Mutagenetix > Incidental Mutation

Incidental Mutation 'R4785:Adamts13'

366906

Institutional Source

Beutler Lab

Gene Symbol

Adamts13

Ensembl Gene

ENSMUSG00000014852

Gene Name

a disintegrin-like and metallopeptidase (reprolysin type) with thrombospondin type 1 motif, 13

Synonyms

vWF-CP mRNA for von Willebrand factor-cleaving, LOC279028

MMRRC Submission

042417-MU

Accession Numbers

NCBI RefSeq: NM_001001322.2; MGI:2685556

Essential gene?

Probably non essential (E-score: 0.072) question?

Stock #

R4785 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

26973416-27009628 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 26983042 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Serine to Threonine at position 341 (S341T)

Ref Sequence

ENSEMBL: ENSMUSP00000099955 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000014996] [ENSMUST00000102891]

AlphaFold

Q769J6

Predicted Effect

probably damaging
Transcript: ENSMUST00000014996
AA Change: S341T

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000014996
Gene: ENSMUSG00000014852
AA Change: S341T

Domain	Start	End	E-Value	Type
transmembrane domain	13	35	N/A	INTRINSIC
Pfam:Reprolysin_4	84	287	2.3e-11	PFAM
Pfam:Reprolysin	84	291	1e-15	PFAM
Pfam:Reprolysin_3	113	237	2e-10	PFAM
Pfam:Reprolysin_2	132	281	5e-9	PFAM
TSP1	392	444	3.29e-14	SMART
TSP1	693	748	7.01e0	SMART
TSP1	750	810	3.34e-6	SMART
TSP1	904	959	5.85e0	SMART
TSP1	961	1019	2.69e0	SMART

Predicted Effect

probably damaging
Transcript: ENSMUST00000102891
AA Change: S341T

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000099955
Gene: ENSMUSG00000014852
AA Change: S341T

Domain	Start	End	E-Value	Type
transmembrane domain	13	35	N/A	INTRINSIC
Pfam:Reprolysin_4	84	287	8.5e-11	PFAM
Pfam:Reprolysin	96	291	4.9e-14	PFAM
Pfam:Reprolysin_3	106	237	5.6e-11	PFAM
TSP1	392	444	3.29e-14	SMART
TSP1	693	748	7.01e0	SMART
TSP1	750	810	3.34e-6	SMART
TSP1	904	959	5.85e0	SMART
TSP1	961	1019	2.69e0	SMART
Blast:TSP1	1022	1079	4e-26	BLAST
TSP1	1081	1137	4.58e-4	SMART
Blast:CUB	1196	1293	2e-39	BLAST
Blast:CUB	1303	1412	3e-63	BLAST

Coding Region Coverage

1x: 99.2%
3x: 98.5%
10x: 96.9%
20x: 94.4%

Validation Efficiency

MGI Phenotype

FUNCTION: This gene encodes a member of "a disintegrin and metalloproteinase with thrombospondin motifs" (ADAMTS) family of multi-domain matrix-associated metalloendopeptidases that have diverse roles in tissue morphogenesis and pathophysiological remodeling, in inflammation and in vascular biology. In certain mouse strains (C57BL/6, for example) an intracisternal A-type particle (IAP) retrotransposon sequence is located in the intron 23 that causes an alternate splicing event resulting in a shorter transcript variants encoding shorter isoforms. The encoded preproprotein undergoes proteolytic processing to generate an active enzyme that cleaves von Willebrand factor (VWF) in circulating blood. [provided by RefSeq, Jul 2016]
PHENOTYPE: Homozygous mutation of this gene results in thrombocytopenia, decreased survival, and increased susceptibility to developing thrombotic thrombocytopenic purpura after shiga toxin injection. On a different background, mutants are viable and fertile. [provided by MGI curators]

Allele List at MGI

All alleles(10) : Targeted(7) Gene trapped(2) Spontaneous(1)

Other mutations in this stock

Total: 145 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4921517D22Rik	T	C	13: 59,691,592	D13G	probably benign	Het
4930442H23Rik	C	T	10: 81,183,144		probably benign	Het
5330417C22Rik	A	T	3: 108,458,227		probably benign	Het
Adamts2	A	G	11: 50,792,722	I944V	probably benign	Het
Adcy3	A	G	12: 4,206,542	T783A	probably benign	Het
Ago3	A	T	4: 126,368,503	M418K	probably benign	Het
Alpk1	G	T	3: 127,687,592	N175K	possibly damaging	Het
Als2	A	G	1: 59,215,313	V295A	probably benign	Het
Anapc13	T	C	9: 102,629,821	I11T	probably benign	Het
Ankrd12	T	A	17: 65,982,999	N1813I	probably damaging	Het
Anks1b	A	T	10: 90,914,750	I176F	probably null	Het
Ap3d1	TTCTCTCTCTCTCTCTCT	TTCTCTCTCTCTCTCT	10: 80,712,778		probably null	Het
Arhgap32	A	G	9: 32,129,653	D67G	probably damaging	Het
Arhgap32	T	C	9: 32,260,780	C1619R	probably damaging	Het
Atp1a4	A	T	1: 172,254,110	Y158*	probably null	Het
Atp8b5	A	T	4: 43,356,980	D576V	probably damaging	Het
Atrnl1	A	G	19: 57,629,158	I122V	probably damaging	Het
B430203G13Rik	A	T	12: 17,924,519		noncoding transcript	Het
Baz1b	T	G	5: 135,217,413	L572R	possibly damaging	Het
Ccnd2	T	C	6: 127,148,798	T92A	possibly damaging	Het
Ccndbp1	A	T	2: 121,008,522	T5S	probably benign	Het
Ccr2	G	A	9: 124,106,372	V230I	probably benign	Het
Cct4	T	A	11: 23,002,866	V514E	probably damaging	Het
Cep152	A	G	2: 125,586,329		probably null	Het
Cflar	C	T	1: 58,752,567	T343M	probably benign	Het
Chrm5	A	C	2: 112,479,585	N395K	probably benign	Het
Chrna10	G	A	7: 102,113,219	P255S	possibly damaging	Het
Chrna6	T	A	8: 27,407,106	I248F	probably damaging	Het
Clip1	T	C	5: 123,579,293	D1387G	probably damaging	Het
Clstn3	T	C	6: 124,437,372		probably null	Het
Cntnap5a	C	T	1: 116,101,565	R250W	probably benign	Het
Col12a1	C	A	9: 79,678,494	V1228F	possibly damaging	Het
Cxcr5	T	C	9: 44,513,341	T340A	probably benign	Het
Cyp2a4	G	A	7: 26,312,875	R361K	probably damaging	Het
Dnah1	T	A	14: 31,263,479	K3818N	probably damaging	Het
Dnah3	T	A	7: 119,967,824	K2393M	probably benign	Het
Dpy19l1	A	T	9: 24,424,823	L529Q	probably damaging	Het
Eif4g2	C	T	7: 111,076,796	R399H	probably damaging	Het
Fam160a1	G	T	3: 85,688,570	T115K	probably damaging	Het
Fam76a	A	T	4: 132,902,117		probably null	Het
Fam76a	A	G	4: 132,916,190	Y78H	probably damaging	Het
Fbn1	A	T	2: 125,324,919	C2026S	probably damaging	Het
Fbxo4	T	C	15: 3,969,041	T312A	probably benign	Het
Fbxw26	A	G	9: 109,724,800	V257A	possibly damaging	Het
Flnb	A	T	14: 7,905,701	E1150D	probably benign	Het
Fndc3c1	A	T	X: 106,437,702	S661R	possibly damaging	Het
Gba2	A	C	4: 43,568,315	L684R	probably damaging	Het
Gbf1	G	T	19: 46,268,395	C812F	possibly damaging	Het
Glt8d2	A	T	10: 82,660,749	D158E	probably damaging	Het
Golga2	T	A	2: 32,297,156	N89K	probably damaging	Het
Got1	A	G	19: 43,502,937	I358T	possibly damaging	Het
Gpx6	C	T	13: 21,312,264	Q3*	probably null	Het
Grin1	T	A	2: 25,292,381	H956L	possibly damaging	Het
Grin2d	A	G	7: 45,856,781	V562A	probably damaging	Het
Grm6	A	G	11: 50,857,277	I405V	probably benign	Het
Hcar2	C	G	5: 123,864,450	G330A	probably benign	Het
Hcfc1	T	C	X: 73,965,946	K20E	probably damaging	Het
Iars	T	A	13: 49,724,663	Y888N	probably damaging	Het
Ifi206	A	T	1: 173,480,866	H521Q	probably benign	Het
Impg1	A	G	9: 80,398,450	S112P	probably benign	Het
Incenp	C	A	19: 9,877,690	R619M	unknown	Het
Incenp	T	A	19: 9,877,691	R619W	unknown	Het
Kat2b	A	G	17: 53,653,203	E513G	possibly damaging	Het
Kbtbd12	G	T	6: 88,618,021	L276I	probably damaging	Het
Kctd9	T	A	14: 67,734,164	D229E	probably damaging	Het
Kdm1b	C	T	13: 47,063,077	R308W	probably damaging	Het
Kif2b	G	A	11: 91,576,428	P343L	probably benign	Het
Kntc1	T	G	5: 123,816,762	M2081R	possibly damaging	Het
Lamc1	T	C	1: 153,231,740	N1231S	probably damaging	Het
Lclat1	T	A	17: 73,240,070	Y327*	probably null	Het
Lgals3bp	G	A	11: 118,393,514	T413I	probably damaging	Het
Lin54	A	G	5: 100,459,738	I250T	probably damaging	Het
Lrp1	T	C	10: 127,558,133	N2621S	probably benign	Het
Lrrtm3	T	A	10: 64,088,002	H462L	probably benign	Het
Lysmd1	A	G	3: 95,134,986	Y57C	probably damaging	Het
Mccc1	C	A	3: 35,975,873	M429I	probably damaging	Het
Metrnl	A	G	11: 121,707,924	E40G	probably benign	Het
Mios	T	A	6: 8,222,464	M466K	probably benign	Het
Mrgpra1	A	G	7: 47,335,470	S154P	probably damaging	Het
Mrpl24	T	C	3: 87,922,050		probably null	Het
Myo1f	A	G	17: 33,598,191	N736S	possibly damaging	Het
Myo1h	A	G	5: 114,360,599	I919V	possibly damaging	Het
Nampt	T	C	12: 32,848,714	L443P	possibly damaging	Het
Ndufaf2	C	G	13: 108,052,780	A145P	probably damaging	Het
Nek10	A	T	14: 14,855,714	T403S	probably benign	Het
Nme8	C	A	13: 19,657,930	V219L	probably damaging	Het
Nov	A	T	15: 54,752,207		probably null	Het
Nps	T	A	7: 135,268,788	L13Q	probably damaging	Het
Nutm1	G	A	2: 112,248,936	A878V	probably benign	Het
Ogdh	T	C	11: 6,349,875	F794L	probably damaging	Het
Olfr1305	A	T	2: 111,873,050	D268E	possibly damaging	Het
Olfr1441	A	T	19: 12,422,977	I223F	probably damaging	Het
Olfr292	T	C	7: 86,694,528	L24P	probably damaging	Het
Olfr305	C	A	7: 86,363,735	G201C	probably damaging	Het
Olfr721-ps1	A	C	14: 14,407,729	Y167S	possibly damaging	Het
Olfr998	A	G	2: 85,590,938	T133A	probably benign	Het
Pik3cg	T	C	12: 32,205,199	E263G	probably damaging	Het
Pikfyve	A	G	1: 65,267,846	T1798A	probably benign	Het
Poldip3	T	C	15: 83,131,501	Y305C	probably damaging	Het
Pqlc2	G	T	4: 139,300,001	H343Q	probably benign	Het
Prkdc	T	C	16: 15,648,976	I107T	probably benign	Het
Prmt2	A	G	10: 76,226,221	I50T	probably damaging	Het
Ptprd	T	C	4: 76,140,553	T168A	probably benign	Het
Pudp	A	G	18: 50,568,065	V199A	probably damaging	Het
Rab3c	T	C	13: 110,061,900	E198G	probably benign	Het
Rasl12	A	G	9: 65,413,448	Y156C	probably damaging	Het
Rbm12	T	C	2: 156,096,564	D596G	possibly damaging	Het
Rbm6	T	C	9: 107,787,352	E694G	probably benign	Het
Rif1	T	C	2: 52,112,747	V2071A	probably damaging	Het
Ripply2	A	T	9: 87,019,796	N125I	probably damaging	Het
Rps6kc1	A	T	1: 190,750,188	H284Q	probably benign	Het
Scara3	A	T	14: 65,953,501	M1K	probably null	Het
Sfswap	A	G	5: 129,513,083	T215A	probably damaging	Het
Shroom2	A	C	X: 152,660,907	F421V	probably benign	Het
Sipa1l3	A	G	7: 29,377,641	V902A	probably damaging	Het
Slamf8	G	T	1: 172,584,214	P238Q	probably damaging	Het
Slc44a3	T	C	3: 121,527,074	T93A	possibly damaging	Het
Slc5a7	A	T	17: 54,278,700	I363N	probably damaging	Het
Slc7a2	T	A	8: 40,911,058	M436K	probably benign	Het
Spindoc	A	G	19: 7,374,091	S223P	probably benign	Het
Stk11ip	T	C	1: 75,530,281	F669L	possibly damaging	Het
Sun3	G	A	11: 9,038,266	L19F	probably benign	Het
Sycp1	C	A	3: 102,853,489	A703S	possibly damaging	Het
Tas2r139	T	G	6: 42,141,284	F117V	probably damaging	Het
Tdrd6	T	C	17: 43,625,576	Y1527C	probably damaging	Het
Tenm4	A	C	7: 96,774,046	K683Q	probably damaging	Het
Tfeb	T	A	17: 47,788,227		probably null	Het
Tmco4	T	C	4: 138,998,039	S121P	probably damaging	Het
Tmprss11d	C	T	5: 86,306,281	V222M	probably damaging	Het
Tnks1bp1	T	C	2: 85,063,034	W440R	probably damaging	Het
Trp53bp2	A	G	1: 182,448,997	T848A	probably benign	Het
Tssk1	G	A	16: 17,895,062	R237H	probably benign	Het
Ttll4	A	T	1: 74,679,007	T6S	possibly damaging	Het
Ttn	G	T	2: 76,721,797	Y29419*	probably null	Het
Ttn	A	G	2: 76,769,603	Y19076H	probably damaging	Het
Ubr3	T	A	2: 69,959,603	V867D	probably damaging	Het
Usp29	A	G	7: 6,961,391	T78A	probably damaging	Het
Utrn	T	G	10: 12,654,745	Q2108P	probably benign	Het
Vcan	T	C	13: 89,705,789	N351D	probably damaging	Het
Vmn1r61	A	T	7: 5,611,125	Y63*	probably null	Het
Vmn1r61	A	T	7: 5,611,127	Y63N	probably benign	Het
Vmn1r85	A	T	7: 13,084,861	W119R	probably damaging	Het
Zbtb21	A	C	16: 97,950,455	V190G	possibly damaging	Het
Zfp157	C	A	5: 138,444,789	T14N	probably damaging	Het
Zfp942	A	T	17: 21,929,419	H76Q	probably damaging	Het

Other mutations in Adamts13

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00089:Adamts13	APN	2	27005361	missense	probably benign	0.04
IGL00465:Adamts13	APN	2	26973555	missense	probably benign	0.32
IGL01114:Adamts13	APN	2	27005190	missense	probably benign	0.41
IGL01138:Adamts13	APN	2	26983042	missense	probably damaging	1.00
IGL01154:Adamts13	APN	2	27006194	missense	probably benign
IGL01860:Adamts13	APN	2	26978011	missense	probably damaging	0.99
IGL01924:Adamts13	APN	2	26996583	missense	possibly damaging	0.80
IGL01991:Adamts13	APN	2	26990598	missense	probably damaging	0.97
IGL02215:Adamts13	APN	2	26985483	missense	probably damaging	1.00
IGL02415:Adamts13	APN	2	26989283	missense	possibly damaging	0.95
IGL02519:Adamts13	APN	2	26978675	missense	probably damaging	1.00
IGL02956:Adamts13	APN	2	26983037	missense	probably benign	0.18
IGL03209:Adamts13	APN	2	26992961	missense	probably benign	0.00
I1329:Adamts13	UTSW	2	26973619	missense	possibly damaging	0.52
IGL02837:Adamts13	UTSW	2	26991420	missense	probably benign	0.01
IGL03048:Adamts13	UTSW	2	26978699	critical splice donor site	probably null
R0041:Adamts13	UTSW	2	26983974	missense	probably damaging	1.00
R0217:Adamts13	UTSW	2	26996921	splice site	probably benign
R0276:Adamts13	UTSW	2	26975760	missense	possibly damaging	0.91
R0309:Adamts13	UTSW	2	26986989	missense	probably damaging	0.99
R0348:Adamts13	UTSW	2	26981080	missense	probably benign	0.13
R0369:Adamts13	UTSW	2	27005186	missense	probably benign	0.00
R0386:Adamts13	UTSW	2	26986679	splice site	probably null
R0553:Adamts13	UTSW	2	26991334	nonsense	probably null
R0714:Adamts13	UTSW	2	26986985	splice site	probably benign
R0862:Adamts13	UTSW	2	27006324	critical splice donor site	probably null
R1320:Adamts13	UTSW	2	26989246	missense	probably damaging	0.97
R1458:Adamts13	UTSW	2	26988354	missense	probably damaging	1.00
R1473:Adamts13	UTSW	2	26981753	nonsense	probably null
R1491:Adamts13	UTSW	2	26978315	missense	probably damaging	1.00
R1588:Adamts13	UTSW	2	26975675	missense	probably benign	0.01
R1638:Adamts13	UTSW	2	26996583	missense	possibly damaging	0.80
R1724:Adamts13	UTSW	2	26991294	missense	probably benign	0.00
R1924:Adamts13	UTSW	2	26984141	missense	probably damaging	1.00
R2001:Adamts13	UTSW	2	26973990	missense	probably benign
R2072:Adamts13	UTSW	2	27005425	missense	probably benign	0.10
R2073:Adamts13	UTSW	2	27006314	missense	probably damaging	1.00
R2409:Adamts13	UTSW	2	26978362	missense	probably benign	0.00
R4362:Adamts13	UTSW	2	27004782	missense	probably damaging	1.00
R4363:Adamts13	UTSW	2	27004782	missense	probably damaging	1.00
R4422:Adamts13	UTSW	2	27005400	missense	probably benign	0.00
R4769:Adamts13	UTSW	2	27008711	nonsense	probably null
R4831:Adamts13	UTSW	2	26983130	critical splice donor site	probably null
R4832:Adamts13	UTSW	2	26989402	missense	probably benign	0.22
R4945:Adamts13	UTSW	2	26986610	missense	probably damaging	1.00
R5047:Adamts13	UTSW	2	26996910	missense	probably damaging	0.98
R5126:Adamts13	UTSW	2	26996915	critical splice donor site	probably null
R5161:Adamts13	UTSW	2	26993008	missense	probably benign	0.00
R5394:Adamts13	UTSW	2	26986558	missense	probably benign	0.00
R5557:Adamts13	UTSW	2	26973639	missense	probably benign	0.05
R5660:Adamts13	UTSW	2	26996749	missense	probably benign
R5890:Adamts13	UTSW	2	26986591	missense	probably damaging	0.96
R6168:Adamts13	UTSW	2	27004886	missense	probably benign	0.37
R6536:Adamts13	UTSW	2	26975750	missense	probably damaging	0.99
R6929:Adamts13	UTSW	2	27006263	nonsense	probably null
R7207:Adamts13	UTSW	2	26978695	missense	probably damaging	1.00
R7211:Adamts13	UTSW	2	26989298	missense	probably benign	0.40
R7212:Adamts13	UTSW	2	27006314	missense	probably damaging	1.00
R7392:Adamts13	UTSW	2	26989324	missense	probably damaging	1.00
R7583:Adamts13	UTSW	2	26973953	missense	probably benign
R7604:Adamts13	UTSW	2	27005206	missense	probably benign	0.00
R7783:Adamts13	UTSW	2	26990585	missense	not run
R7814:Adamts13	UTSW	2	26996549	missense	probably benign
R8076:Adamts13	UTSW	2	26990612	missense	probably benign	0.06
R8245:Adamts13	UTSW	2	26990556	missense	probably damaging	1.00
R8526:Adamts13	UTSW	2	26978000	missense	probably benign
R9112:Adamts13	UTSW	2	26990367	missense	possibly damaging	0.60
R9147:Adamts13	UTSW	2	26993012	missense	probably benign
R9148:Adamts13	UTSW	2	26993012	missense	probably benign
R9704:Adamts13	UTSW	2	27005225	missense
R9743:Adamts13	UTSW	2	26996800	missense	probably benign	0.16
R9743:Adamts13	UTSW	2	27005479	critical splice donor site	probably null
X0027:Adamts13	UTSW	2	26985546	nonsense	probably null

Predicted Primers

PCR Primer
(F):5'- CCAAGGCAGACTTCCTCCT -3'
(R):5'- GGGTGCTCTTTCCCTAATCC -3'

Sequencing Primer
(F):5'- AGACATTTTCATGGCCCCTAGAGG -3'
(R):5'- GGGTGCTCTTTCCCTAATCCCTTAC -3'

Posted On

2015-12-29