGL02081:Aff1 APN 5 103834305 missense probably damaging 1.00
IGL02108:Aff1 APN 5 103811109 critical splice donor site probably null
IGL03056:Aff1 APN 5 103811081 missense probably damaging 0.99
IGL03332:Aff1 APN 5 103841105 nonsense probably null
IGL03340:Aff1 APN 5 103783804 missense possibly damaging 0.76
IGL03382:Aff1 APN 5 103841060 missense possibly damaging 0.86
PIT4495001:Aff1 UTSW 5 103849525 missense probably benign 0.16
R0013:Aff1 UTSW 5 103828484 nonsense probably null
R0219:Aff1 UTSW 5 103811040 splice site probably benign
R0520:Aff1 UTSW 5 103847751 nonsense probably null
R0607:Aff1 UTSW 5 103828454 missense probably damaging 1.00
R0883:Aff1 UTSW 5 103826138 splice site probably benign
R1662:Aff1 UTSW 5 103841057 missense probably damaging 0.99
R1730:Aff1 UTSW 5 103833512 missense probably damaging 1.00
R1850:Aff1 UTSW 5 103833907 missense probably damaging 1.00
R3411:Aff1 UTSW 5 103754706 start codon destroyed probably null 0.53
R4007:Aff1 UTSW 5 103784222 missense probably benign 0.15
R4207:Aff1 UTSW 5 103818988 critical splice donor site probably null
R4702:Aff1 UTSW 5 103811069 missense probably damaging 1.00
R4730:Aff1 UTSW 5 103843073 missense possibly damaging 0.95
R5166:Aff1 UTSW 5 103754657 start gained probably benign
R5294:Aff1 UTSW 5 103811157 intron probably benign
R5435:Aff1 UTSW 5 103754332 unclassified probably benign
R5436:Aff1 UTSW 5 103783870 missense probably damaging 1.00
R6065:Aff1 UTSW 5 103842252 missense probably damaging 1.00
R6114:Aff1 UTSW 5 103842297 missense probably damaging 0.97
R6298:Aff1 UTSW 5 103754720 missense possibly damaging 0.68
R7095:Aff1 UTSW 5 103843085 missense probably damaging 0.97
R7261:Aff1 UTSW 5 103828379 missense probably damaging 0.97
R7350:Aff1 UTSW 5 103847092 missense probably benign 0.28
R7423:Aff1 UTSW 5 103847101 missense probably damaging 1.00
R7469:Aff1 UTSW 5 103833547 missense probably benign 0.00
R7604:Aff1 UTSW 5 103847809 missense probably benign 0.09
R7607:Aff1 UTSW 5 103849459 missense possibly damaging 0.72
R8014:Aff1 UTSW 5 103833869 missense possibly damaging 0.82
R8219:Aff1 UTSW 5 103846333 missense probably damaging 1.00
R8315:Aff1 UTSW 5 103811090 missense probably damaging 0.99
R8837:Aff1 UTSW 5 103834212 missense possibly damaging 0.77
R8957:Aff1 UTSW 5 103833768 missense possibly damaging 0.82
R9159:Aff1 UTSW 5 103842265 missense possibly damaging 0.89
R9377:Aff1 UTSW 5 103833819 missense probably damaging 0.96
R9381:Aff1 UTSW 5 103833867 missense possibly damaging 0.85
R9705:Aff1 UTSW 5 103784410 missense possibly damaging 0.88
R9725:Aff1 UTSW 5 103847065 missense probably damaging 0.99
R9764:Aff1 UTSW 5 103849499 missense probably damaging 1.00
Z1177:Aff1 UTSW 5 103783753 missense possibly damaging 0.71
Predicted Primers PCR Primer
(F):5'- CACCACACTTGAGAGAGCAG -3'
(R):5'- GAGTCAGACTAAGTTCCCTCCTG -3'

Sequencing Primer
(F):5'- ACACTTGAGAGAGCAGGCCTC -3'
(R):5'- CCTGGTCTACATAATGAGTTCCAGG -3'
Posted On 2015-12-29