Mutagenetix > Incidental Mutation

Incidental Mutation 'R4784:Atrnl1'

366890

Institutional Source

Beutler Lab

Gene Symbol

Atrnl1

Ensembl Gene

ENSMUSG00000054843

Gene Name

attractin like 1

Synonyms

Alp

MMRRC Submission

041994-MU

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.210) question?

Stock #

R4784 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

57611034-58133338 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 57629158 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Isoleucine to Valine at position 122 (I122V)

Ref Sequence

ENSEMBL: ENSMUSP00000076514 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000077282]

AlphaFold

Q6A051

Predicted Effect

probably damaging
Transcript: ENSMUST00000077282
AA Change: I122V

PolyPhen 2 Score 0.974 (Sensitivity: 0.76; Specificity: 0.96)

SMART Domains

Protein: ENSMUSP00000076514
Gene: ENSMUSG00000054843
AA Change: I122V

Domain	Start	End	E-Value	Type
low complexity region	25	32	N/A	INTRINSIC
EGF	61	90	5.71e-1	SMART
CUB	92	208	1.43e-11	SMART
EGF	209	244	1.95e1	SMART
Pfam:EGF_2	248	279	5.8e-7	PFAM
Pfam:Kelch_5	350	391	2.1e-9	PFAM
Pfam:Kelch_6	354	401	5.8e-8	PFAM
Pfam:Kelch_4	465	517	4.3e-7	PFAM
Pfam:Kelch_1	519	573	2.7e-6	PFAM
PSI	613	656	3.38e-1	SMART
PSI	665	708	2e-3	SMART
PSI	714	759	1.72e-2	SMART
CLECT	747	872	2.86e-20	SMART
PSI	888	938	6.26e-5	SMART
PSI	941	1011	1.73e-7	SMART
EGF_Lam	1013	1056	1.07e-5	SMART
low complexity region	1157	1173	N/A	INTRINSIC
transmembrane domain	1229	1251	N/A	INTRINSIC
low complexity region	1261	1272	N/A	INTRINSIC
low complexity region	1326	1339	N/A	INTRINSIC

Coding Region Coverage

1x: 99.2%
3x: 98.5%
10x: 96.9%
20x: 94.3%

Validation Efficiency

MGI Phenotype

PHENOTYPE: Mice homozygous for a null allele exhibit normal coat coloring and normal brain morphology. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 106 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Adra1a	T	A	14: 66,637,824	S83T	probably damaging	Het
Aff1	T	A	5: 103,847,039	Y1034*	probably null	Het
Ago3	A	T	4: 126,368,503	M418K	probably benign	Het
Alpk1	G	T	3: 127,687,592	N175K	possibly damaging	Het
Als2	A	G	1: 59,215,313	V295A	probably benign	Het
Arhgap32	A	G	9: 32,129,653	D67G	probably damaging	Het
Arhgap32	T	C	9: 32,260,780	C1619R	probably damaging	Het
Asns	T	G	6: 7,678,029	K350Q	probably benign	Het
Atp8b5	A	T	4: 43,356,980	D576V	probably damaging	Het
Baz1b	T	G	5: 135,217,413	L572R	possibly damaging	Het
C4b	T	C	17: 34,733,406	T1220A	probably benign	Het
Carmil3	T	C	14: 55,501,321		probably null	Het
Ccndbp1	A	T	2: 121,008,522	T5S	probably benign	Het
Chaf1b	T	C	16: 93,884,542	V16A	probably damaging	Het
Chd8	C	A	14: 52,205,368	C575F	probably damaging	Het
Chrna10	G	A	7: 102,113,219	P255S	possibly damaging	Het
Clip1	T	C	5: 123,579,293	D1387G	probably damaging	Het
Col12a1	C	A	9: 79,678,494	V1228F	possibly damaging	Het
Cxcr5	T	C	9: 44,513,341	T340A	probably benign	Het
Cyp2e1	G	A	7: 140,763,908	V20I	possibly damaging	Het
Dchs1	A	G	7: 105,765,926	Y684H	probably damaging	Het
Dcun1d3	T	C	7: 119,857,664	E275G	probably damaging	Het
Dgcr8	G	A	16: 18,258,310	R4*	probably null	Het
Dglucy	A	T	12: 100,838,664	D168V	probably damaging	Het
Dnah1	T	A	14: 31,263,479	K3818N	probably damaging	Het
Dnajc17	T	C	2: 119,179,428	D239G	probably benign	Het
Dok2	C	T	14: 70,777,874	P347L	probably benign	Het
Elavl2	T	C	4: 91,254,142	R265G	probably null	Het
Elf1	T	A	14: 79,580,743	N567K	probably benign	Het
Epha8	A	T	4: 136,933,322	I695N	probably damaging	Het
Fam103a1	T	A	7: 81,768,415	W73R	probably damaging	Het
Fam178b	C	A	1: 36,632,415		probably null	Het
Fam76a	A	T	4: 132,902,117		probably null	Het
Fam76a	A	G	4: 132,916,190	Y78H	probably damaging	Het
Fbn1	A	T	2: 125,324,919	C2026S	probably damaging	Het
Fbxo4	T	C	15: 3,969,041	T312A	probably benign	Het
Fscn2	T	C	11: 120,367,987	F453L	possibly damaging	Het
Gabrb2	T	C	11: 42,597,642	C312R	probably damaging	Het
Gba2	A	C	4: 43,568,315	L684R	probably damaging	Het
Golga2	T	A	2: 32,297,156	N89K	probably damaging	Het
Gpx6	C	T	13: 21,312,264	Q3*	probably null	Het
Grin1	T	A	2: 25,292,381	H956L	possibly damaging	Het
H2-Q7	T	G	17: 35,439,938	C122G	probably damaging	Het
Hcar2	C	G	5: 123,864,450	G330A	probably benign	Het
Hes3	A	G	4: 152,287,832	S37P	probably damaging	Het
Hs3st3b1	T	C	11: 63,889,260	H347R	probably benign	Het
Il1rl1	A	G	1: 40,450,188	R367G	probably damaging	Het
Kcnc1	G	T	7: 46,437,287	S570I	probably benign	Het
Kctd3	T	C	1: 188,974,468	I523M	probably damaging	Het
Klk14	G	A	7: 43,692,077	C51Y	probably damaging	Het
Kntc1	T	G	5: 123,816,762	M2081R	possibly damaging	Het
Krt83	A	G	15: 101,487,956	S253P	probably damaging	Het
Ktn1	T	A	14: 47,693,496		probably null	Het
Lair1	T	A	7: 4,009,732	M251L	probably benign	Het
Lama3	A	T	18: 12,449,544	H631L	probably benign	Het
Lamc1	T	C	1: 153,231,740	N1231S	probably damaging	Het
Lin54	A	G	5: 100,459,738	I250T	probably damaging	Het
Lrit1	C	T	14: 37,062,236	T507M	possibly damaging	Het
Lrp11	A	G	10: 7,604,201	H345R	possibly damaging	Het
Lrp6	A	C	6: 134,479,539	S921A	probably benign	Het
Lrrc27	A	G	7: 139,242,698	T502A	probably benign	Het
Marf1	A	C	16: 14,152,457	S133A	probably benign	Het
Mga	C	T	2: 119,903,057	P129S	probably damaging	Het
Mgat4e	T	C	1: 134,541,325	N327S	probably damaging	Het
Mlh1	A	G	9: 111,239,798	Y499H	probably benign	Het
Mrgpra1	A	G	7: 47,335,470	S154P	probably damaging	Het
Myo1h	A	G	5: 114,360,599	I919V	possibly damaging	Het
Naalad2	T	C	9: 18,350,918	R442G	probably damaging	Het
Nat8f4	T	C	6: 85,901,499	H14R	probably benign	Het
Nav1	A	G	1: 135,458,739	S1184P	probably damaging	Het
Nckap1	T	A	2: 80,506,934	N986I	probably benign	Het
Ndufaf2	C	G	13: 108,052,780	A145P	probably damaging	Het
Nop9	AGAGGAGGAGGAGGAGGA	AGAGGAGGAGGAGGA	14: 55,746,402		probably benign	Het
Nphp4	G	A	4: 152,554,546	R878K	probably benign	Het
Nutm1	G	A	2: 112,248,936	A878V	probably benign	Het
Olfr1305	A	T	2: 111,873,050	D268E	possibly damaging	Het
Olfr172	G	T	16: 58,760,548	F209L	probably damaging	Het
Olfr675	A	C	7: 105,024,530	I150S	probably damaging	Het
Orc6	T	A	8: 85,302,950	I41K	probably damaging	Het
Pikfyve	A	G	1: 65,267,846	T1798A	probably benign	Het
Ppp1r14a	A	T	7: 29,292,061	E98V	possibly damaging	Het
Pqlc2	G	T	4: 139,300,001	H343Q	probably benign	Het
Prpf8	T	A	11: 75,492,505	D521E	probably damaging	Het
Pudp	A	G	18: 50,568,065	V199A	probably damaging	Het
Rab3c	T	C	13: 110,061,900	E198G	probably benign	Het
Rbl2	A	G	8: 91,085,568	Y255C	probably damaging	Het
Rbm12	T	C	2: 156,096,564	D596G	possibly damaging	Het
Sipa1l3	A	G	7: 29,377,641	V902A	probably damaging	Het
Slc37a3	T	G	6: 39,337,223	Q485P	probably benign	Het
Slc44a3	T	C	3: 121,527,074	T93A	possibly damaging	Het
Sun3	G	A	11: 9,038,266	L19F	probably benign	Het
Tas2r125	A	G	6: 132,909,903	I85V	probably benign	Het
Tenm4	A	C	7: 96,774,046	K683Q	probably damaging	Het
Tmprss11d	C	T	5: 86,306,281	V222M	probably damaging	Het
Tnip1	A	C	11: 54,915,539	S570A	possibly damaging	Het
Top1mt	G	A	15: 75,657,703	P554S	probably damaging	Het
Top1mt	A	G	15: 75,676,031	F69L	possibly damaging	Het
Ttc7	A	G	17: 87,340,897	K508R	probably benign	Het
Ttll4	A	T	1: 74,679,007	T6S	possibly damaging	Het
Xpo5	T	C	17: 46,222,717	Y500H	possibly damaging	Het
Xpot	C	T	10: 121,615,063		probably null	Het
Zbbx	T	C	3: 75,085,041	I268V	probably benign	Het
Zbtb40	G	A	4: 137,007,097	P360S	probably damaging	Het
Zfp324	T	C	7: 12,971,306	L474P	probably damaging	Het
Zfp398	A	G	6: 47,840,252	T9A	probably benign	Het
Zfp692	A	C	11: 58,310,171	S293R	probably null	Het

Other mutations in Atrnl1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00323:Atrnl1	APN	19	57691817	missense	probably benign	0.02
IGL00707:Atrnl1	APN	19	57673265	missense	probably damaging	0.96
IGL00921:Atrnl1	APN	19	57702153	missense	probably damaging	1.00
IGL01410:Atrnl1	APN	19	58131104	missense	probably damaging	1.00
IGL01468:Atrnl1	APN	19	57699712	missense	probably benign	0.02
IGL01756:Atrnl1	APN	19	57652948	missense	probably benign
IGL01971:Atrnl1	APN	19	57753283	missense	probably damaging	1.00
IGL02019:Atrnl1	APN	19	57691763	splice site	probably benign
IGL02580:Atrnl1	APN	19	57714576	splice site	probably benign
IGL02649:Atrnl1	APN	19	57650441	splice site	probably benign
IGL02676:Atrnl1	APN	19	57691884	missense	probably damaging	1.00
IGL03276:Atrnl1	APN	19	57652927	missense	probably damaging	0.99
IGL03379:Atrnl1	APN	19	57642541	missense	probably benign	0.02
Magnetogorsk	UTSW	19	57630306	missense	probably damaging	1.00
polar	UTSW	19	57652950	missense	probably benign	0.00
PIT4812001:Atrnl1	UTSW	19	57731623	missense	probably benign	0.08
R0109:Atrnl1	UTSW	19	57755517	missense	possibly damaging	0.78
R0308:Atrnl1	UTSW	19	57753288	missense	probably benign	0.04
R0394:Atrnl1	UTSW	19	57673176	missense	probably benign	0.10
R0734:Atrnl1	UTSW	19	57654861	missense	probably damaging	1.00
R0811:Atrnl1	UTSW	19	57673141	missense	probably benign	0.07
R0812:Atrnl1	UTSW	19	57673141	missense	probably benign	0.07
R1183:Atrnl1	UTSW	19	57650293	missense	probably damaging	0.97
R1213:Atrnl1	UTSW	19	57638462	missense	probably benign	0.25
R1344:Atrnl1	UTSW	19	57935705	critical splice donor site	probably null
R1418:Atrnl1	UTSW	19	57935705	critical splice donor site	probably null
R1707:Atrnl1	UTSW	19	57686737	missense	probably benign	0.00
R1748:Atrnl1	UTSW	19	57714702	missense	probably damaging	0.99
R2051:Atrnl1	UTSW	19	57691849	missense	probably benign	0.01
R2113:Atrnl1	UTSW	19	57755616	nonsense	probably null
R2130:Atrnl1	UTSW	19	57654994	missense	probably damaging	1.00
R3710:Atrnl1	UTSW	19	57657114	missense	probably damaging	1.00
R3916:Atrnl1	UTSW	19	57935652	missense	possibly damaging	0.82
R4524:Atrnl1	UTSW	19	57630306	missense	probably damaging	1.00
R4707:Atrnl1	UTSW	19	57629158	missense	probably damaging	0.97
R4712:Atrnl1	UTSW	19	57652950	missense	probably benign	0.00
R4785:Atrnl1	UTSW	19	57629158	missense	probably damaging	0.97
R4798:Atrnl1	UTSW	19	58042361	missense	probably benign
R5172:Atrnl1	UTSW	19	57685513	nonsense	probably null
R5226:Atrnl1	UTSW	19	57650335	missense	probably benign
R5289:Atrnl1	UTSW	19	57657082	missense	probably damaging	1.00
R5372:Atrnl1	UTSW	19	57755536	missense	probably benign
R5737:Atrnl1	UTSW	19	57777888	missense	possibly damaging	0.84
R5782:Atrnl1	UTSW	19	57753286	missense	possibly damaging	0.95
R5826:Atrnl1	UTSW	19	57630292	nonsense	probably null
R6169:Atrnl1	UTSW	19	57642463	missense	probably benign	0.00
R6242:Atrnl1	UTSW	19	57642478	missense	probably benign	0.02
R6342:Atrnl1	UTSW	19	57638510	missense	probably damaging	1.00
R6372:Atrnl1	UTSW	19	57650332	missense	probably benign	0.01
R6811:Atrnl1	UTSW	19	57654961	missense	probably damaging	0.98
R6897:Atrnl1	UTSW	19	58042368	missense	probably benign	0.01
R7024:Atrnl1	UTSW	19	57638450	critical splice acceptor site	probably null
R7085:Atrnl1	UTSW	19	57691857	missense	probably damaging	1.00
R7144:Atrnl1	UTSW	19	58042352	missense	probably damaging	1.00
R7259:Atrnl1	UTSW	19	57935606	nonsense	probably null
R7289:Atrnl1	UTSW	19	57650414	missense	probably benign	0.13
R7310:Atrnl1	UTSW	19	57642424	missense	possibly damaging	0.69
R7372:Atrnl1	UTSW	19	57935646	missense	possibly damaging	0.47
R7432:Atrnl1	UTSW	19	57755524	missense	probably damaging	1.00
R7478:Atrnl1	UTSW	19	57696312	missense	possibly damaging	0.89
R7556:Atrnl1	UTSW	19	57654846	missense	probably benign
R7567:Atrnl1	UTSW	19	57699523	missense	probably damaging	0.98
R7608:Atrnl1	UTSW	19	57714687	missense	probably damaging	1.00
R7632:Atrnl1	UTSW	19	57630306	missense	probably damaging	1.00
R7655:Atrnl1	UTSW	19	57611379	nonsense	probably null
R7656:Atrnl1	UTSW	19	57611379	nonsense	probably null
R7718:Atrnl1	UTSW	19	57740183	nonsense	probably null
R7721:Atrnl1	UTSW	19	57696331	missense	probably benign	0.00
R7726:Atrnl1	UTSW	19	57702072	missense	probably damaging	1.00
R7733:Atrnl1	UTSW	19	57701988	missense	probably benign	0.00
R7774:Atrnl1	UTSW	19	57699671	missense	probably damaging	1.00
R8010:Atrnl1	UTSW	19	57682446	missense	probably benign	0.14
R8119:Atrnl1	UTSW	19	57642463	missense	probably benign	0.00
R9242:Atrnl1	UTSW	19	57657228	missense	probably benign	0.07
R9265:Atrnl1	UTSW	19	57777927	missense	probably benign	0.11
R9272:Atrnl1	UTSW	19	57654988	missense	probably benign	0.00
R9480:Atrnl1	UTSW	19	57701988	missense	possibly damaging	0.61
R9526:Atrnl1	UTSW	19	57629119	missense	probably damaging	0.99
R9672:Atrnl1	UTSW	19	57630263	missense	possibly damaging	0.87
R9673:Atrnl1	UTSW	19	57611354	start codon destroyed	probably null	0.04
RF021:Atrnl1	UTSW	19	57642473	missense	probably benign	0.00

Predicted Primers

PCR Primer
(F):5'- GTCAGTTGAAACAGCCGTGC -3'
(R):5'- CCATTAAGGGAAGACACTATGGTTTAC -3'

Sequencing Primer
(F):5'- CAGTTGAAACAGCCGTGCTTTATC -3'
(R):5'- CCGACACGTTTGCATCA -3'

Posted On

2015-12-29