Incidental Mutation 'R4785:Dnah3'
ID366967
Institutional Source Beutler Lab
Gene Symbol Dnah3
Ensembl Gene ENSMUSG00000052273
Gene Namedynein, axonemal, heavy chain 3
Synonyms
MMRRC Submission 042417-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.098) question?
Stock #R4785 (G1)
Quality Score225
Status Not validated
Chromosome7
Chromosomal Location119922671-120095280 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 119967824 bp
ZygosityHeterozygous
Amino Acid Change Lysine to Methionine at position 2393 (K2393M)
Ref Sequence ENSEMBL: ENSMUSP00000042857 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000046993] [ENSMUST00000209154] [ENSMUST00000213149]
Predicted Effect probably benign
Transcript: ENSMUST00000046993
AA Change: K2393M

PolyPhen 2 Score 0.289 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000042857
Gene: ENSMUSG00000052273
AA Change: K2393M

DomainStartEndE-ValueType
low complexity region 121 133 N/A INTRINSIC
low complexity region 805 820 N/A INTRINSIC
Pfam:DHC_N2 826 1235 3.3e-144 PFAM
AAA 1388 1527 1.59e-1 SMART
low complexity region 1594 1606 N/A INTRINSIC
Blast:AAA 1669 1897 9e-84 BLAST
AAA 2033 2180 1.33e-3 SMART
Pfam:AAA_8 2362 2632 1.5e-63 PFAM
Pfam:MT 2644 2994 7.4e-52 PFAM
Pfam:AAA_9 3015 3240 3.5e-92 PFAM
low complexity region 3338 3349 N/A INTRINSIC
Pfam:Dynein_heavy 3376 4079 4.4e-285 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000157547
Predicted Effect unknown
Transcript: ENSMUST00000208910
AA Change: K6M
Predicted Effect probably benign
Transcript: ENSMUST00000209154
AA Change: K2382M

PolyPhen 2 Score 0.024 (Sensitivity: 0.95; Specificity: 0.81)
Predicted Effect probably benign
Transcript: ENSMUST00000213149
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 94.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene belongs to the dynein family, whose members encode large proteins that are constituents of the microtubule-associated motor protein complex. This complex is composed of dynein heavy, intermediate and light chains, which can be axonemal or cytoplasmic. This protein is an axonemal dynein heavy chain. It is involved in producing force for ciliary beating by using energy from ATP hydrolysis. Alternative splicing results in multiple transcript variants encoding distinct isoforms. [provided by RefSeq, Dec 2016]
Allele List at MGI
Other mutations in this stock
Total: 145 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4921517D22Rik T C 13: 59,691,592 D13G probably benign Het
4930442H23Rik C T 10: 81,183,144 probably benign Het
5330417C22Rik A T 3: 108,458,227 probably benign Het
Adamts13 T A 2: 26,983,042 S341T probably damaging Het
Adamts2 A G 11: 50,792,722 I944V probably benign Het
Adcy3 A G 12: 4,206,542 T783A probably benign Het
Ago3 A T 4: 126,368,503 M418K probably benign Het
Alpk1 G T 3: 127,687,592 N175K possibly damaging Het
Als2 A G 1: 59,215,313 V295A probably benign Het
Anapc13 T C 9: 102,629,821 I11T probably benign Het
Ankrd12 T A 17: 65,982,999 N1813I probably damaging Het
Anks1b A T 10: 90,914,750 I176F probably null Het
Ap3d1 TTCTCTCTCTCTCTCTCT TTCTCTCTCTCTCTCT 10: 80,712,778 probably null Het
Arhgap32 A G 9: 32,129,653 D67G probably damaging Het
Arhgap32 T C 9: 32,260,780 C1619R probably damaging Het
Atp1a4 A T 1: 172,254,110 Y158* probably null Het
Atp8b5 A T 4: 43,356,980 D576V probably damaging Het
Atrnl1 A G 19: 57,629,158 I122V probably damaging Het
B430203G13Rik A T 12: 17,924,519 noncoding transcript Het
Baz1b T G 5: 135,217,413 L572R possibly damaging Het
Ccnd2 T C 6: 127,148,798 T92A possibly damaging Het
Ccndbp1 A T 2: 121,008,522 T5S probably benign Het
Ccr2 G A 9: 124,106,372 V230I probably benign Het
Cct4 T A 11: 23,002,866 V514E probably damaging Het
Cep152 A G 2: 125,586,329 probably null Het
Cflar C T 1: 58,752,567 T343M probably benign Het
Chrm5 A C 2: 112,479,585 N395K probably benign Het
Chrna10 G A 7: 102,113,219 P255S possibly damaging Het
Chrna6 T A 8: 27,407,106 I248F probably damaging Het
Clip1 T C 5: 123,579,293 D1387G probably damaging Het
Clstn3 T C 6: 124,437,372 probably null Het
Cntnap5a C T 1: 116,101,565 R250W probably benign Het
Col12a1 C A 9: 79,678,494 V1228F possibly damaging Het
Cxcr5 T C 9: 44,513,341 T340A probably benign Het
Cyp2a4 G A 7: 26,312,875 R361K probably damaging Het
Dnah1 T A 14: 31,263,479 K3818N probably damaging Het
Dpy19l1 A T 9: 24,424,823 L529Q probably damaging Het
Eif4g2 C T 7: 111,076,796 R399H probably damaging Het
Fam160a1 G T 3: 85,688,570 T115K probably damaging Het
Fam76a A T 4: 132,902,117 probably null Het
Fam76a A G 4: 132,916,190 Y78H probably damaging Het
Fbn1 A T 2: 125,324,919 C2026S probably damaging Het
Fbxo4 T C 15: 3,969,041 T312A probably benign Het
Fbxw26 A G 9: 109,724,800 V257A possibly damaging Het
Flnb A T 14: 7,905,701 E1150D probably benign Het
Fndc3c1 A T X: 106,437,702 S661R possibly damaging Het
Gba2 A C 4: 43,568,315 L684R probably damaging Het
Gbf1 G T 19: 46,268,395 C812F possibly damaging Het
Glt8d2 A T 10: 82,660,749 D158E probably damaging Het
Golga2 T A 2: 32,297,156 N89K probably damaging Het
Got1 A G 19: 43,502,937 I358T possibly damaging Het
Gpx6 C T 13: 21,312,264 Q3* probably null Het
Grin1 T A 2: 25,292,381 H956L possibly damaging Het
Grin2d A G 7: 45,856,781 V562A probably damaging Het
Grm6 A G 11: 50,857,277 I405V probably benign Het
Hcar2 C G 5: 123,864,450 G330A probably benign Het
Hcfc1 T C X: 73,965,946 K20E probably damaging Het
Iars T A 13: 49,724,663 Y888N probably damaging Het
Ifi206 A T 1: 173,480,866 H521Q probably benign Het
Impg1 A G 9: 80,398,450 S112P probably benign Het
Incenp C A 19: 9,877,690 R619M unknown Het
Incenp T A 19: 9,877,691 R619W unknown Het
Kat2b A G 17: 53,653,203 E513G possibly damaging Het
Kbtbd12 G T 6: 88,618,021 L276I probably damaging Het
Kctd9 T A 14: 67,734,164 D229E probably damaging Het
Kdm1b C T 13: 47,063,077 R308W probably damaging Het
Kif2b G A 11: 91,576,428 P343L probably benign Het
Kntc1 T G 5: 123,816,762 M2081R possibly damaging Het
Lamc1 T C 1: 153,231,740 N1231S probably damaging Het
Lclat1 T A 17: 73,240,070 Y327* probably null Het
Lgals3bp G A 11: 118,393,514 T413I probably damaging Het
Lin54 A G 5: 100,459,738 I250T probably damaging Het
Lrp1 T C 10: 127,558,133 N2621S probably benign Het
Lrrtm3 T A 10: 64,088,002 H462L probably benign Het
Lysmd1 A G 3: 95,134,986 Y57C probably damaging Het
Mccc1 C A 3: 35,975,873 M429I probably damaging Het
Metrnl A G 11: 121,707,924 E40G probably benign Het
Mios T A 6: 8,222,464 M466K probably benign Het
Mrgpra1 A G 7: 47,335,470 S154P probably damaging Het
Mrpl24 T C 3: 87,922,050 probably null Het
Myo1f A G 17: 33,598,191 N736S possibly damaging Het
Myo1h A G 5: 114,360,599 I919V possibly damaging Het
Nampt T C 12: 32,848,714 L443P possibly damaging Het
Ndufaf2 C G 13: 108,052,780 A145P probably damaging Het
Nek10 A T 14: 14,855,714 T403S probably benign Het
Nme8 C A 13: 19,657,930 V219L probably damaging Het
Nov A T 15: 54,752,207 probably null Het
Nps T A 7: 135,268,788 L13Q probably damaging Het
Nutm1 G A 2: 112,248,936 A878V probably benign Het
Ogdh T C 11: 6,349,875 F794L probably damaging Het
Olfr1305 A T 2: 111,873,050 D268E possibly damaging Het
Olfr1441 A T 19: 12,422,977 I223F probably damaging Het
Olfr292 T C 7: 86,694,528 L24P probably damaging Het
Olfr305 C A 7: 86,363,735 G201C probably damaging Het
Olfr721-ps1 A C 14: 14,407,729 Y167S possibly damaging Het
Olfr998 A G 2: 85,590,938 T133A probably benign Het
Pik3cg T C 12: 32,205,199 E263G probably damaging Het
Pikfyve A G 1: 65,267,846 T1798A probably benign Het
Poldip3 T C 15: 83,131,501 Y305C probably damaging Het
Pqlc2 G T 4: 139,300,001 H343Q probably benign Het
Prkdc T C 16: 15,648,976 I107T probably benign Het
Prmt2 A G 10: 76,226,221 I50T probably damaging Het
Ptprd T C 4: 76,140,553 T168A probably benign Het
Pudp A G 18: 50,568,065 V199A probably damaging Het
Rab3c T C 13: 110,061,900 E198G probably benign Het
Rasl12 A G 9: 65,413,448 Y156C probably damaging Het
Rbm12 T C 2: 156,096,564 D596G possibly damaging Het
Rbm6 T C 9: 107,787,352 E694G probably benign Het
Rif1 T C 2: 52,112,747 V2071A probably damaging Het
Ripply2 A T 9: 87,019,796 N125I probably damaging Het
Rps6kc1 A T 1: 190,750,188 H284Q probably benign Het
Scara3 A T 14: 65,953,501 M1K probably null Het
Sfswap A G 5: 129,513,083 T215A probably damaging Het
Shroom2 A C X: 152,660,907 F421V probably benign Het
Sipa1l3 A G 7: 29,377,641 V902A probably damaging Het
Slamf8 G T 1: 172,584,214 P238Q probably damaging Het
Slc44a3 T C 3: 121,527,074 T93A possibly damaging Het
Slc5a7 A T 17: 54,278,700 I363N probably damaging Het
Slc7a2 T A 8: 40,911,058 M436K probably benign Het
Spindoc A G 19: 7,374,091 S223P probably benign Het
Stk11ip T C 1: 75,530,281 F669L possibly damaging Het
Sun3 G A 11: 9,038,266 L19F probably benign Het
Sycp1 C A 3: 102,853,489 A703S possibly damaging Het
Tas2r139 T G 6: 42,141,284 F117V probably damaging Het
Tdrd6 T C 17: 43,625,576 Y1527C probably damaging Het
Tenm4 A C 7: 96,774,046 K683Q probably damaging Het
Tfeb T A 17: 47,788,227 probably null Het
Tmco4 T C 4: 138,998,039 S121P probably damaging Het
Tmprss11d C T 5: 86,306,281 V222M probably damaging Het
Tnks1bp1 T C 2: 85,063,034 W440R probably damaging Het
Trp53bp2 A G 1: 182,448,997 T848A probably benign Het
Tssk1 G A 16: 17,895,062 R237H probably benign Het
Ttll4 A T 1: 74,679,007 T6S possibly damaging Het
Ttn G T 2: 76,721,797 Y29419* probably null Het
Ttn A G 2: 76,769,603 Y19076H probably damaging Het
Ubr3 T A 2: 69,959,603 V867D probably damaging Het
Usp29 A G 7: 6,961,391 T78A probably damaging Het
Utrn T G 10: 12,654,745 Q2108P probably benign Het
Vcan T C 13: 89,705,789 N351D probably damaging Het
Vmn1r61 A T 7: 5,611,125 Y63* probably null Het
Vmn1r61 A T 7: 5,611,127 Y63N probably benign Het
Vmn1r85 A T 7: 13,084,861 W119R probably damaging Het
Zbtb21 A C 16: 97,950,455 V190G possibly damaging Het
Zfp157 C A 5: 138,444,789 T14N probably damaging Het
Zfp942 A T 17: 21,929,419 H76Q probably damaging Het
Other mutations in Dnah3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00650:Dnah3 APN 7 119938905 missense possibly damaging 0.88
IGL01095:Dnah3 APN 7 119951597 missense probably benign 0.02
IGL01329:Dnah3 APN 7 120022941 missense probably damaging 1.00
IGL01380:Dnah3 APN 7 119926564 missense probably damaging 1.00
IGL01410:Dnah3 APN 7 119967720 missense possibly damaging 0.91
IGL01487:Dnah3 APN 7 119965530 nonsense probably null
IGL01843:Dnah3 APN 7 119943575 missense probably benign 0.12
IGL01929:Dnah3 APN 7 119951651 nonsense probably null
IGL01994:Dnah3 APN 7 119951214 missense possibly damaging 0.58
IGL02115:Dnah3 APN 7 120029054 missense probably damaging 1.00
IGL02273:Dnah3 APN 7 119951271 missense probably damaging 1.00
IGL02299:Dnah3 APN 7 119967579 missense probably benign 0.39
IGL02421:Dnah3 APN 7 119950992 missense possibly damaging 0.87
IGL02514:Dnah3 APN 7 119966247 missense probably damaging 1.00
IGL02596:Dnah3 APN 7 119938914 missense probably benign 0.19
IGL02716:Dnah3 APN 7 119937023 missense probably damaging 0.97
IGL02738:Dnah3 APN 7 119965497 missense probably benign
IGL03404:Dnah3 APN 7 119938977 missense probably damaging 1.00
BB004:Dnah3 UTSW 7 119951271 missense probably damaging 0.97
BB014:Dnah3 UTSW 7 119951271 missense probably damaging 0.97
R0011:Dnah3 UTSW 7 120019701 missense probably damaging 1.00
R0195:Dnah3 UTSW 7 120077775 critical splice donor site probably null
R0241:Dnah3 UTSW 7 119922730 missense probably damaging 1.00
R0241:Dnah3 UTSW 7 119922730 missense probably damaging 1.00
R0312:Dnah3 UTSW 7 120045659 missense probably damaging 1.00
R0316:Dnah3 UTSW 7 119965659 missense possibly damaging 0.94
R0370:Dnah3 UTSW 7 120086720 missense possibly damaging 0.91
R0426:Dnah3 UTSW 7 119943572 missense probably benign 0.11
R0525:Dnah3 UTSW 7 119928754 missense probably damaging 1.00
R0625:Dnah3 UTSW 7 120071887 missense possibly damaging 0.68
R0627:Dnah3 UTSW 7 120020915 missense probably damaging 1.00
R0632:Dnah3 UTSW 7 119967905 missense probably benign 0.11
R0928:Dnah3 UTSW 7 120030051 missense probably damaging 1.00
R0964:Dnah3 UTSW 7 119952739 splice site probably benign
R0972:Dnah3 UTSW 7 120035340 splice site probably null
R1066:Dnah3 UTSW 7 120061009 missense probably damaging 1.00
R1082:Dnah3 UTSW 7 120078445 missense probably damaging 1.00
R1127:Dnah3 UTSW 7 119923030 missense probably damaging 1.00
R1132:Dnah3 UTSW 7 119939004 missense possibly damaging 0.50
R1222:Dnah3 UTSW 7 120090676 missense probably benign 0.28
R1420:Dnah3 UTSW 7 119951979 missense probably damaging 0.99
R1456:Dnah3 UTSW 7 120047630 missense probably damaging 1.00
R1472:Dnah3 UTSW 7 120070958 missense probably benign 0.12
R1617:Dnah3 UTSW 7 120089946 missense probably benign 0.01
R1624:Dnah3 UTSW 7 120019695 missense probably damaging 0.99
R1654:Dnah3 UTSW 7 119926449 missense probably damaging 1.00
R1673:Dnah3 UTSW 7 119971179 nonsense probably null
R1677:Dnah3 UTSW 7 119928740 missense probably damaging 1.00
R1687:Dnah3 UTSW 7 120045786 splice site probably null
R1711:Dnah3 UTSW 7 120078571 missense probably damaging 1.00
R1738:Dnah3 UTSW 7 120035359 missense probably damaging 1.00
R1778:Dnah3 UTSW 7 120078402 missense probably damaging 1.00
R1866:Dnah3 UTSW 7 119928856 splice site probably null
R1883:Dnah3 UTSW 7 120077919 missense probably benign 0.06
R1894:Dnah3 UTSW 7 120086334 missense probably benign 0.05
R1929:Dnah3 UTSW 7 119975129 missense probably benign 0.10
R1988:Dnah3 UTSW 7 119967570 missense possibly damaging 0.92
R1988:Dnah3 UTSW 7 119967959 missense probably damaging 0.99
R2010:Dnah3 UTSW 7 120095177 start codon destroyed probably benign 0.00
R2022:Dnah3 UTSW 7 119951242 missense probably damaging 1.00
R2026:Dnah3 UTSW 7 120039406 missense probably damaging 1.00
R2063:Dnah3 UTSW 7 119951909 missense probably damaging 0.96
R2131:Dnah3 UTSW 7 119967759 missense possibly damaging 0.93
R2152:Dnah3 UTSW 7 119952013 missense probably benign 0.02
R2199:Dnah3 UTSW 7 119951569 missense possibly damaging 0.89
R2271:Dnah3 UTSW 7 119975129 missense probably benign 0.10
R2350:Dnah3 UTSW 7 120045788 splice site probably null
R2567:Dnah3 UTSW 7 119952697 missense possibly damaging 0.83
R2848:Dnah3 UTSW 7 119967938 missense probably benign 0.01
R2902:Dnah3 UTSW 7 119951499 missense possibly damaging 0.61
R2926:Dnah3 UTSW 7 119951115 missense probably damaging 1.00
R2944:Dnah3 UTSW 7 119951110 missense probably damaging 1.00
R3022:Dnah3 UTSW 7 120078481 missense possibly damaging 0.93
R3401:Dnah3 UTSW 7 119967656 missense probably benign 0.00
R3402:Dnah3 UTSW 7 119967656 missense probably benign 0.00
R3403:Dnah3 UTSW 7 119967656 missense probably benign 0.00
R3919:Dnah3 UTSW 7 119951080 missense probably damaging 1.00
R3972:Dnah3 UTSW 7 120086720 missense probably damaging 0.99
R4162:Dnah3 UTSW 7 119922838 missense probably damaging 1.00
R4184:Dnah3 UTSW 7 120083293 missense probably damaging 1.00
R4198:Dnah3 UTSW 7 119922838 missense probably damaging 1.00
R4199:Dnah3 UTSW 7 119922838 missense probably damaging 1.00
R4200:Dnah3 UTSW 7 119922838 missense probably damaging 1.00
R4239:Dnah3 UTSW 7 120029025 nonsense probably null
R4478:Dnah3 UTSW 7 120071863 missense probably benign 0.00
R4579:Dnah3 UTSW 7 120009331 missense probably damaging 1.00
R4600:Dnah3 UTSW 7 120089946 missense probably benign
R4649:Dnah3 UTSW 7 120047698 missense probably damaging 1.00
R4658:Dnah3 UTSW 7 119950651 missense probably damaging 1.00
R4728:Dnah3 UTSW 7 120059366 missense probably damaging 0.99
R4739:Dnah3 UTSW 7 120077946 missense possibly damaging 0.54
R4758:Dnah3 UTSW 7 120079406 missense probably benign 0.00
R4789:Dnah3 UTSW 7 120011072 missense probably damaging 1.00
R4930:Dnah3 UTSW 7 119951681 nonsense probably null
R4935:Dnah3 UTSW 7 120016477 nonsense probably null
R4946:Dnah3 UTSW 7 119931560 missense probably damaging 1.00
R4981:Dnah3 UTSW 7 119956201 missense probably benign 0.03
R4984:Dnah3 UTSW 7 119928779 missense probably benign 0.04
R5025:Dnah3 UTSW 7 120071905 missense probably benign 0.02
R5046:Dnah3 UTSW 7 119951580 missense probably damaging 1.00
R5056:Dnah3 UTSW 7 120020946 missense probably damaging 1.00
R5068:Dnah3 UTSW 7 120032790 missense probably benign
R5069:Dnah3 UTSW 7 120032790 missense probably benign
R5154:Dnah3 UTSW 7 119952419 missense probably damaging 1.00
R5208:Dnah3 UTSW 7 120032638 missense probably damaging 1.00
R5323:Dnah3 UTSW 7 120021011 missense probably damaging 1.00
R5330:Dnah3 UTSW 7 119943648 missense probably benign 0.00
R5385:Dnah3 UTSW 7 119924903 missense probably damaging 1.00
R5391:Dnah3 UTSW 7 120090076 missense probably benign 0.02
R5564:Dnah3 UTSW 7 119971466 critical splice donor site probably null
R5594:Dnah3 UTSW 7 119971621 missense possibly damaging 0.89
R5610:Dnah3 UTSW 7 119939065 intron probably null
R5673:Dnah3 UTSW 7 119951589 missense possibly damaging 0.91
R5678:Dnah3 UTSW 7 120077851 missense probably benign 0.00
R5737:Dnah3 UTSW 7 120059198 missense probably benign 0.03
R5766:Dnah3 UTSW 7 119978222 missense probably damaging 1.00
R5769:Dnah3 UTSW 7 120089952 nonsense probably null
R5789:Dnah3 UTSW 7 119943599 missense possibly damaging 0.70
R5791:Dnah3 UTSW 7 119931473 missense probably benign 0.00
R5841:Dnah3 UTSW 7 119951021 utr 3 prime probably benign
R5843:Dnah3 UTSW 7 119951021 utr 3 prime probably benign
R5844:Dnah3 UTSW 7 119951021 utr 3 prime probably benign
R5846:Dnah3 UTSW 7 119951021 utr 3 prime probably benign
R5851:Dnah3 UTSW 7 120039362 missense possibly damaging 0.51
R5853:Dnah3 UTSW 7 119938833 missense probably damaging 1.00
R5857:Dnah3 UTSW 7 119951021 utr 3 prime probably benign
R5865:Dnah3 UTSW 7 119975108 missense probably benign 0.00
R5885:Dnah3 UTSW 7 120069704 missense probably benign 0.10
R5898:Dnah3 UTSW 7 120078501 missense probably benign 0.37
R5917:Dnah3 UTSW 7 120016526 missense probably damaging 1.00
R5964:Dnah3 UTSW 7 119922880 missense probably benign 0.00
R5990:Dnah3 UTSW 7 120073541 missense probably benign
R6004:Dnah3 UTSW 7 120086297 missense probably benign 0.10
R6033:Dnah3 UTSW 7 120071647 missense probably benign 0.00
R6033:Dnah3 UTSW 7 120071647 missense probably benign 0.00
R6045:Dnah3 UTSW 7 119967522 missense probably damaging 0.99
R6056:Dnah3 UTSW 7 120030031 missense probably damaging 1.00
R6133:Dnah3 UTSW 7 120086246 missense probably benign 0.10
R6229:Dnah3 UTSW 7 119965488 missense probably benign 0.11
R6237:Dnah3 UTSW 7 120009384 missense probably damaging 1.00
R6333:Dnah3 UTSW 7 120054633 missense probably damaging 1.00
R6408:Dnah3 UTSW 7 119922968 unclassified probably null
R6447:Dnah3 UTSW 7 119923054 missense probably benign 0.12
R6606:Dnah3 UTSW 7 120060956 missense probably benign 0.02
R6666:Dnah3 UTSW 7 120070949 missense probably benign 0.16
R6733:Dnah3 UTSW 7 119922974 missense probably benign 0.22
R6815:Dnah3 UTSW 7 119971727 missense probably benign
R6882:Dnah3 UTSW 7 119971184 missense possibly damaging 0.95
R6934:Dnah3 UTSW 7 120054601 critical splice donor site probably null
R6966:Dnah3 UTSW 7 120032754 missense probably damaging 1.00
R7025:Dnah3 UTSW 7 120030010 missense possibly damaging 0.90
R7207:Dnah3 UTSW 7 119971089 missense probably damaging 1.00
R7214:Dnah3 UTSW 7 119922742 missense probably damaging 1.00
R7222:Dnah3 UTSW 7 120071523 missense probably benign 0.00
R7235:Dnah3 UTSW 7 120032670 missense probably damaging 1.00
R7241:Dnah3 UTSW 7 119943633 missense probably benign 0.03
R7313:Dnah3 UTSW 7 119981344 missense probably benign 0.39
R7342:Dnah3 UTSW 7 120029985 missense probably damaging 1.00
R7368:Dnah3 UTSW 7 120029016 missense probably benign
R7375:Dnah3 UTSW 7 119951677 missense probably damaging 1.00
R7395:Dnah3 UTSW 7 119966251 missense
R7395:Dnah3 UTSW 7 120060960 missense probably benign 0.00
R7431:Dnah3 UTSW 7 120051744 missense probably damaging 1.00
R7499:Dnah3 UTSW 7 120060912 missense probably damaging 0.99
R7515:Dnah3 UTSW 7 120073592 missense probably benign 0.21
R7564:Dnah3 UTSW 7 119971594 missense probably benign
R7618:Dnah3 UTSW 7 119978378 missense probably damaging 0.97
R7697:Dnah3 UTSW 7 119967434 missense
R7728:Dnah3 UTSW 7 119938828 missense probably damaging 1.00
R7757:Dnah3 UTSW 7 120071570 missense probably benign
R7757:Dnah3 UTSW 7 119971215 splice site probably null
R7774:Dnah3 UTSW 7 119951752 nonsense probably null
R7804:Dnah3 UTSW 7 119952618 missense probably damaging 1.00
R7804:Dnah3 UTSW 7 120011012 missense probably damaging 1.00
R7857:Dnah3 UTSW 7 119951704 missense probably damaging 1.00
R7871:Dnah3 UTSW 7 119967552 missense
R7903:Dnah3 UTSW 7 120042128 missense probably damaging 1.00
R7927:Dnah3 UTSW 7 119951271 missense probably damaging 0.97
R7989:Dnah3 UTSW 7 120077789 missense probably benign
R8142:Dnah3 UTSW 7 120060966 missense probably benign 0.00
R8164:Dnah3 UTSW 7 119967614 missense probably damaging 1.00
R8237:Dnah3 UTSW 7 119926413 missense probably benign 0.01
R8313:Dnah3 UTSW 7 119951152 missense probably benign 0.38
R8338:Dnah3 UTSW 7 120071881 missense probably benign 0.01
R8355:Dnah3 UTSW 7 119952208 missense probably damaging 1.00
Z1088:Dnah3 UTSW 7 120010873 missense probably null 1.00
Z1088:Dnah3 UTSW 7 120086297 missense probably benign 0.00
Z1176:Dnah3 UTSW 7 119967803 missense
Z1177:Dnah3 UTSW 7 119967901 missense probably damaging 0.99
Z1177:Dnah3 UTSW 7 120007862 missense probably benign
Predicted Primers PCR Primer
(F):5'- ATCTGGTTATCCGAGAAGAGGAAC -3'
(R):5'- TCGGGGATTATTTGAAGCCAG -3'

Sequencing Primer
(F):5'- AACACAGTACTCTTGGTGGC -3'
(R):5'- GATTATTTGAAGCCAGAAAGTGACC -3'
Posted On2015-12-29