Mutagenetix > Incidental Mutation

Incidental Mutation 'R4784:Dchs1'

366839

Institutional Source

Beutler Lab

Gene Symbol

Dchs1

Ensembl Gene

ENSMUSG00000036862

Gene Name

dachsous cadherin related 1

Synonyms

3110041P15Rik, C130033F22Rik

MMRRC Submission

041994-MU

Accession Numbers

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R4784 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

105752990-105787654 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 105765926 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Tyrosine to Histidine at position 684 (Y684H)

Ref Sequence

ENSEMBL: ENSMUSP00000077574 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000078482]

AlphaFold

no structure available at present

Predicted Effect

probably damaging
Transcript: ENSMUST00000078482
AA Change: Y684H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000077574
Gene: ENSMUSG00000036862
AA Change: Y684H

Domain	Start	End	E-Value	Type
signal peptide	1	36	N/A	INTRINSIC
CA	58	135	5.2e-11	SMART
CA	159	247	6.1e-17	SMART
CA	271	354	2.6e-30	SMART
CA	382	464	7.8e-26	SMART
CA	489	570	1.2e-34	SMART
CA	594	677	1.9e-27	SMART
CA	701	782	5.3e-11	SMART
CA	806	886	1e-12	SMART
CA	910	990	3.3e-14	SMART
CA	1016	1097	3.6e-18	SMART
CA	1121	1203	3.1e-34	SMART
CA	1233	1307	8.8e-16	SMART
low complexity region	1323	1335	N/A	INTRINSIC
CA	1344	1427	9.9e-9	SMART
CA	1451	1537	1.5e-23	SMART
CA	1560	1640	7.2e-32	SMART
CA	1664	1742	1.8e-31	SMART
CA	1765	1846	7.8e-30	SMART
CA	1870	1951	3.7e-26	SMART
low complexity region	1957	1965	N/A	INTRINSIC
CA	1979	2059	1.1e-6	SMART
CA	2083	2162	2.7e-18	SMART
CA	2186	2268	2.2e-26	SMART
CA	2291	2367	1e-18	SMART
CA	2391	2473	1.8e-23	SMART
CA	2497	2593	3.5e-21	SMART
CA	2617	2697	1.2e-25	SMART
CA	2721	2804	1.9e-18	SMART
CA	2828	2919	3e-3	SMART
transmembrane domain	2932	2954	N/A	INTRINSIC
low complexity region	3001	3017	N/A	INTRINSIC
low complexity region	3046	3055	N/A	INTRINSIC
low complexity region	3088	3097	N/A	INTRINSIC
low complexity region	3185	3196	N/A	INTRINSIC
low complexity region	3237	3259	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000131504

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000154659

Coding Region Coverage

1x: 99.2%
3x: 98.5%
10x: 96.9%
20x: 94.3%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of the cadherin superfamily whose members encode calcium-dependent cell-cell adhesion molecules. The encoded protein has a signal peptide, 27 cadherin repeat domains and a unique cytoplasmic region. This particular cadherin family member is expressed in fibroblasts but not in melanocytes or keratinocytes. The cell-cell adhesion of fibroblasts is thought to be necessary for wound healing. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit postnatal lethality, growth retardation, small lungs, abnormal cochlea morphology, abnormal kidney morphology, cardiovascular abnormalities and skeletal abnormalities. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 106 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Adra1a	T	A	14: 66,637,824	S83T	probably damaging	Het
Aff1	T	A	5: 103,847,039	Y1034*	probably null	Het
Ago3	A	T	4: 126,368,503	M418K	probably benign	Het
Alpk1	G	T	3: 127,687,592	N175K	possibly damaging	Het
Als2	A	G	1: 59,215,313	V295A	probably benign	Het
Arhgap32	A	G	9: 32,129,653	D67G	probably damaging	Het
Arhgap32	T	C	9: 32,260,780	C1619R	probably damaging	Het
Asns	T	G	6: 7,678,029	K350Q	probably benign	Het
Atp8b5	A	T	4: 43,356,980	D576V	probably damaging	Het
Atrnl1	A	G	19: 57,629,158	I122V	probably damaging	Het
Baz1b	T	G	5: 135,217,413	L572R	possibly damaging	Het
C4b	T	C	17: 34,733,406	T1220A	probably benign	Het
Carmil3	T	C	14: 55,501,321		probably null	Het
Ccndbp1	A	T	2: 121,008,522	T5S	probably benign	Het
Chaf1b	T	C	16: 93,884,542	V16A	probably damaging	Het
Chd8	C	A	14: 52,205,368	C575F	probably damaging	Het
Chrna10	G	A	7: 102,113,219	P255S	possibly damaging	Het
Clip1	T	C	5: 123,579,293	D1387G	probably damaging	Het
Col12a1	C	A	9: 79,678,494	V1228F	possibly damaging	Het
Cxcr5	T	C	9: 44,513,341	T340A	probably benign	Het
Cyp2e1	G	A	7: 140,763,908	V20I	possibly damaging	Het
Dcun1d3	T	C	7: 119,857,664	E275G	probably damaging	Het
Dgcr8	G	A	16: 18,258,310	R4*	probably null	Het
Dglucy	A	T	12: 100,838,664	D168V	probably damaging	Het
Dnah1	T	A	14: 31,263,479	K3818N	probably damaging	Het
Dnajc17	T	C	2: 119,179,428	D239G	probably benign	Het
Dok2	C	T	14: 70,777,874	P347L	probably benign	Het
Elavl2	T	C	4: 91,254,142	R265G	probably null	Het
Elf1	T	A	14: 79,580,743	N567K	probably benign	Het
Epha8	A	T	4: 136,933,322	I695N	probably damaging	Het
Fam103a1	T	A	7: 81,768,415	W73R	probably damaging	Het
Fam178b	C	A	1: 36,632,415		probably null	Het
Fam76a	A	T	4: 132,902,117		probably null	Het
Fam76a	A	G	4: 132,916,190	Y78H	probably damaging	Het
Fbn1	A	T	2: 125,324,919	C2026S	probably damaging	Het
Fbxo4	T	C	15: 3,969,041	T312A	probably benign	Het
Fscn2	T	C	11: 120,367,987	F453L	possibly damaging	Het
Gabrb2	T	C	11: 42,597,642	C312R	probably damaging	Het
Gba2	A	C	4: 43,568,315	L684R	probably damaging	Het
Golga2	T	A	2: 32,297,156	N89K	probably damaging	Het
Gpx6	C	T	13: 21,312,264	Q3*	probably null	Het
Grin1	T	A	2: 25,292,381	H956L	possibly damaging	Het
H2-Q7	T	G	17: 35,439,938	C122G	probably damaging	Het
Hcar2	C	G	5: 123,864,450	G330A	probably benign	Het
Hes3	A	G	4: 152,287,832	S37P	probably damaging	Het
Hs3st3b1	T	C	11: 63,889,260	H347R	probably benign	Het
Il1rl1	A	G	1: 40,450,188	R367G	probably damaging	Het
Kcnc1	G	T	7: 46,437,287	S570I	probably benign	Het
Kctd3	T	C	1: 188,974,468	I523M	probably damaging	Het
Klk14	G	A	7: 43,692,077	C51Y	probably damaging	Het
Kntc1	T	G	5: 123,816,762	M2081R	possibly damaging	Het
Krt83	A	G	15: 101,487,956	S253P	probably damaging	Het
Ktn1	T	A	14: 47,693,496		probably null	Het
Lair1	T	A	7: 4,009,732	M251L	probably benign	Het
Lama3	A	T	18: 12,449,544	H631L	probably benign	Het
Lamc1	T	C	1: 153,231,740	N1231S	probably damaging	Het
Lin54	A	G	5: 100,459,738	I250T	probably damaging	Het
Lrit1	C	T	14: 37,062,236	T507M	possibly damaging	Het
Lrp11	A	G	10: 7,604,201	H345R	possibly damaging	Het
Lrp6	A	C	6: 134,479,539	S921A	probably benign	Het
Lrrc27	A	G	7: 139,242,698	T502A	probably benign	Het
Marf1	A	C	16: 14,152,457	S133A	probably benign	Het
Mga	C	T	2: 119,903,057	P129S	probably damaging	Het
Mgat4e	T	C	1: 134,541,325	N327S	probably damaging	Het
Mlh1	A	G	9: 111,239,798	Y499H	probably benign	Het
Mrgpra1	A	G	7: 47,335,470	S154P	probably damaging	Het
Myo1h	A	G	5: 114,360,599	I919V	possibly damaging	Het
Naalad2	T	C	9: 18,350,918	R442G	probably damaging	Het
Nat8f4	T	C	6: 85,901,499	H14R	probably benign	Het
Nav1	A	G	1: 135,458,739	S1184P	probably damaging	Het
Nckap1	T	A	2: 80,506,934	N986I	probably benign	Het
Ndufaf2	C	G	13: 108,052,780	A145P	probably damaging	Het
Nop9	AGAGGAGGAGGAGGAGGA	AGAGGAGGAGGAGGA	14: 55,746,402		probably benign	Het
Nphp4	G	A	4: 152,554,546	R878K	probably benign	Het
Nutm1	G	A	2: 112,248,936	A878V	probably benign	Het
Olfr1305	A	T	2: 111,873,050	D268E	possibly damaging	Het
Olfr172	G	T	16: 58,760,548	F209L	probably damaging	Het
Olfr675	A	C	7: 105,024,530	I150S	probably damaging	Het
Orc6	T	A	8: 85,302,950	I41K	probably damaging	Het
Pikfyve	A	G	1: 65,267,846	T1798A	probably benign	Het
Ppp1r14a	A	T	7: 29,292,061	E98V	possibly damaging	Het
Pqlc2	G	T	4: 139,300,001	H343Q	probably benign	Het
Prpf8	T	A	11: 75,492,505	D521E	probably damaging	Het
Pudp	A	G	18: 50,568,065	V199A	probably damaging	Het
Rab3c	T	C	13: 110,061,900	E198G	probably benign	Het
Rbl2	A	G	8: 91,085,568	Y255C	probably damaging	Het
Rbm12	T	C	2: 156,096,564	D596G	possibly damaging	Het
Sipa1l3	A	G	7: 29,377,641	V902A	probably damaging	Het
Slc37a3	T	G	6: 39,337,223	Q485P	probably benign	Het
Slc44a3	T	C	3: 121,527,074	T93A	possibly damaging	Het
Sun3	G	A	11: 9,038,266	L19F	probably benign	Het
Tas2r125	A	G	6: 132,909,903	I85V	probably benign	Het
Tenm4	A	C	7: 96,774,046	K683Q	probably damaging	Het
Tmprss11d	C	T	5: 86,306,281	V222M	probably damaging	Het
Tnip1	A	C	11: 54,915,539	S570A	possibly damaging	Het
Top1mt	G	A	15: 75,657,703	P554S	probably damaging	Het
Top1mt	A	G	15: 75,676,031	F69L	possibly damaging	Het
Ttc7	A	G	17: 87,340,897	K508R	probably benign	Het
Ttll4	A	T	1: 74,679,007	T6S	possibly damaging	Het
Xpo5	T	C	17: 46,222,717	Y500H	possibly damaging	Het
Xpot	C	T	10: 121,615,063		probably null	Het
Zbbx	T	C	3: 75,085,041	I268V	probably benign	Het
Zbtb40	G	A	4: 137,007,097	P360S	probably damaging	Het
Zfp324	T	C	7: 12,971,306	L474P	probably damaging	Het
Zfp398	A	G	6: 47,840,252	T9A	probably benign	Het
Zfp692	A	C	11: 58,310,171	S293R	probably null	Het

Other mutations in Dchs1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00235:Dchs1	APN	7	105758743	missense	probably damaging	1.00
IGL00422:Dchs1	APN	7	105758029	missense	possibly damaging	0.88
IGL00427:Dchs1	APN	7	105758424	missense	probably damaging	0.98
IGL00469:Dchs1	APN	7	105755261	missense	probably damaging	1.00
IGL00470:Dchs1	APN	7	105758207	missense	probably damaging	1.00
IGL00534:Dchs1	APN	7	105757943	missense	probably benign
IGL01292:Dchs1	APN	7	105760891	missense	probably damaging	0.98
IGL01380:Dchs1	APN	7	105762211	missense	probably damaging	1.00
IGL01396:Dchs1	APN	7	105772283	missense	probably damaging	1.00
IGL01448:Dchs1	APN	7	105771927	missense	probably damaging	0.98
IGL01759:Dchs1	APN	7	105755302	missense	probably benign	0.00
IGL01829:Dchs1	APN	7	105755397	missense	probably damaging	0.99
IGL01946:Dchs1	APN	7	105759105	missense	probably damaging	1.00
IGL01955:Dchs1	APN	7	105757591	missense	probably benign	0.00
IGL02012:Dchs1	APN	7	105764297	missense	probably damaging	0.98
IGL02222:Dchs1	APN	7	105764887	missense	probably damaging	1.00
IGL02261:Dchs1	APN	7	105772569	missense	probably damaging	1.00
IGL02365:Dchs1	APN	7	105755188	missense	probably benign	0.22
IGL02430:Dchs1	APN	7	105771971	missense	probably benign	0.34
IGL02500:Dchs1	APN	7	105755806	missense	probably benign
IGL02741:Dchs1	APN	7	105757323	missense	probably damaging	1.00
IGL02890:Dchs1	APN	7	105756491	missense	probably damaging	1.00
IGL03213:Dchs1	APN	7	105755072	missense	probably damaging	1.00
G1patch:Dchs1	UTSW	7	105758793	missense	probably damaging	0.99
P0026:Dchs1	UTSW	7	105758405	missense	probably damaging	0.99
PIT4377001:Dchs1	UTSW	7	105757588	missense	probably damaging	1.00
PIT4791001:Dchs1	UTSW	7	105758971	missense	probably damaging	1.00
R0013:Dchs1	UTSW	7	105755836	missense	possibly damaging	0.90
R0090:Dchs1	UTSW	7	105755932	missense	probably benign	0.18
R0091:Dchs1	UTSW	7	105766094	splice site	probably benign
R0193:Dchs1	UTSW	7	105764983	missense	probably benign	0.40
R0395:Dchs1	UTSW	7	105758538	missense	probably damaging	1.00
R0448:Dchs1	UTSW	7	105765927	missense	probably benign	0.00
R0480:Dchs1	UTSW	7	105771489	missense	probably benign	0.14
R0485:Dchs1	UTSW	7	105772727	missense	probably benign	0.00
R0566:Dchs1	UTSW	7	105759195	missense	probably benign	0.00
R0571:Dchs1	UTSW	7	105771996	missense	probably damaging	1.00
R0573:Dchs1	UTSW	7	105758778	missense	probably damaging	0.98
R0577:Dchs1	UTSW	7	105764255	missense	possibly damaging	0.78
R0622:Dchs1	UTSW	7	105763449	missense	probably damaging	1.00
R0654:Dchs1	UTSW	7	105772349	missense	probably damaging	1.00
R0677:Dchs1	UTSW	7	105764984	missense	probably damaging	1.00
R1171:Dchs1	UTSW	7	105757714	missense	probably benign
R1241:Dchs1	UTSW	7	105758178	missense	probably damaging	1.00
R1389:Dchs1	UTSW	7	105755571	missense	probably benign	0.40
R1427:Dchs1	UTSW	7	105766191	missense	probably benign	0.06
R1458:Dchs1	UTSW	7	105755244	missense	probably damaging	1.00
R1513:Dchs1	UTSW	7	105772071	nonsense	probably null
R1524:Dchs1	UTSW	7	105764525	missense	probably damaging	1.00
R1525:Dchs1	UTSW	7	105758931	missense	probably damaging	1.00
R1534:Dchs1	UTSW	7	105772040	missense	probably damaging	0.98
R1567:Dchs1	UTSW	7	105771861	missense	probably benign	0.01
R1577:Dchs1	UTSW	7	105765955	missense	probably damaging	1.00
R1603:Dchs1	UTSW	7	105762770	missense	probably benign	0.24
R1676:Dchs1	UTSW	7	105754921	missense	probably benign	0.40
R1794:Dchs1	UTSW	7	105771720	missense	probably benign	0.02
R1826:Dchs1	UTSW	7	105757627	missense	probably damaging	1.00
R1892:Dchs1	UTSW	7	105764156	missense	probably benign	0.00
R1924:Dchs1	UTSW	7	105772280	missense	possibly damaging	0.81
R1932:Dchs1	UTSW	7	105765902	missense	probably damaging	1.00
R1962:Dchs1	UTSW	7	105764201	missense	probably damaging	1.00
R1985:Dchs1	UTSW	7	105772398	missense	possibly damaging	0.72
R1993:Dchs1	UTSW	7	105762548	missense	probably benign	0.00
R2007:Dchs1	UTSW	7	105755325	missense	probably damaging	1.00
R2316:Dchs1	UTSW	7	105764204	missense	possibly damaging	0.71
R2351:Dchs1	UTSW	7	105754094	missense	probably benign
R2474:Dchs1	UTSW	7	105755074	missense	probably benign	0.37
R2474:Dchs1	UTSW	7	105772838	missense	probably damaging	1.00
R3429:Dchs1	UTSW	7	105756504	missense	possibly damaging	0.85
R3430:Dchs1	UTSW	7	105756504	missense	possibly damaging	0.85
R3737:Dchs1	UTSW	7	105762316	missense	possibly damaging	0.88
R3767:Dchs1	UTSW	7	105757085	missense	possibly damaging	0.67
R3874:Dchs1	UTSW	7	105761635	missense	probably damaging	1.00
R3883:Dchs1	UTSW	7	105762563	missense	probably damaging	1.00
R4105:Dchs1	UTSW	7	105765140	missense	probably damaging	1.00
R4209:Dchs1	UTSW	7	105766190	missense	probably damaging	0.99
R4329:Dchs1	UTSW	7	105753759	missense	probably damaging	1.00
R4516:Dchs1	UTSW	7	105754852	missense	probably damaging	1.00
R4579:Dchs1	UTSW	7	105754765	missense	probably damaging	1.00
R4579:Dchs1	UTSW	7	105758973	missense	probably benign
R4588:Dchs1	UTSW	7	105756041	missense	probably benign
R4613:Dchs1	UTSW	7	105772724	missense	probably damaging	1.00
R4632:Dchs1	UTSW	7	105754355	missense	probably benign	0.02
R4696:Dchs1	UTSW	7	105764627	missense	probably damaging	1.00
R4725:Dchs1	UTSW	7	105755253	missense	probably damaging	0.98
R4725:Dchs1	UTSW	7	105765552	missense	probably damaging	1.00
R4738:Dchs1	UTSW	7	105758673	missense	probably damaging	0.96
R4768:Dchs1	UTSW	7	105771620	missense	possibly damaging	0.96
R4864:Dchs1	UTSW	7	105755253	missense	probably damaging	0.98
R4880:Dchs1	UTSW	7	105755730	missense	probably benign	0.00
R4909:Dchs1	UTSW	7	105766255	missense	probably damaging	1.00
R5102:Dchs1	UTSW	7	105772177	missense	probably benign	0.09
R5109:Dchs1	UTSW	7	105765014	missense	probably benign
R5126:Dchs1	UTSW	7	105753517	missense	probably damaging	1.00
R5149:Dchs1	UTSW	7	105755658	missense	probably damaging	0.98
R5330:Dchs1	UTSW	7	105754602	missense	probably damaging	1.00
R5384:Dchs1	UTSW	7	105758029	missense	probably damaging	1.00
R5384:Dchs1	UTSW	7	105772055	missense	probably damaging	1.00
R5386:Dchs1	UTSW	7	105758029	missense	probably damaging	1.00
R5622:Dchs1	UTSW	7	105755293	missense	probably benign	0.11
R5623:Dchs1	UTSW	7	105772769	missense	probably damaging	1.00
R5708:Dchs1	UTSW	7	105772809	missense	probably damaging	1.00
R5718:Dchs1	UTSW	7	105755748	missense	probably benign	0.01
R5743:Dchs1	UTSW	7	105771596	missense	probably benign
R5759:Dchs1	UTSW	7	105764176	missense	probably damaging	0.99
R5772:Dchs1	UTSW	7	105773040	missense	probably damaging	1.00
R5860:Dchs1	UTSW	7	105772035	missense	probably damaging	1.00
R5916:Dchs1	UTSW	7	105759166	missense	probably damaging	1.00
R5965:Dchs1	UTSW	7	105755925	missense	probably damaging	1.00
R5997:Dchs1	UTSW	7	105754095	missense	probably benign	0.08
R6065:Dchs1	UTSW	7	105755421	missense	probably damaging	1.00
R6136:Dchs1	UTSW	7	105760925	missense	probably benign
R6137:Dchs1	UTSW	7	105765106	missense	probably damaging	0.99
R6324:Dchs1	UTSW	7	105764938	missense	probably benign	0.05
R6363:Dchs1	UTSW	7	105758472	missense	probably benign	0.12
R6466:Dchs1	UTSW	7	105764541	missense	probably benign	0.09
R6544:Dchs1	UTSW	7	105758178	missense	probably damaging	1.00
R6572:Dchs1	UTSW	7	105758806	missense	possibly damaging	0.94
R6579:Dchs1	UTSW	7	105762913	missense	probably benign	0.17
R6632:Dchs1	UTSW	7	105761878	missense	probably damaging	1.00
R6725:Dchs1	UTSW	7	105758793	missense	probably damaging	0.99
R6789:Dchs1	UTSW	7	105757003	missense	possibly damaging	0.61
R6868:Dchs1	UTSW	7	105763503	missense	possibly damaging	0.91
R7058:Dchs1	UTSW	7	105757021	missense	probably benign
R7064:Dchs1	UTSW	7	105763185	missense	probably damaging	0.99
R7076:Dchs1	UTSW	7	105761871	missense	probably benign	0.04
R7191:Dchs1	UTSW	7	105765439	missense	possibly damaging	0.89
R7298:Dchs1	UTSW	7	105755131	nonsense	probably null
R7380:Dchs1	UTSW	7	105758628	missense	probably benign	0.35
R7438:Dchs1	UTSW	7	105754948	missense	probably benign	0.30
R7496:Dchs1	UTSW	7	105761859	missense	probably damaging	1.00
R7534:Dchs1	UTSW	7	105772373	missense	probably benign	0.00
R7604:Dchs1	UTSW	7	105765982	missense	probably damaging	1.00
R7631:Dchs1	UTSW	7	105759238	missense	probably benign
R7821:Dchs1	UTSW	7	105765145	missense	probably benign	0.00
R7834:Dchs1	UTSW	7	105765567	missense	probably benign	0.39
R7841:Dchs1	UTSW	7	105762973	missense	probably benign
R7913:Dchs1	UTSW	7	105759228	missense	possibly damaging	0.61
R8041:Dchs1	UTSW	7	105755188	missense	probably benign	0.45
R8076:Dchs1	UTSW	7	105755921	missense	possibly damaging	0.52
R8076:Dchs1	UTSW	7	105761982	missense	probably damaging	1.00
R8087:Dchs1	UTSW	7	105753499	missense	probably benign	0.41
R8125:Dchs1	UTSW	7	105764882	missense	possibly damaging	0.91
R8223:Dchs1	UTSW	7	105762617	missense	possibly damaging	0.81
R8239:Dchs1	UTSW	7	105765511	missense	probably benign	0.22
R8476:Dchs1	UTSW	7	105758808	missense	probably benign	0.05
R8497:Dchs1	UTSW	7	105758961	missense	probably damaging	1.00
R8770:Dchs1	UTSW	7	105771738	missense	probably damaging	1.00
R8856:Dchs1	UTSW	7	105760857	missense	probably damaging	1.00
R8866:Dchs1	UTSW	7	105755390	missense	probably benign	0.00
R8948:Dchs1	UTSW	7	105759005	missense	probably benign	0.30
R8950:Dchs1	UTSW	7	105759005	missense	probably benign	0.30
R9029:Dchs1	UTSW	7	105753712	missense	probably benign	0.13
R9039:Dchs1	UTSW	7	105756008	missense	probably benign	0.11
R9081:Dchs1	UTSW	7	105754429	missense	probably benign	0.00
R9134:Dchs1	UTSW	7	105755703	missense	probably damaging	0.96
R9159:Dchs1	UTSW	7	105765919	missense	probably benign
R9162:Dchs1	UTSW	7	105765525	missense	probably damaging	1.00
R9169:Dchs1	UTSW	7	105772907	missense	probably damaging	1.00
R9262:Dchs1	UTSW	7	105755626	missense	probably damaging	1.00
R9292:Dchs1	UTSW	7	105753913	missense	probably damaging	1.00
R9325:Dchs1	UTSW	7	105766195	missense	possibly damaging	0.51
R9376:Dchs1	UTSW	7	105765774	critical splice donor site	probably null
R9392:Dchs1	UTSW	7	105772662	missense	probably benign	0.09
R9619:Dchs1	UTSW	7	105764455	missense	probably benign	0.07
R9680:Dchs1	UTSW	7	105762418	missense	probably damaging	1.00
R9687:Dchs1	UTSW	7	105757984	missense	probably damaging	0.99
R9747:Dchs1	UTSW	7	105763475	missense	probably damaging	1.00
Z1177:Dchs1	UTSW	7	105757693	missense	probably damaging	1.00
Z1177:Dchs1	UTSW	7	105758551	missense	probably benign	0.00

Predicted Primers

PCR Primer
(F):5'- TGTCAACAGCCCTGGAGAAG -3'
(R):5'- TCACGGTGACAGCTATCGATG -3'

Sequencing Primer
(F):5'- TCCTGGAAAGAGGAGACAATATTTAG -3'
(R):5'- CTATCGATGGGGTAAGTAAACAGACC -3'

Posted On

2015-12-29