Incidental Mutation 'R4785:Gba2'
ID 366929
Institutional Source Beutler Lab
Gene Symbol Gba2
Ensembl Gene ENSMUSG00000028467
Gene Name glucosidase beta 2
Synonyms bile acid
MMRRC Submission 042417-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R4785 (G1)
Quality Score 225
Status Not validated
Chromosome 4
Chromosomal Location 43566928-43578873 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to C at 43568315 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Leucine to Arginine at position 684 (L684R)
Ref Sequence ENSEMBL: ENSMUSP00000030189 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000030189] [ENSMUST00000102944] [ENSMUST00000130443] [ENSMUST00000132631] [ENSMUST00000167751]
AlphaFold Q69ZF3
Predicted Effect probably damaging
Transcript: ENSMUST00000030189
AA Change: L684R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000030189
Gene: ENSMUSG00000028467
AA Change: L684R

DomainStartEndE-ValueType
Pfam:GBA2_N 142 446 9.4e-106 PFAM
Pfam:DUF608 512 879 1.3e-153 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000102944
SMART Domains Protein: ENSMUSP00000100008
Gene: ENSMUSG00000028466

DomainStartEndE-ValueType
low complexity region 54 83 N/A INTRINSIC
low complexity region 132 147 N/A INTRINSIC
BRLZ 158 222 2.03e-15 SMART
low complexity region 240 253 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000126277
Predicted Effect noncoding transcript
Transcript: ENSMUST00000128403
Predicted Effect probably benign
Transcript: ENSMUST00000130443
SMART Domains Protein: ENSMUSP00000119589
Gene: ENSMUSG00000028467

DomainStartEndE-ValueType
Pfam:GBA2_N 142 180 5.6e-13 PFAM
Pfam:GBA2_N 178 227 1.5e-13 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000132631
Predicted Effect noncoding transcript
Transcript: ENSMUST00000138623
Predicted Effect noncoding transcript
Transcript: ENSMUST00000139606
Predicted Effect noncoding transcript
Transcript: ENSMUST00000144968
Predicted Effect noncoding transcript
Transcript: ENSMUST00000148426
Predicted Effect noncoding transcript
Transcript: ENSMUST00000152251
Predicted Effect noncoding transcript
Transcript: ENSMUST00000159923
Predicted Effect probably benign
Transcript: ENSMUST00000167751
SMART Domains Protein: ENSMUSP00000129401
Gene: ENSMUSG00000028466

DomainStartEndE-ValueType
low complexity region 54 83 N/A INTRINSIC
low complexity region 156 171 N/A INTRINSIC
BRLZ 182 246 2.03e-15 SMART
low complexity region 264 277 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 94.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a microsomal beta-glucosidase that catalyzes the hydrolysis of bile acid 3-O-glucosides as endogenous compounds. Studies to determine subcellular localization of this protein in the liver indicated that the enzyme was mainly enriched in the microsomal fraction where it appeared to be confined to the endoplasmic reticulum. This putative transmembrane protein is thought to play a role in carbohydrate transport and metabolism. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit accumulation of glucosylceramides in multiple tissues, and show impaired male fertility associated with globozoospermia, oligozoospermia, reduced sperm motility, and male germ cell apoptosis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 145 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4921517D22Rik T C 13: 59,839,406 (GRCm39) D13G probably benign Het
4930442H23Rik C T 10: 81,018,978 (GRCm39) probably benign Het
Adamts13 T A 2: 26,873,054 (GRCm39) S341T probably damaging Het
Adamts2 A G 11: 50,683,549 (GRCm39) I944V probably benign Het
Adcy3 A G 12: 4,256,542 (GRCm39) T783A probably benign Het
Ago3 A T 4: 126,262,296 (GRCm39) M418K probably benign Het
Alpk1 G T 3: 127,481,241 (GRCm39) N175K possibly damaging Het
Als2 A G 1: 59,254,472 (GRCm39) V295A probably benign Het
Anapc13 T C 9: 102,507,020 (GRCm39) I11T probably benign Het
Ankrd12 T A 17: 66,289,994 (GRCm39) N1813I probably damaging Het
Anks1b A T 10: 90,750,612 (GRCm39) I176F probably null Het
Ap3d1 TTCTCTCTCTCTCTCTCT TTCTCTCTCTCTCTCT 10: 80,548,612 (GRCm39) probably null Het
Arhgap32 T C 9: 32,172,076 (GRCm39) C1619R probably damaging Het
Arhgap32 A G 9: 32,040,949 (GRCm39) D67G probably damaging Het
Atp1a4 A T 1: 172,081,677 (GRCm39) Y158* probably null Het
Atp8b5 A T 4: 43,356,980 (GRCm39) D576V probably damaging Het
Atrnl1 A G 19: 57,617,590 (GRCm39) I122V probably damaging Het
B430203G13Rik A T 12: 17,974,520 (GRCm39) noncoding transcript Het
Baz1b T G 5: 135,246,267 (GRCm39) L572R possibly damaging Het
Ccn3 A T 15: 54,615,603 (GRCm39) probably null Het
Ccnd2 T C 6: 127,125,761 (GRCm39) T92A possibly damaging Het
Ccndbp1 A T 2: 120,839,003 (GRCm39) T5S probably benign Het
Ccr2 G A 9: 123,906,409 (GRCm39) V230I probably benign Het
Cct4 T A 11: 22,952,866 (GRCm39) V514E probably damaging Het
Cep152 A G 2: 125,428,249 (GRCm39) probably null Het
Cflar C T 1: 58,791,726 (GRCm39) T343M probably benign Het
Chrm5 A C 2: 112,309,930 (GRCm39) N395K probably benign Het
Chrna10 G A 7: 101,762,426 (GRCm39) P255S possibly damaging Het
Chrna6 T A 8: 27,897,134 (GRCm39) I248F probably damaging Het
Clip1 T C 5: 123,717,356 (GRCm39) D1387G probably damaging Het
Clstn3 T C 6: 124,414,331 (GRCm39) probably null Het
Cntnap5a C T 1: 116,029,295 (GRCm39) R250W probably benign Het
Col12a1 C A 9: 79,585,776 (GRCm39) V1228F possibly damaging Het
Cxcr5 T C 9: 44,424,638 (GRCm39) T340A probably benign Het
Cyp2a4 G A 7: 26,012,300 (GRCm39) R361K probably damaging Het
Dnah1 T A 14: 30,985,436 (GRCm39) K3818N probably damaging Het
Dnah3 T A 7: 119,567,047 (GRCm39) K2393M probably benign Het
Dpy19l1 A T 9: 24,336,119 (GRCm39) L529Q probably damaging Het
Eif4g2 C T 7: 110,676,003 (GRCm39) R399H probably damaging Het
Elapor1 A T 3: 108,365,543 (GRCm39) probably benign Het
Fam76a A T 4: 132,629,428 (GRCm39) probably null Het
Fam76a A G 4: 132,643,501 (GRCm39) Y78H probably damaging Het
Fbn1 A T 2: 125,166,839 (GRCm39) C2026S probably damaging Het
Fbxo4 T C 15: 3,998,523 (GRCm39) T312A probably benign Het
Fbxw26 A G 9: 109,553,868 (GRCm39) V257A possibly damaging Het
Fhip1a G T 3: 85,595,877 (GRCm39) T115K probably damaging Het
Flnb A T 14: 7,905,701 (GRCm38) E1150D probably benign Het
Fndc3c1 A T X: 105,481,308 (GRCm39) S661R possibly damaging Het
Gbf1 G T 19: 46,256,834 (GRCm39) C812F possibly damaging Het
Glt8d2 A T 10: 82,496,583 (GRCm39) D158E probably damaging Het
Golga2 T A 2: 32,187,168 (GRCm39) N89K probably damaging Het
Got1 A G 19: 43,491,376 (GRCm39) I358T possibly damaging Het
Gpx6 C T 13: 21,496,434 (GRCm39) Q3* probably null Het
Grin1 T A 2: 25,182,393 (GRCm39) H956L possibly damaging Het
Grin2d A G 7: 45,506,205 (GRCm39) V562A probably damaging Het
Grm6 A G 11: 50,748,104 (GRCm39) I405V probably benign Het
Hcar2 C G 5: 124,002,513 (GRCm39) G330A probably benign Het
Hcfc1 T C X: 73,009,552 (GRCm39) K20E probably damaging Het
Iars1 T A 13: 49,878,139 (GRCm39) Y888N probably damaging Het
Ifi206 A T 1: 173,308,432 (GRCm39) H521Q probably benign Het
Impg1 A G 9: 80,305,732 (GRCm39) S112P probably benign Het
Incenp C A 19: 9,855,054 (GRCm39) R619M unknown Het
Incenp T A 19: 9,855,055 (GRCm39) R619W unknown Het
Kat2b A G 17: 53,960,231 (GRCm39) E513G possibly damaging Het
Kbtbd12 G T 6: 88,595,003 (GRCm39) L276I probably damaging Het
Kctd9 T A 14: 67,971,613 (GRCm39) D229E probably damaging Het
Kdm1b C T 13: 47,216,553 (GRCm39) R308W probably damaging Het
Kif2b G A 11: 91,467,254 (GRCm39) P343L probably benign Het
Kntc1 T G 5: 123,954,825 (GRCm39) M2081R possibly damaging Het
Lamc1 T C 1: 153,107,486 (GRCm39) N1231S probably damaging Het
Lclat1 T A 17: 73,547,065 (GRCm39) Y327* probably null Het
Lgals3bp G A 11: 118,284,340 (GRCm39) T413I probably damaging Het
Lin54 A G 5: 100,607,597 (GRCm39) I250T probably damaging Het
Lrp1 T C 10: 127,394,002 (GRCm39) N2621S probably benign Het
Lrrtm3 T A 10: 63,923,781 (GRCm39) H462L probably benign Het
Lysmd1 A G 3: 95,042,297 (GRCm39) Y57C probably damaging Het
Mccc1 C A 3: 36,030,022 (GRCm39) M429I probably damaging Het
Metrnl A G 11: 121,598,750 (GRCm39) E40G probably benign Het
Mios T A 6: 8,222,464 (GRCm39) M466K probably benign Het
Mrgpra1 A G 7: 46,985,218 (GRCm39) S154P probably damaging Het
Mrpl24 T C 3: 87,829,357 (GRCm39) probably null Het
Myo1f A G 17: 33,817,165 (GRCm39) N736S possibly damaging Het
Myo1h A G 5: 114,498,660 (GRCm39) I919V possibly damaging Het
Nampt T C 12: 32,898,713 (GRCm39) L443P possibly damaging Het
Ndufaf2 C G 13: 108,189,314 (GRCm39) A145P probably damaging Het
Nek10 A T 14: 14,855,714 (GRCm38) T403S probably benign Het
Nme8 C A 13: 19,842,100 (GRCm39) V219L probably damaging Het
Nps T A 7: 134,870,517 (GRCm39) L13Q probably damaging Het
Nutm1 G A 2: 112,079,281 (GRCm39) A878V probably benign Het
Ogdh T C 11: 6,299,875 (GRCm39) F794L probably damaging Het
Or14a259 C A 7: 86,012,943 (GRCm39) G201C probably damaging Het
Or14c39 T C 7: 86,343,736 (GRCm39) L24P probably damaging Het
Or2t35 A C 14: 14,407,729 (GRCm38) Y167S possibly damaging Het
Or4f56 A T 2: 111,703,395 (GRCm39) D268E possibly damaging Het
Or5a3 A T 19: 12,400,341 (GRCm39) I223F probably damaging Het
Or5g29 A G 2: 85,421,282 (GRCm39) T133A probably benign Het
Pik3cg T C 12: 32,255,198 (GRCm39) E263G probably damaging Het
Pikfyve A G 1: 65,307,005 (GRCm39) T1798A probably benign Het
Poldip3 T C 15: 83,015,702 (GRCm39) Y305C probably damaging Het
Prkdc T C 16: 15,466,840 (GRCm39) I107T probably benign Het
Prmt2 A G 10: 76,062,055 (GRCm39) I50T probably damaging Het
Ptprd T C 4: 76,058,790 (GRCm39) T168A probably benign Het
Pudp A G 18: 50,701,136 (GRCm39) V199A probably damaging Het
Rab3c T C 13: 110,198,434 (GRCm39) E198G probably benign Het
Rasl12 A G 9: 65,320,730 (GRCm39) Y156C probably damaging Het
Rbm12 T C 2: 155,938,484 (GRCm39) D596G possibly damaging Het
Rbm6 T C 9: 107,664,551 (GRCm39) E694G probably benign Het
Rif1 T C 2: 52,002,759 (GRCm39) V2071A probably damaging Het
Ripply2 A T 9: 86,901,849 (GRCm39) N125I probably damaging Het
Rps6kc1 A T 1: 190,482,385 (GRCm39) H284Q probably benign Het
Scara3 A T 14: 66,190,950 (GRCm39) M1K probably null Het
Sfswap A G 5: 129,590,147 (GRCm39) T215A probably damaging Het
Shroom2 A C X: 151,443,903 (GRCm39) F421V probably benign Het
Sipa1l3 A G 7: 29,077,066 (GRCm39) V902A probably damaging Het
Slamf8 G T 1: 172,411,781 (GRCm39) P238Q probably damaging Het
Slc44a3 T C 3: 121,320,723 (GRCm39) T93A possibly damaging Het
Slc5a7 A T 17: 54,585,728 (GRCm39) I363N probably damaging Het
Slc66a1 G T 4: 139,027,312 (GRCm39) H343Q probably benign Het
Slc7a2 T A 8: 41,364,095 (GRCm39) M436K probably benign Het
Spindoc A G 19: 7,351,456 (GRCm39) S223P probably benign Het
Stk11ip T C 1: 75,506,925 (GRCm39) F669L possibly damaging Het
Sun3 G A 11: 8,988,266 (GRCm39) L19F probably benign Het
Sycp1 C A 3: 102,760,805 (GRCm39) A703S possibly damaging Het
Tas2r139 T G 6: 42,118,218 (GRCm39) F117V probably damaging Het
Tdrd6 T C 17: 43,936,467 (GRCm39) Y1527C probably damaging Het
Tenm4 A C 7: 96,423,253 (GRCm39) K683Q probably damaging Het
Tfeb T A 17: 48,099,152 (GRCm39) probably null Het
Tmco4 T C 4: 138,725,350 (GRCm39) S121P probably damaging Het
Tmprss11d C T 5: 86,454,140 (GRCm39) V222M probably damaging Het
Tnks1bp1 T C 2: 84,893,378 (GRCm39) W440R probably damaging Het
Trp53bp2 A G 1: 182,276,562 (GRCm39) T848A probably benign Het
Tssk1 G A 16: 17,712,926 (GRCm39) R237H probably benign Het
Ttll4 A T 1: 74,718,166 (GRCm39) T6S possibly damaging Het
Ttn G T 2: 76,552,141 (GRCm39) Y29419* probably null Het
Ttn A G 2: 76,599,947 (GRCm39) Y19076H probably damaging Het
Ubr3 T A 2: 69,789,947 (GRCm39) V867D probably damaging Het
Usp29 A G 7: 6,964,390 (GRCm39) T78A probably damaging Het
Utrn T G 10: 12,530,489 (GRCm39) Q2108P probably benign Het
Vcan T C 13: 89,853,908 (GRCm39) N351D probably damaging Het
Vmn1r61 A T 7: 5,614,124 (GRCm39) Y63* probably null Het
Vmn1r61 A T 7: 5,614,126 (GRCm39) Y63N probably benign Het
Vmn1r85 A T 7: 12,818,788 (GRCm39) W119R probably damaging Het
Zbtb21 A C 16: 97,751,655 (GRCm39) V190G possibly damaging Het
Zfp157 C A 5: 138,443,051 (GRCm39) T14N probably damaging Het
Zfp942 A T 17: 22,148,400 (GRCm39) H76Q probably damaging Het
Other mutations in Gba2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00501:Gba2 APN 4 43,568,477 (GRCm39) missense probably damaging 1.00
IGL01577:Gba2 APN 4 43,573,753 (GRCm39) nonsense probably null
IGL02066:Gba2 APN 4 43,570,175 (GRCm39) missense probably benign 0.18
IGL02126:Gba2 APN 4 43,567,918 (GRCm39) critical splice acceptor site probably null
IGL02243:Gba2 APN 4 43,568,719 (GRCm39) missense probably benign 0.13
IGL02474:Gba2 APN 4 43,568,538 (GRCm39) missense possibly damaging 0.69
IGL02567:Gba2 APN 4 43,567,281 (GRCm39) missense probably benign
IGL02628:Gba2 APN 4 43,568,919 (GRCm39) missense probably benign 0.01
IGL02706:Gba2 APN 4 43,567,257 (GRCm39) missense probably benign 0.01
IGL02795:Gba2 APN 4 43,578,331 (GRCm39) missense probably damaging 1.00
R0389:Gba2 UTSW 4 43,570,832 (GRCm39) missense probably damaging 1.00
R0555:Gba2 UTSW 4 43,569,927 (GRCm39) missense probably damaging 1.00
R0650:Gba2 UTSW 4 43,570,424 (GRCm39) splice site probably null
R1603:Gba2 UTSW 4 43,567,823 (GRCm39) missense probably damaging 1.00
R1628:Gba2 UTSW 4 43,570,118 (GRCm39) missense probably benign 0.00
R1664:Gba2 UTSW 4 43,578,080 (GRCm39) missense probably benign 0.01
R1686:Gba2 UTSW 4 43,573,869 (GRCm39) splice site probably benign
R1730:Gba2 UTSW 4 43,578,242 (GRCm39) missense probably benign 0.01
R2036:Gba2 UTSW 4 43,568,118 (GRCm39) unclassified probably benign
R2061:Gba2 UTSW 4 43,574,029 (GRCm39) nonsense probably null
R2259:Gba2 UTSW 4 43,570,107 (GRCm39) missense probably benign
R2847:Gba2 UTSW 4 43,568,000 (GRCm39) splice site probably null
R3026:Gba2 UTSW 4 43,578,308 (GRCm39) missense possibly damaging 0.95
R3617:Gba2 UTSW 4 43,573,803 (GRCm39) missense probably damaging 1.00
R4225:Gba2 UTSW 4 43,569,464 (GRCm39) unclassified probably benign
R4346:Gba2 UTSW 4 43,571,337 (GRCm39) missense probably benign 0.04
R4601:Gba2 UTSW 4 43,573,810 (GRCm39) missense probably damaging 1.00
R4611:Gba2 UTSW 4 43,568,092 (GRCm39) missense probably damaging 1.00
R4664:Gba2 UTSW 4 43,568,619 (GRCm39) unclassified probably benign
R4784:Gba2 UTSW 4 43,568,315 (GRCm39) missense probably damaging 1.00
R5079:Gba2 UTSW 4 43,568,640 (GRCm39) unclassified probably benign
R5327:Gba2 UTSW 4 43,574,063 (GRCm39) missense probably damaging 1.00
R5746:Gba2 UTSW 4 43,568,465 (GRCm39) splice site probably null
R6052:Gba2 UTSW 4 43,568,330 (GRCm39) missense probably damaging 1.00
R6485:Gba2 UTSW 4 43,574,118 (GRCm39) missense probably damaging 1.00
R7073:Gba2 UTSW 4 43,573,753 (GRCm39) missense probably damaging 1.00
R7112:Gba2 UTSW 4 43,568,453 (GRCm39) missense probably benign 0.01
R7472:Gba2 UTSW 4 43,568,967 (GRCm39) missense probably benign 0.44
R8220:Gba2 UTSW 4 43,568,510 (GRCm39) missense probably damaging 1.00
R8315:Gba2 UTSW 4 43,569,937 (GRCm39) frame shift probably null
R8476:Gba2 UTSW 4 43,569,944 (GRCm39) missense probably damaging 0.98
R8477:Gba2 UTSW 4 43,569,944 (GRCm39) missense probably damaging 0.98
R8794:Gba2 UTSW 4 43,568,077 (GRCm39) missense probably damaging 0.98
R9087:Gba2 UTSW 4 43,568,304 (GRCm39) missense probably benign 0.09
R9193:Gba2 UTSW 4 43,578,112 (GRCm39) missense probably benign 0.26
R9753:Gba2 UTSW 4 43,568,716 (GRCm39) missense probably damaging 1.00
RF007:Gba2 UTSW 4 43,569,894 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CAAGTTGCTTGTATCCCGTAGTTG -3'
(R):5'- GCTGTGATGGAGTCCGAAATG -3'

Sequencing Primer
(F):5'- GGGTTTTAAGCTGCCCCAG -3'
(R):5'- CTCATTGAGAATGGAGGCTACGC -3'
Posted On 2015-12-29