Incidental Mutation 'R4784:Dchs1'
ID 366839
Institutional Source Beutler Lab
Gene Symbol Dchs1
Ensembl Gene ENSMUSG00000036862
Gene Name dachsous cadherin related 1
Synonyms C130033F22Rik, 3110041P15Rik
MMRRC Submission 041994-MU
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R4784 (G1)
Quality Score 225
Status Not validated
Chromosome 7
Chromosomal Location 105402197-105436861 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 105415133 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Tyrosine to Histidine at position 684 (Y684H)
Ref Sequence ENSEMBL: ENSMUSP00000077574 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000078482]
AlphaFold no structure available at present
Predicted Effect probably damaging
Transcript: ENSMUST00000078482
AA Change: Y684H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000077574
Gene: ENSMUSG00000036862
AA Change: Y684H

DomainStartEndE-ValueType
signal peptide 1 36 N/A INTRINSIC
CA 58 135 5.2e-11 SMART
CA 159 247 6.1e-17 SMART
CA 271 354 2.6e-30 SMART
CA 382 464 7.8e-26 SMART
CA 489 570 1.2e-34 SMART
CA 594 677 1.9e-27 SMART
CA 701 782 5.3e-11 SMART
CA 806 886 1e-12 SMART
CA 910 990 3.3e-14 SMART
CA 1016 1097 3.6e-18 SMART
CA 1121 1203 3.1e-34 SMART
CA 1233 1307 8.8e-16 SMART
low complexity region 1323 1335 N/A INTRINSIC
CA 1344 1427 9.9e-9 SMART
CA 1451 1537 1.5e-23 SMART
CA 1560 1640 7.2e-32 SMART
CA 1664 1742 1.8e-31 SMART
CA 1765 1846 7.8e-30 SMART
CA 1870 1951 3.7e-26 SMART
low complexity region 1957 1965 N/A INTRINSIC
CA 1979 2059 1.1e-6 SMART
CA 2083 2162 2.7e-18 SMART
CA 2186 2268 2.2e-26 SMART
CA 2291 2367 1e-18 SMART
CA 2391 2473 1.8e-23 SMART
CA 2497 2593 3.5e-21 SMART
CA 2617 2697 1.2e-25 SMART
CA 2721 2804 1.9e-18 SMART
CA 2828 2919 3e-3 SMART
transmembrane domain 2932 2954 N/A INTRINSIC
low complexity region 3001 3017 N/A INTRINSIC
low complexity region 3046 3055 N/A INTRINSIC
low complexity region 3088 3097 N/A INTRINSIC
low complexity region 3185 3196 N/A INTRINSIC
low complexity region 3237 3259 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000131504
Predicted Effect noncoding transcript
Transcript: ENSMUST00000154659
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 94.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of the cadherin superfamily whose members encode calcium-dependent cell-cell adhesion molecules. The encoded protein has a signal peptide, 27 cadherin repeat domains and a unique cytoplasmic region. This particular cadherin family member is expressed in fibroblasts but not in melanocytes or keratinocytes. The cell-cell adhesion of fibroblasts is thought to be necessary for wound healing. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit postnatal lethality, growth retardation, small lungs, abnormal cochlea morphology, abnormal kidney morphology, cardiovascular abnormalities and skeletal abnormalities. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 106 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adra1a T A 14: 66,875,273 (GRCm39) S83T probably damaging Het
Aff1 T A 5: 103,994,905 (GRCm39) Y1034* probably null Het
Ago3 A T 4: 126,262,296 (GRCm39) M418K probably benign Het
Alpk1 G T 3: 127,481,241 (GRCm39) N175K possibly damaging Het
Als2 A G 1: 59,254,472 (GRCm39) V295A probably benign Het
Arhgap32 A G 9: 32,040,949 (GRCm39) D67G probably damaging Het
Arhgap32 T C 9: 32,172,076 (GRCm39) C1619R probably damaging Het
Asns T G 6: 7,678,029 (GRCm39) K350Q probably benign Het
Atp8b5 A T 4: 43,356,980 (GRCm39) D576V probably damaging Het
Atrnl1 A G 19: 57,617,590 (GRCm39) I122V probably damaging Het
Baz1b T G 5: 135,246,267 (GRCm39) L572R possibly damaging Het
C4b T C 17: 34,952,380 (GRCm39) T1220A probably benign Het
Carmil3 T C 14: 55,738,778 (GRCm39) probably null Het
Ccndbp1 A T 2: 120,839,003 (GRCm39) T5S probably benign Het
Chaf1b T C 16: 93,681,430 (GRCm39) V16A probably damaging Het
Chd8 C A 14: 52,442,825 (GRCm39) C575F probably damaging Het
Chrna10 G A 7: 101,762,426 (GRCm39) P255S possibly damaging Het
Clip1 T C 5: 123,717,356 (GRCm39) D1387G probably damaging Het
Col12a1 C A 9: 79,585,776 (GRCm39) V1228F possibly damaging Het
Cxcr5 T C 9: 44,424,638 (GRCm39) T340A probably benign Het
Cyp2e1 G A 7: 140,343,821 (GRCm39) V20I possibly damaging Het
Dcun1d3 T C 7: 119,456,887 (GRCm39) E275G probably damaging Het
Dgcr8 G A 16: 18,076,174 (GRCm39) R4* probably null Het
Dglucy A T 12: 100,804,923 (GRCm39) D168V probably damaging Het
Dnah1 T A 14: 30,985,436 (GRCm39) K3818N probably damaging Het
Dnajc17 T C 2: 119,009,909 (GRCm39) D239G probably benign Het
Dok2 C T 14: 71,015,314 (GRCm39) P347L probably benign Het
Elavl2 T C 4: 91,142,379 (GRCm39) R265G probably null Het
Elf1 T A 14: 79,818,183 (GRCm39) N567K probably benign Het
Epha8 A T 4: 136,660,633 (GRCm39) I695N probably damaging Het
Fam178b C A 1: 36,671,496 (GRCm39) probably null Het
Fam76a A T 4: 132,629,428 (GRCm39) probably null Het
Fam76a A G 4: 132,643,501 (GRCm39) Y78H probably damaging Het
Fbn1 A T 2: 125,166,839 (GRCm39) C2026S probably damaging Het
Fbxo4 T C 15: 3,998,523 (GRCm39) T312A probably benign Het
Fscn2 T C 11: 120,258,813 (GRCm39) F453L possibly damaging Het
Gabrb2 T C 11: 42,488,469 (GRCm39) C312R probably damaging Het
Gba2 A C 4: 43,568,315 (GRCm39) L684R probably damaging Het
Golga2 T A 2: 32,187,168 (GRCm39) N89K probably damaging Het
Gpx6 C T 13: 21,496,434 (GRCm39) Q3* probably null Het
Grin1 T A 2: 25,182,393 (GRCm39) H956L possibly damaging Het
H2-Q7 T G 17: 35,658,914 (GRCm39) C122G probably damaging Het
Hcar2 C G 5: 124,002,513 (GRCm39) G330A probably benign Het
Hes3 A G 4: 152,372,289 (GRCm39) S37P probably damaging Het
Hs3st3b1 T C 11: 63,780,086 (GRCm39) H347R probably benign Het
Il1rl1 A G 1: 40,489,348 (GRCm39) R367G probably damaging Het
Kcnc1 G T 7: 46,086,711 (GRCm39) S570I probably benign Het
Kctd3 T C 1: 188,706,665 (GRCm39) I523M probably damaging Het
Klk14 G A 7: 43,341,501 (GRCm39) C51Y probably damaging Het
Kntc1 T G 5: 123,954,825 (GRCm39) M2081R possibly damaging Het
Krt87 A G 15: 101,385,837 (GRCm39) S253P probably damaging Het
Ktn1 T A 14: 47,930,953 (GRCm39) probably null Het
Lair1 T A 7: 4,012,731 (GRCm39) M251L probably benign Het
Lama3 A T 18: 12,582,601 (GRCm39) H631L probably benign Het
Lamc1 T C 1: 153,107,486 (GRCm39) N1231S probably damaging Het
Lin54 A G 5: 100,607,597 (GRCm39) I250T probably damaging Het
Lrit1 C T 14: 36,784,193 (GRCm39) T507M possibly damaging Het
Lrp11 A G 10: 7,479,965 (GRCm39) H345R possibly damaging Het
Lrp6 A C 6: 134,456,502 (GRCm39) S921A probably benign Het
Lrrc27 A G 7: 138,822,614 (GRCm39) T502A probably benign Het
Marf1 A C 16: 13,970,321 (GRCm39) S133A probably benign Het
Mga C T 2: 119,733,538 (GRCm39) P129S probably damaging Het
Mgat4e T C 1: 134,469,063 (GRCm39) N327S probably damaging Het
Mlh1 A G 9: 111,068,866 (GRCm39) Y499H probably benign Het
Mrgpra1 A G 7: 46,985,218 (GRCm39) S154P probably damaging Het
Myo1h A G 5: 114,498,660 (GRCm39) I919V possibly damaging Het
Naalad2 T C 9: 18,262,214 (GRCm39) R442G probably damaging Het
Nat8f4 T C 6: 85,878,481 (GRCm39) H14R probably benign Het
Nav1 A G 1: 135,386,477 (GRCm39) S1184P probably damaging Het
Nckap1 T A 2: 80,337,278 (GRCm39) N986I probably benign Het
Ndufaf2 C G 13: 108,189,314 (GRCm39) A145P probably damaging Het
Nop9 AGAGGAGGAGGAGGAGGA AGAGGAGGAGGAGGA 14: 55,983,859 (GRCm39) probably benign Het
Nphp4 G A 4: 152,639,003 (GRCm39) R878K probably benign Het
Nutm1 G A 2: 112,079,281 (GRCm39) A878V probably benign Het
Or4f56 A T 2: 111,703,395 (GRCm39) D268E possibly damaging Het
Or52e8b A C 7: 104,673,737 (GRCm39) I150S probably damaging Het
Or5k1b G T 16: 58,580,911 (GRCm39) F209L probably damaging Het
Orc6 T A 8: 86,029,579 (GRCm39) I41K probably damaging Het
Pikfyve A G 1: 65,307,005 (GRCm39) T1798A probably benign Het
Ppp1r14a A T 7: 28,991,486 (GRCm39) E98V possibly damaging Het
Prpf8 T A 11: 75,383,331 (GRCm39) D521E probably damaging Het
Pudp A G 18: 50,701,136 (GRCm39) V199A probably damaging Het
Rab3c T C 13: 110,198,434 (GRCm39) E198G probably benign Het
Ramac T A 7: 81,418,163 (GRCm39) W73R probably damaging Het
Rbl2 A G 8: 91,812,196 (GRCm39) Y255C probably damaging Het
Rbm12 T C 2: 155,938,484 (GRCm39) D596G possibly damaging Het
Sipa1l3 A G 7: 29,077,066 (GRCm39) V902A probably damaging Het
Slc37a3 T G 6: 39,314,157 (GRCm39) Q485P probably benign Het
Slc44a3 T C 3: 121,320,723 (GRCm39) T93A possibly damaging Het
Slc66a1 G T 4: 139,027,312 (GRCm39) H343Q probably benign Het
Sun3 G A 11: 8,988,266 (GRCm39) L19F probably benign Het
Tas2r125 A G 6: 132,886,866 (GRCm39) I85V probably benign Het
Tenm4 A C 7: 96,423,253 (GRCm39) K683Q probably damaging Het
Tmprss11d C T 5: 86,454,140 (GRCm39) V222M probably damaging Het
Tnip1 A C 11: 54,806,365 (GRCm39) S570A possibly damaging Het
Top1mt G A 15: 75,529,552 (GRCm39) P554S probably damaging Het
Top1mt A G 15: 75,547,880 (GRCm39) F69L possibly damaging Het
Ttc7 A G 17: 87,648,325 (GRCm39) K508R probably benign Het
Ttll4 A T 1: 74,718,166 (GRCm39) T6S possibly damaging Het
Xpo5 T C 17: 46,533,643 (GRCm39) Y500H possibly damaging Het
Xpot C T 10: 121,450,968 (GRCm39) probably null Het
Zbbx T C 3: 74,992,348 (GRCm39) I268V probably benign Het
Zbtb40 G A 4: 136,734,408 (GRCm39) P360S probably damaging Het
Zfp324 T C 7: 12,705,233 (GRCm39) L474P probably damaging Het
Zfp398 A G 6: 47,817,186 (GRCm39) T9A probably benign Het
Zfp692 A C 11: 58,200,997 (GRCm39) S293R probably null Het
Other mutations in Dchs1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00235:Dchs1 APN 7 105,407,950 (GRCm39) missense probably damaging 1.00
IGL00422:Dchs1 APN 7 105,407,236 (GRCm39) missense possibly damaging 0.88
IGL00427:Dchs1 APN 7 105,407,631 (GRCm39) missense probably damaging 0.98
IGL00469:Dchs1 APN 7 105,404,468 (GRCm39) missense probably damaging 1.00
IGL00470:Dchs1 APN 7 105,407,414 (GRCm39) missense probably damaging 1.00
IGL00534:Dchs1 APN 7 105,407,150 (GRCm39) missense probably benign
IGL01292:Dchs1 APN 7 105,410,098 (GRCm39) missense probably damaging 0.98
IGL01380:Dchs1 APN 7 105,411,418 (GRCm39) missense probably damaging 1.00
IGL01396:Dchs1 APN 7 105,421,490 (GRCm39) missense probably damaging 1.00
IGL01448:Dchs1 APN 7 105,421,134 (GRCm39) missense probably damaging 0.98
IGL01759:Dchs1 APN 7 105,404,509 (GRCm39) missense probably benign 0.00
IGL01829:Dchs1 APN 7 105,404,604 (GRCm39) missense probably damaging 0.99
IGL01946:Dchs1 APN 7 105,408,312 (GRCm39) missense probably damaging 1.00
IGL01955:Dchs1 APN 7 105,406,798 (GRCm39) missense probably benign 0.00
IGL02012:Dchs1 APN 7 105,413,504 (GRCm39) missense probably damaging 0.98
IGL02222:Dchs1 APN 7 105,414,094 (GRCm39) missense probably damaging 1.00
IGL02261:Dchs1 APN 7 105,421,776 (GRCm39) missense probably damaging 1.00
IGL02365:Dchs1 APN 7 105,404,395 (GRCm39) missense probably benign 0.22
IGL02430:Dchs1 APN 7 105,421,178 (GRCm39) missense probably benign 0.34
IGL02500:Dchs1 APN 7 105,405,013 (GRCm39) missense probably benign
IGL02741:Dchs1 APN 7 105,406,530 (GRCm39) missense probably damaging 1.00
IGL02890:Dchs1 APN 7 105,405,698 (GRCm39) missense probably damaging 1.00
IGL03213:Dchs1 APN 7 105,404,279 (GRCm39) missense probably damaging 1.00
G1patch:Dchs1 UTSW 7 105,408,000 (GRCm39) missense probably damaging 0.99
P0026:Dchs1 UTSW 7 105,407,612 (GRCm39) missense probably damaging 0.99
PIT4377001:Dchs1 UTSW 7 105,406,795 (GRCm39) missense probably damaging 1.00
PIT4791001:Dchs1 UTSW 7 105,408,178 (GRCm39) missense probably damaging 1.00
R0013:Dchs1 UTSW 7 105,405,043 (GRCm39) missense possibly damaging 0.90
R0090:Dchs1 UTSW 7 105,405,139 (GRCm39) missense probably benign 0.18
R0091:Dchs1 UTSW 7 105,415,301 (GRCm39) splice site probably benign
R0193:Dchs1 UTSW 7 105,414,190 (GRCm39) missense probably benign 0.40
R0395:Dchs1 UTSW 7 105,407,745 (GRCm39) missense probably damaging 1.00
R0448:Dchs1 UTSW 7 105,415,134 (GRCm39) missense probably benign 0.00
R0480:Dchs1 UTSW 7 105,420,696 (GRCm39) missense probably benign 0.14
R0485:Dchs1 UTSW 7 105,421,934 (GRCm39) missense probably benign 0.00
R0566:Dchs1 UTSW 7 105,408,402 (GRCm39) missense probably benign 0.00
R0571:Dchs1 UTSW 7 105,421,203 (GRCm39) missense probably damaging 1.00
R0573:Dchs1 UTSW 7 105,407,985 (GRCm39) missense probably damaging 0.98
R0577:Dchs1 UTSW 7 105,413,462 (GRCm39) missense possibly damaging 0.78
R0622:Dchs1 UTSW 7 105,412,656 (GRCm39) missense probably damaging 1.00
R0654:Dchs1 UTSW 7 105,421,556 (GRCm39) missense probably damaging 1.00
R0677:Dchs1 UTSW 7 105,414,191 (GRCm39) missense probably damaging 1.00
R1171:Dchs1 UTSW 7 105,406,921 (GRCm39) missense probably benign
R1241:Dchs1 UTSW 7 105,407,385 (GRCm39) missense probably damaging 1.00
R1389:Dchs1 UTSW 7 105,404,778 (GRCm39) missense probably benign 0.40
R1427:Dchs1 UTSW 7 105,415,398 (GRCm39) missense probably benign 0.06
R1458:Dchs1 UTSW 7 105,404,451 (GRCm39) missense probably damaging 1.00
R1513:Dchs1 UTSW 7 105,421,278 (GRCm39) nonsense probably null
R1524:Dchs1 UTSW 7 105,413,732 (GRCm39) missense probably damaging 1.00
R1525:Dchs1 UTSW 7 105,408,138 (GRCm39) missense probably damaging 1.00
R1534:Dchs1 UTSW 7 105,421,247 (GRCm39) missense probably damaging 0.98
R1567:Dchs1 UTSW 7 105,421,068 (GRCm39) missense probably benign 0.01
R1577:Dchs1 UTSW 7 105,415,162 (GRCm39) missense probably damaging 1.00
R1603:Dchs1 UTSW 7 105,411,977 (GRCm39) missense probably benign 0.24
R1676:Dchs1 UTSW 7 105,404,128 (GRCm39) missense probably benign 0.40
R1794:Dchs1 UTSW 7 105,420,927 (GRCm39) missense probably benign 0.02
R1826:Dchs1 UTSW 7 105,406,834 (GRCm39) missense probably damaging 1.00
R1892:Dchs1 UTSW 7 105,413,363 (GRCm39) missense probably benign 0.00
R1924:Dchs1 UTSW 7 105,421,487 (GRCm39) missense possibly damaging 0.81
R1932:Dchs1 UTSW 7 105,415,109 (GRCm39) missense probably damaging 1.00
R1962:Dchs1 UTSW 7 105,413,408 (GRCm39) missense probably damaging 1.00
R1985:Dchs1 UTSW 7 105,421,605 (GRCm39) missense possibly damaging 0.72
R1993:Dchs1 UTSW 7 105,411,755 (GRCm39) missense probably benign 0.00
R2007:Dchs1 UTSW 7 105,404,532 (GRCm39) missense probably damaging 1.00
R2316:Dchs1 UTSW 7 105,413,411 (GRCm39) missense possibly damaging 0.71
R2351:Dchs1 UTSW 7 105,403,301 (GRCm39) missense probably benign
R2474:Dchs1 UTSW 7 105,404,281 (GRCm39) missense probably benign 0.37
R2474:Dchs1 UTSW 7 105,422,045 (GRCm39) missense probably damaging 1.00
R3429:Dchs1 UTSW 7 105,405,711 (GRCm39) missense possibly damaging 0.85
R3430:Dchs1 UTSW 7 105,405,711 (GRCm39) missense possibly damaging 0.85
R3737:Dchs1 UTSW 7 105,411,523 (GRCm39) missense possibly damaging 0.88
R3767:Dchs1 UTSW 7 105,406,292 (GRCm39) missense possibly damaging 0.67
R3874:Dchs1 UTSW 7 105,410,842 (GRCm39) missense probably damaging 1.00
R3883:Dchs1 UTSW 7 105,411,770 (GRCm39) missense probably damaging 1.00
R4105:Dchs1 UTSW 7 105,414,347 (GRCm39) missense probably damaging 1.00
R4209:Dchs1 UTSW 7 105,415,397 (GRCm39) missense probably damaging 0.99
R4329:Dchs1 UTSW 7 105,402,966 (GRCm39) missense probably damaging 1.00
R4516:Dchs1 UTSW 7 105,404,059 (GRCm39) missense probably damaging 1.00
R4579:Dchs1 UTSW 7 105,408,180 (GRCm39) missense probably benign
R4579:Dchs1 UTSW 7 105,403,972 (GRCm39) missense probably damaging 1.00
R4588:Dchs1 UTSW 7 105,405,248 (GRCm39) missense probably benign
R4613:Dchs1 UTSW 7 105,421,931 (GRCm39) missense probably damaging 1.00
R4632:Dchs1 UTSW 7 105,403,562 (GRCm39) missense probably benign 0.02
R4696:Dchs1 UTSW 7 105,413,834 (GRCm39) missense probably damaging 1.00
R4725:Dchs1 UTSW 7 105,414,759 (GRCm39) missense probably damaging 1.00
R4725:Dchs1 UTSW 7 105,404,460 (GRCm39) missense probably damaging 0.98
R4738:Dchs1 UTSW 7 105,407,880 (GRCm39) missense probably damaging 0.96
R4768:Dchs1 UTSW 7 105,420,827 (GRCm39) missense possibly damaging 0.96
R4864:Dchs1 UTSW 7 105,404,460 (GRCm39) missense probably damaging 0.98
R4880:Dchs1 UTSW 7 105,404,937 (GRCm39) missense probably benign 0.00
R4909:Dchs1 UTSW 7 105,415,462 (GRCm39) missense probably damaging 1.00
R5102:Dchs1 UTSW 7 105,421,384 (GRCm39) missense probably benign 0.09
R5109:Dchs1 UTSW 7 105,414,221 (GRCm39) missense probably benign
R5126:Dchs1 UTSW 7 105,402,724 (GRCm39) missense probably damaging 1.00
R5149:Dchs1 UTSW 7 105,404,865 (GRCm39) missense probably damaging 0.98
R5330:Dchs1 UTSW 7 105,403,809 (GRCm39) missense probably damaging 1.00
R5384:Dchs1 UTSW 7 105,421,262 (GRCm39) missense probably damaging 1.00
R5384:Dchs1 UTSW 7 105,407,236 (GRCm39) missense probably damaging 1.00
R5386:Dchs1 UTSW 7 105,407,236 (GRCm39) missense probably damaging 1.00
R5622:Dchs1 UTSW 7 105,404,500 (GRCm39) missense probably benign 0.11
R5623:Dchs1 UTSW 7 105,421,976 (GRCm39) missense probably damaging 1.00
R5708:Dchs1 UTSW 7 105,422,016 (GRCm39) missense probably damaging 1.00
R5718:Dchs1 UTSW 7 105,404,955 (GRCm39) missense probably benign 0.01
R5743:Dchs1 UTSW 7 105,420,803 (GRCm39) missense probably benign
R5759:Dchs1 UTSW 7 105,413,383 (GRCm39) missense probably damaging 0.99
R5772:Dchs1 UTSW 7 105,422,247 (GRCm39) missense probably damaging 1.00
R5860:Dchs1 UTSW 7 105,421,242 (GRCm39) missense probably damaging 1.00
R5916:Dchs1 UTSW 7 105,408,373 (GRCm39) missense probably damaging 1.00
R5965:Dchs1 UTSW 7 105,405,132 (GRCm39) missense probably damaging 1.00
R5997:Dchs1 UTSW 7 105,403,302 (GRCm39) missense probably benign 0.08
R6065:Dchs1 UTSW 7 105,404,628 (GRCm39) missense probably damaging 1.00
R6136:Dchs1 UTSW 7 105,410,132 (GRCm39) missense probably benign
R6137:Dchs1 UTSW 7 105,414,313 (GRCm39) missense probably damaging 0.99
R6324:Dchs1 UTSW 7 105,414,145 (GRCm39) missense probably benign 0.05
R6363:Dchs1 UTSW 7 105,407,679 (GRCm39) missense probably benign 0.12
R6466:Dchs1 UTSW 7 105,413,748 (GRCm39) missense probably benign 0.09
R6544:Dchs1 UTSW 7 105,407,385 (GRCm39) missense probably damaging 1.00
R6572:Dchs1 UTSW 7 105,408,013 (GRCm39) missense possibly damaging 0.94
R6579:Dchs1 UTSW 7 105,412,120 (GRCm39) missense probably benign 0.17
R6632:Dchs1 UTSW 7 105,411,085 (GRCm39) missense probably damaging 1.00
R6725:Dchs1 UTSW 7 105,408,000 (GRCm39) missense probably damaging 0.99
R6789:Dchs1 UTSW 7 105,406,210 (GRCm39) missense possibly damaging 0.61
R6868:Dchs1 UTSW 7 105,412,710 (GRCm39) missense possibly damaging 0.91
R7058:Dchs1 UTSW 7 105,406,228 (GRCm39) missense probably benign
R7064:Dchs1 UTSW 7 105,412,392 (GRCm39) missense probably damaging 0.99
R7076:Dchs1 UTSW 7 105,411,078 (GRCm39) missense probably benign 0.04
R7191:Dchs1 UTSW 7 105,414,646 (GRCm39) missense possibly damaging 0.89
R7298:Dchs1 UTSW 7 105,404,338 (GRCm39) nonsense probably null
R7380:Dchs1 UTSW 7 105,407,835 (GRCm39) missense probably benign 0.35
R7438:Dchs1 UTSW 7 105,404,155 (GRCm39) missense probably benign 0.30
R7496:Dchs1 UTSW 7 105,411,066 (GRCm39) missense probably damaging 1.00
R7534:Dchs1 UTSW 7 105,421,580 (GRCm39) missense probably benign 0.00
R7604:Dchs1 UTSW 7 105,415,189 (GRCm39) missense probably damaging 1.00
R7631:Dchs1 UTSW 7 105,408,445 (GRCm39) missense probably benign
R7821:Dchs1 UTSW 7 105,414,352 (GRCm39) missense probably benign 0.00
R7834:Dchs1 UTSW 7 105,414,774 (GRCm39) missense probably benign 0.39
R7841:Dchs1 UTSW 7 105,412,180 (GRCm39) missense probably benign
R7913:Dchs1 UTSW 7 105,408,435 (GRCm39) missense possibly damaging 0.61
R8041:Dchs1 UTSW 7 105,404,395 (GRCm39) missense probably benign 0.45
R8076:Dchs1 UTSW 7 105,411,189 (GRCm39) missense probably damaging 1.00
R8076:Dchs1 UTSW 7 105,405,128 (GRCm39) missense possibly damaging 0.52
R8087:Dchs1 UTSW 7 105,402,706 (GRCm39) missense probably benign 0.41
R8125:Dchs1 UTSW 7 105,414,089 (GRCm39) missense possibly damaging 0.91
R8223:Dchs1 UTSW 7 105,411,824 (GRCm39) missense possibly damaging 0.81
R8239:Dchs1 UTSW 7 105,414,718 (GRCm39) missense probably benign 0.22
R8476:Dchs1 UTSW 7 105,408,015 (GRCm39) missense probably benign 0.05
R8497:Dchs1 UTSW 7 105,408,168 (GRCm39) missense probably damaging 1.00
R8770:Dchs1 UTSW 7 105,420,945 (GRCm39) missense probably damaging 1.00
R8856:Dchs1 UTSW 7 105,410,064 (GRCm39) missense probably damaging 1.00
R8866:Dchs1 UTSW 7 105,404,597 (GRCm39) missense probably benign 0.00
R8948:Dchs1 UTSW 7 105,408,212 (GRCm39) missense probably benign 0.30
R8950:Dchs1 UTSW 7 105,408,212 (GRCm39) missense probably benign 0.30
R9029:Dchs1 UTSW 7 105,402,919 (GRCm39) missense probably benign 0.13
R9039:Dchs1 UTSW 7 105,405,215 (GRCm39) missense probably benign 0.11
R9081:Dchs1 UTSW 7 105,403,636 (GRCm39) missense probably benign 0.00
R9134:Dchs1 UTSW 7 105,404,910 (GRCm39) missense probably damaging 0.96
R9159:Dchs1 UTSW 7 105,415,126 (GRCm39) missense probably benign
R9162:Dchs1 UTSW 7 105,414,732 (GRCm39) missense probably damaging 1.00
R9169:Dchs1 UTSW 7 105,422,114 (GRCm39) missense probably damaging 1.00
R9262:Dchs1 UTSW 7 105,404,833 (GRCm39) missense probably damaging 1.00
R9292:Dchs1 UTSW 7 105,403,120 (GRCm39) missense probably damaging 1.00
R9325:Dchs1 UTSW 7 105,415,402 (GRCm39) missense possibly damaging 0.51
R9376:Dchs1 UTSW 7 105,414,981 (GRCm39) critical splice donor site probably null
R9392:Dchs1 UTSW 7 105,421,869 (GRCm39) missense probably benign 0.09
R9619:Dchs1 UTSW 7 105,413,662 (GRCm39) missense probably benign 0.07
R9680:Dchs1 UTSW 7 105,411,625 (GRCm39) missense probably damaging 1.00
R9687:Dchs1 UTSW 7 105,407,191 (GRCm39) missense probably damaging 0.99
R9747:Dchs1 UTSW 7 105,412,682 (GRCm39) missense probably damaging 1.00
Z1177:Dchs1 UTSW 7 105,406,900 (GRCm39) missense probably damaging 1.00
Z1177:Dchs1 UTSW 7 105,407,758 (GRCm39) missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- TGTCAACAGCCCTGGAGAAG -3'
(R):5'- TCACGGTGACAGCTATCGATG -3'

Sequencing Primer
(F):5'- TCCTGGAAAGAGGAGACAATATTTAG -3'
(R):5'- CTATCGATGGGGTAAGTAAACAGACC -3'
Posted On 2015-12-29