Incidental Mutation 'R4785:Rasl12'
ID 366976
Institutional Source Beutler Lab
Gene Symbol Rasl12
Ensembl Gene ENSMUSG00000041696
Gene Name RAS-like, family 12
Synonyms 4631404I11Rik
MMRRC Submission 042417-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.082) question?
Stock # R4785 (G1)
Quality Score 225
Status Not validated
Chromosome 9
Chromosomal Location 65305788-65322135 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 65320730 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Tyrosine to Cysteine at position 156 (Y156C)
Ref Sequence ENSEMBL: ENSMUSP00000131837 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000065894] [ENSMUST00000085453] [ENSMUST00000165682] [ENSMUST00000217172]
AlphaFold Q08AT1
Predicted Effect probably benign
Transcript: ENSMUST00000065894
SMART Domains Protein: ENSMUSP00000064494
Gene: ENSMUSG00000053862

DomainStartEndE-ValueType
Pfam:OSTbeta 1 122 1.1e-55 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000085453
SMART Domains Protein: ENSMUSP00000082580
Gene: ENSMUSG00000041696

DomainStartEndE-ValueType
Pfam:Arf 15 154 4e-7 PFAM
Pfam:Roc 22 138 1.5e-8 PFAM
Pfam:Ras 22 185 9.7e-33 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000165682
AA Change: Y156C

PolyPhen 2 Score 0.993 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000131837
Gene: ENSMUSG00000041696
AA Change: Y156C

DomainStartEndE-ValueType
Pfam:Arf 15 155 3.9e-8 PFAM
Pfam:Miro 22 137 9.2e-14 PFAM
Pfam:Ras 22 159 1.7e-23 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000217172
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 94.4%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 145 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4921517D22Rik T C 13: 59,839,406 (GRCm39) D13G probably benign Het
4930442H23Rik C T 10: 81,018,978 (GRCm39) probably benign Het
Adamts13 T A 2: 26,873,054 (GRCm39) S341T probably damaging Het
Adamts2 A G 11: 50,683,549 (GRCm39) I944V probably benign Het
Adcy3 A G 12: 4,256,542 (GRCm39) T783A probably benign Het
Ago3 A T 4: 126,262,296 (GRCm39) M418K probably benign Het
Alpk1 G T 3: 127,481,241 (GRCm39) N175K possibly damaging Het
Als2 A G 1: 59,254,472 (GRCm39) V295A probably benign Het
Anapc13 T C 9: 102,507,020 (GRCm39) I11T probably benign Het
Ankrd12 T A 17: 66,289,994 (GRCm39) N1813I probably damaging Het
Anks1b A T 10: 90,750,612 (GRCm39) I176F probably null Het
Ap3d1 TTCTCTCTCTCTCTCTCT TTCTCTCTCTCTCTCT 10: 80,548,612 (GRCm39) probably null Het
Arhgap32 T C 9: 32,172,076 (GRCm39) C1619R probably damaging Het
Arhgap32 A G 9: 32,040,949 (GRCm39) D67G probably damaging Het
Atp1a4 A T 1: 172,081,677 (GRCm39) Y158* probably null Het
Atp8b5 A T 4: 43,356,980 (GRCm39) D576V probably damaging Het
Atrnl1 A G 19: 57,617,590 (GRCm39) I122V probably damaging Het
B430203G13Rik A T 12: 17,974,520 (GRCm39) noncoding transcript Het
Baz1b T G 5: 135,246,267 (GRCm39) L572R possibly damaging Het
Ccn3 A T 15: 54,615,603 (GRCm39) probably null Het
Ccnd2 T C 6: 127,125,761 (GRCm39) T92A possibly damaging Het
Ccndbp1 A T 2: 120,839,003 (GRCm39) T5S probably benign Het
Ccr2 G A 9: 123,906,409 (GRCm39) V230I probably benign Het
Cct4 T A 11: 22,952,866 (GRCm39) V514E probably damaging Het
Cep152 A G 2: 125,428,249 (GRCm39) probably null Het
Cflar C T 1: 58,791,726 (GRCm39) T343M probably benign Het
Chrm5 A C 2: 112,309,930 (GRCm39) N395K probably benign Het
Chrna10 G A 7: 101,762,426 (GRCm39) P255S possibly damaging Het
Chrna6 T A 8: 27,897,134 (GRCm39) I248F probably damaging Het
Clip1 T C 5: 123,717,356 (GRCm39) D1387G probably damaging Het
Clstn3 T C 6: 124,414,331 (GRCm39) probably null Het
Cntnap5a C T 1: 116,029,295 (GRCm39) R250W probably benign Het
Col12a1 C A 9: 79,585,776 (GRCm39) V1228F possibly damaging Het
Cxcr5 T C 9: 44,424,638 (GRCm39) T340A probably benign Het
Cyp2a4 G A 7: 26,012,300 (GRCm39) R361K probably damaging Het
Dnah1 T A 14: 30,985,436 (GRCm39) K3818N probably damaging Het
Dnah3 T A 7: 119,567,047 (GRCm39) K2393M probably benign Het
Dpy19l1 A T 9: 24,336,119 (GRCm39) L529Q probably damaging Het
Eif4g2 C T 7: 110,676,003 (GRCm39) R399H probably damaging Het
Elapor1 A T 3: 108,365,543 (GRCm39) probably benign Het
Fam76a A T 4: 132,629,428 (GRCm39) probably null Het
Fam76a A G 4: 132,643,501 (GRCm39) Y78H probably damaging Het
Fbn1 A T 2: 125,166,839 (GRCm39) C2026S probably damaging Het
Fbxo4 T C 15: 3,998,523 (GRCm39) T312A probably benign Het
Fbxw26 A G 9: 109,553,868 (GRCm39) V257A possibly damaging Het
Fhip1a G T 3: 85,595,877 (GRCm39) T115K probably damaging Het
Flnb A T 14: 7,905,701 (GRCm38) E1150D probably benign Het
Fndc3c1 A T X: 105,481,308 (GRCm39) S661R possibly damaging Het
Gba2 A C 4: 43,568,315 (GRCm39) L684R probably damaging Het
Gbf1 G T 19: 46,256,834 (GRCm39) C812F possibly damaging Het
Glt8d2 A T 10: 82,496,583 (GRCm39) D158E probably damaging Het
Golga2 T A 2: 32,187,168 (GRCm39) N89K probably damaging Het
Got1 A G 19: 43,491,376 (GRCm39) I358T possibly damaging Het
Gpx6 C T 13: 21,496,434 (GRCm39) Q3* probably null Het
Grin1 T A 2: 25,182,393 (GRCm39) H956L possibly damaging Het
Grin2d A G 7: 45,506,205 (GRCm39) V562A probably damaging Het
Grm6 A G 11: 50,748,104 (GRCm39) I405V probably benign Het
Hcar2 C G 5: 124,002,513 (GRCm39) G330A probably benign Het
Hcfc1 T C X: 73,009,552 (GRCm39) K20E probably damaging Het
Iars1 T A 13: 49,878,139 (GRCm39) Y888N probably damaging Het
Ifi206 A T 1: 173,308,432 (GRCm39) H521Q probably benign Het
Impg1 A G 9: 80,305,732 (GRCm39) S112P probably benign Het
Incenp C A 19: 9,855,054 (GRCm39) R619M unknown Het
Incenp T A 19: 9,855,055 (GRCm39) R619W unknown Het
Kat2b A G 17: 53,960,231 (GRCm39) E513G possibly damaging Het
Kbtbd12 G T 6: 88,595,003 (GRCm39) L276I probably damaging Het
Kctd9 T A 14: 67,971,613 (GRCm39) D229E probably damaging Het
Kdm1b C T 13: 47,216,553 (GRCm39) R308W probably damaging Het
Kif2b G A 11: 91,467,254 (GRCm39) P343L probably benign Het
Kntc1 T G 5: 123,954,825 (GRCm39) M2081R possibly damaging Het
Lamc1 T C 1: 153,107,486 (GRCm39) N1231S probably damaging Het
Lclat1 T A 17: 73,547,065 (GRCm39) Y327* probably null Het
Lgals3bp G A 11: 118,284,340 (GRCm39) T413I probably damaging Het
Lin54 A G 5: 100,607,597 (GRCm39) I250T probably damaging Het
Lrp1 T C 10: 127,394,002 (GRCm39) N2621S probably benign Het
Lrrtm3 T A 10: 63,923,781 (GRCm39) H462L probably benign Het
Lysmd1 A G 3: 95,042,297 (GRCm39) Y57C probably damaging Het
Mccc1 C A 3: 36,030,022 (GRCm39) M429I probably damaging Het
Metrnl A G 11: 121,598,750 (GRCm39) E40G probably benign Het
Mios T A 6: 8,222,464 (GRCm39) M466K probably benign Het
Mrgpra1 A G 7: 46,985,218 (GRCm39) S154P probably damaging Het
Mrpl24 T C 3: 87,829,357 (GRCm39) probably null Het
Myo1f A G 17: 33,817,165 (GRCm39) N736S possibly damaging Het
Myo1h A G 5: 114,498,660 (GRCm39) I919V possibly damaging Het
Nampt T C 12: 32,898,713 (GRCm39) L443P possibly damaging Het
Ndufaf2 C G 13: 108,189,314 (GRCm39) A145P probably damaging Het
Nek10 A T 14: 14,855,714 (GRCm38) T403S probably benign Het
Nme8 C A 13: 19,842,100 (GRCm39) V219L probably damaging Het
Nps T A 7: 134,870,517 (GRCm39) L13Q probably damaging Het
Nutm1 G A 2: 112,079,281 (GRCm39) A878V probably benign Het
Ogdh T C 11: 6,299,875 (GRCm39) F794L probably damaging Het
Or14a259 C A 7: 86,012,943 (GRCm39) G201C probably damaging Het
Or14c39 T C 7: 86,343,736 (GRCm39) L24P probably damaging Het
Or2t35 A C 14: 14,407,729 (GRCm38) Y167S possibly damaging Het
Or4f56 A T 2: 111,703,395 (GRCm39) D268E possibly damaging Het
Or5a3 A T 19: 12,400,341 (GRCm39) I223F probably damaging Het
Or5g29 A G 2: 85,421,282 (GRCm39) T133A probably benign Het
Pik3cg T C 12: 32,255,198 (GRCm39) E263G probably damaging Het
Pikfyve A G 1: 65,307,005 (GRCm39) T1798A probably benign Het
Poldip3 T C 15: 83,015,702 (GRCm39) Y305C probably damaging Het
Prkdc T C 16: 15,466,840 (GRCm39) I107T probably benign Het
Prmt2 A G 10: 76,062,055 (GRCm39) I50T probably damaging Het
Ptprd T C 4: 76,058,790 (GRCm39) T168A probably benign Het
Pudp A G 18: 50,701,136 (GRCm39) V199A probably damaging Het
Rab3c T C 13: 110,198,434 (GRCm39) E198G probably benign Het
Rbm12 T C 2: 155,938,484 (GRCm39) D596G possibly damaging Het
Rbm6 T C 9: 107,664,551 (GRCm39) E694G probably benign Het
Rif1 T C 2: 52,002,759 (GRCm39) V2071A probably damaging Het
Ripply2 A T 9: 86,901,849 (GRCm39) N125I probably damaging Het
Rps6kc1 A T 1: 190,482,385 (GRCm39) H284Q probably benign Het
Scara3 A T 14: 66,190,950 (GRCm39) M1K probably null Het
Sfswap A G 5: 129,590,147 (GRCm39) T215A probably damaging Het
Shroom2 A C X: 151,443,903 (GRCm39) F421V probably benign Het
Sipa1l3 A G 7: 29,077,066 (GRCm39) V902A probably damaging Het
Slamf8 G T 1: 172,411,781 (GRCm39) P238Q probably damaging Het
Slc44a3 T C 3: 121,320,723 (GRCm39) T93A possibly damaging Het
Slc5a7 A T 17: 54,585,728 (GRCm39) I363N probably damaging Het
Slc66a1 G T 4: 139,027,312 (GRCm39) H343Q probably benign Het
Slc7a2 T A 8: 41,364,095 (GRCm39) M436K probably benign Het
Spindoc A G 19: 7,351,456 (GRCm39) S223P probably benign Het
Stk11ip T C 1: 75,506,925 (GRCm39) F669L possibly damaging Het
Sun3 G A 11: 8,988,266 (GRCm39) L19F probably benign Het
Sycp1 C A 3: 102,760,805 (GRCm39) A703S possibly damaging Het
Tas2r139 T G 6: 42,118,218 (GRCm39) F117V probably damaging Het
Tdrd6 T C 17: 43,936,467 (GRCm39) Y1527C probably damaging Het
Tenm4 A C 7: 96,423,253 (GRCm39) K683Q probably damaging Het
Tfeb T A 17: 48,099,152 (GRCm39) probably null Het
Tmco4 T C 4: 138,725,350 (GRCm39) S121P probably damaging Het
Tmprss11d C T 5: 86,454,140 (GRCm39) V222M probably damaging Het
Tnks1bp1 T C 2: 84,893,378 (GRCm39) W440R probably damaging Het
Trp53bp2 A G 1: 182,276,562 (GRCm39) T848A probably benign Het
Tssk1 G A 16: 17,712,926 (GRCm39) R237H probably benign Het
Ttll4 A T 1: 74,718,166 (GRCm39) T6S possibly damaging Het
Ttn G T 2: 76,552,141 (GRCm39) Y29419* probably null Het
Ttn A G 2: 76,599,947 (GRCm39) Y19076H probably damaging Het
Ubr3 T A 2: 69,789,947 (GRCm39) V867D probably damaging Het
Usp29 A G 7: 6,964,390 (GRCm39) T78A probably damaging Het
Utrn T G 10: 12,530,489 (GRCm39) Q2108P probably benign Het
Vcan T C 13: 89,853,908 (GRCm39) N351D probably damaging Het
Vmn1r61 A T 7: 5,614,124 (GRCm39) Y63* probably null Het
Vmn1r61 A T 7: 5,614,126 (GRCm39) Y63N probably benign Het
Vmn1r85 A T 7: 12,818,788 (GRCm39) W119R probably damaging Het
Zbtb21 A C 16: 97,751,655 (GRCm39) V190G possibly damaging Het
Zfp157 C A 5: 138,443,051 (GRCm39) T14N probably damaging Het
Zfp942 A T 17: 22,148,400 (GRCm39) H76Q probably damaging Het
Other mutations in Rasl12
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01942:Rasl12 APN 9 65,315,644 (GRCm39) missense probably damaging 1.00
IGL02268:Rasl12 APN 9 65,305,946 (GRCm39) missense probably damaging 1.00
IGL02293:Rasl12 APN 9 65,315,593 (GRCm39) missense probably benign 0.02
R0755:Rasl12 UTSW 9 65,318,241 (GRCm39) missense probably benign
R1334:Rasl12 UTSW 9 65,318,151 (GRCm39) missense probably damaging 1.00
R2063:Rasl12 UTSW 9 65,318,106 (GRCm39) missense probably damaging 1.00
R2872:Rasl12 UTSW 9 65,315,605 (GRCm39) missense probably benign 0.10
R2872:Rasl12 UTSW 9 65,315,605 (GRCm39) missense probably benign 0.10
R2874:Rasl12 UTSW 9 65,315,605 (GRCm39) missense probably benign 0.10
R4456:Rasl12 UTSW 9 65,305,866 (GRCm39) missense probably null 1.00
R5391:Rasl12 UTSW 9 65,305,949 (GRCm39) missense probably damaging 0.96
R7008:Rasl12 UTSW 9 65,318,151 (GRCm39) missense probably damaging 1.00
R8964:Rasl12 UTSW 9 65,314,913 (GRCm39) missense probably damaging 1.00
X0058:Rasl12 UTSW 9 65,315,611 (GRCm39) missense possibly damaging 0.92
Predicted Primers PCR Primer
(F):5'- GTGACCTTTCTCCAAAGCACATG -3'
(R):5'- TTACCCTGTCAGAAAGCATCCC -3'

Sequencing Primer
(F):5'- TTCTCCAAAGCACATGATCCTG -3'
(R):5'- CTTTCAGCAAACTCAACTGAGAG -3'
Posted On 2015-12-29