Incidental Mutation 'R4785:Ap3d1'
ID366988
Institutional Source Beutler Lab
Gene Symbol Ap3d1
Ensembl Gene ENSMUSG00000020198
Gene Nameadaptor-related protein complex 3, delta 1 subunit
SynonymsmBLVR1, Bolvr
MMRRC Submission 042417-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.584) question?
Stock #R4785 (G1)
Quality Score106
Status Not validated
Chromosome10
Chromosomal Location80706956-80742264 bp(-) (GRCm38)
Type of Mutationframe shift
DNA Base Change (assembly) TTCTCTCTCTCTCTCTCT to TTCTCTCTCTCTCTCT at 80712778 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000020420 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000020420] [ENSMUST00000218610]
Predicted Effect probably null
Transcript: ENSMUST00000020420
SMART Domains Protein: ENSMUSP00000020420
Gene: ENSMUSG00000020198

DomainStartEndE-ValueType
Pfam:Adaptin_N 32 583 6.6e-153 PFAM
Pfam:Cnd1 130 292 2.1e-8 PFAM
low complexity region 629 642 N/A INTRINSIC
BLVR 660 803 5.3e-80 SMART
low complexity region 835 861 N/A INTRINSIC
low complexity region 871 881 N/A INTRINSIC
coiled coil region 910 933 N/A INTRINSIC
low complexity region 947 964 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000218125
Predicted Effect probably benign
Transcript: ENSMUST00000218610
Predicted Effect noncoding transcript
Transcript: ENSMUST00000219816
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 94.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a subunit of the AP3 adaptor-like complex, which is not clathrin-associated, but is associated with the golgi region, as well as more peripheral structures. The AP-3 complex facilitates the budding of vesicles from the golgi membrane, and may be directly involved in trafficking to lysosomes. This subunit is implicated in intracellular biogenesis and trafficking of pigment granules, and possibly platelet dense granules and neurotransmitter vesicles. Defects in this gene are a cause of a new type of Hermansky-Pudlak syndrome. [provided by RefSeq, Feb 2017]
PHENOTYPE: Mutant mice show coat and eye color dilution, platelet defects, lysosomal abnormalities, inner ear degeneration and neurological defects and model Hermansky-Pudlak storage pool deficiency syndrome. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 145 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4921517D22Rik T C 13: 59,691,592 D13G probably benign Het
4930442H23Rik C T 10: 81,183,144 probably benign Het
5330417C22Rik A T 3: 108,458,227 probably benign Het
Adamts13 T A 2: 26,983,042 S341T probably damaging Het
Adamts2 A G 11: 50,792,722 I944V probably benign Het
Adcy3 A G 12: 4,206,542 T783A probably benign Het
Ago3 A T 4: 126,368,503 M418K probably benign Het
Alpk1 G T 3: 127,687,592 N175K possibly damaging Het
Als2 A G 1: 59,215,313 V295A probably benign Het
Anapc13 T C 9: 102,629,821 I11T probably benign Het
Ankrd12 T A 17: 65,982,999 N1813I probably damaging Het
Anks1b A T 10: 90,914,750 I176F probably null Het
Arhgap32 A G 9: 32,129,653 D67G probably damaging Het
Arhgap32 T C 9: 32,260,780 C1619R probably damaging Het
Atp1a4 A T 1: 172,254,110 Y158* probably null Het
Atp8b5 A T 4: 43,356,980 D576V probably damaging Het
Atrnl1 A G 19: 57,629,158 I122V probably damaging Het
B430203G13Rik A T 12: 17,924,519 noncoding transcript Het
Baz1b T G 5: 135,217,413 L572R possibly damaging Het
Ccnd2 T C 6: 127,148,798 T92A possibly damaging Het
Ccndbp1 A T 2: 121,008,522 T5S probably benign Het
Ccr2 G A 9: 124,106,372 V230I probably benign Het
Cct4 T A 11: 23,002,866 V514E probably damaging Het
Cep152 A G 2: 125,586,329 probably null Het
Cflar C T 1: 58,752,567 T343M probably benign Het
Chrm5 A C 2: 112,479,585 N395K probably benign Het
Chrna10 G A 7: 102,113,219 P255S possibly damaging Het
Chrna6 T A 8: 27,407,106 I248F probably damaging Het
Clip1 T C 5: 123,579,293 D1387G probably damaging Het
Clstn3 T C 6: 124,437,372 probably null Het
Cntnap5a C T 1: 116,101,565 R250W probably benign Het
Col12a1 C A 9: 79,678,494 V1228F possibly damaging Het
Cxcr5 T C 9: 44,513,341 T340A probably benign Het
Cyp2a4 G A 7: 26,312,875 R361K probably damaging Het
Dnah1 T A 14: 31,263,479 K3818N probably damaging Het
Dnah3 T A 7: 119,967,824 K2393M probably benign Het
Dpy19l1 A T 9: 24,424,823 L529Q probably damaging Het
Eif4g2 C T 7: 111,076,796 R399H probably damaging Het
Fam160a1 G T 3: 85,688,570 T115K probably damaging Het
Fam76a A T 4: 132,902,117 probably null Het
Fam76a A G 4: 132,916,190 Y78H probably damaging Het
Fbn1 A T 2: 125,324,919 C2026S probably damaging Het
Fbxo4 T C 15: 3,969,041 T312A probably benign Het
Fbxw26 A G 9: 109,724,800 V257A possibly damaging Het
Flnb A T 14: 7,905,701 E1150D probably benign Het
Fndc3c1 A T X: 106,437,702 S661R possibly damaging Het
Gba2 A C 4: 43,568,315 L684R probably damaging Het
Gbf1 G T 19: 46,268,395 C812F possibly damaging Het
Glt8d2 A T 10: 82,660,749 D158E probably damaging Het
Golga2 T A 2: 32,297,156 N89K probably damaging Het
Got1 A G 19: 43,502,937 I358T possibly damaging Het
Gpx6 C T 13: 21,312,264 Q3* probably null Het
Grin1 T A 2: 25,292,381 H956L possibly damaging Het
Grin2d A G 7: 45,856,781 V562A probably damaging Het
Grm6 A G 11: 50,857,277 I405V probably benign Het
Hcar2 C G 5: 123,864,450 G330A probably benign Het
Hcfc1 T C X: 73,965,946 K20E probably damaging Het
Iars T A 13: 49,724,663 Y888N probably damaging Het
Ifi206 A T 1: 173,480,866 H521Q probably benign Het
Impg1 A G 9: 80,398,450 S112P probably benign Het
Incenp C A 19: 9,877,690 R619M unknown Het
Incenp T A 19: 9,877,691 R619W unknown Het
Kat2b A G 17: 53,653,203 E513G possibly damaging Het
Kbtbd12 G T 6: 88,618,021 L276I probably damaging Het
Kctd9 T A 14: 67,734,164 D229E probably damaging Het
Kdm1b C T 13: 47,063,077 R308W probably damaging Het
Kif2b G A 11: 91,576,428 P343L probably benign Het
Kntc1 T G 5: 123,816,762 M2081R possibly damaging Het
Lamc1 T C 1: 153,231,740 N1231S probably damaging Het
Lclat1 T A 17: 73,240,070 Y327* probably null Het
Lgals3bp G A 11: 118,393,514 T413I probably damaging Het
Lin54 A G 5: 100,459,738 I250T probably damaging Het
Lrp1 T C 10: 127,558,133 N2621S probably benign Het
Lrrtm3 T A 10: 64,088,002 H462L probably benign Het
Lysmd1 A G 3: 95,134,986 Y57C probably damaging Het
Mccc1 C A 3: 35,975,873 M429I probably damaging Het
Metrnl A G 11: 121,707,924 E40G probably benign Het
Mios T A 6: 8,222,464 M466K probably benign Het
Mrgpra1 A G 7: 47,335,470 S154P probably damaging Het
Mrpl24 T C 3: 87,922,050 probably null Het
Myo1f A G 17: 33,598,191 N736S possibly damaging Het
Myo1h A G 5: 114,360,599 I919V possibly damaging Het
Nampt T C 12: 32,848,714 L443P possibly damaging Het
Ndufaf2 C G 13: 108,052,780 A145P probably damaging Het
Nek10 A T 14: 14,855,714 T403S probably benign Het
Nme8 C A 13: 19,657,930 V219L probably damaging Het
Nov A T 15: 54,752,207 probably null Het
Nps T A 7: 135,268,788 L13Q probably damaging Het
Nutm1 G A 2: 112,248,936 A878V probably benign Het
Ogdh T C 11: 6,349,875 F794L probably damaging Het
Olfr1305 A T 2: 111,873,050 D268E possibly damaging Het
Olfr1441 A T 19: 12,422,977 I223F probably damaging Het
Olfr292 T C 7: 86,694,528 L24P probably damaging Het
Olfr305 C A 7: 86,363,735 G201C probably damaging Het
Olfr721-ps1 A C 14: 14,407,729 Y167S possibly damaging Het
Olfr998 A G 2: 85,590,938 T133A probably benign Het
Pik3cg T C 12: 32,205,199 E263G probably damaging Het
Pikfyve A G 1: 65,267,846 T1798A probably benign Het
Poldip3 T C 15: 83,131,501 Y305C probably damaging Het
Pqlc2 G T 4: 139,300,001 H343Q probably benign Het
Prkdc T C 16: 15,648,976 I107T probably benign Het
Prmt2 A G 10: 76,226,221 I50T probably damaging Het
Ptprd T C 4: 76,140,553 T168A probably benign Het
Pudp A G 18: 50,568,065 V199A probably damaging Het
Rab3c T C 13: 110,061,900 E198G probably benign Het
Rasl12 A G 9: 65,413,448 Y156C probably damaging Het
Rbm12 T C 2: 156,096,564 D596G possibly damaging Het
Rbm6 T C 9: 107,787,352 E694G probably benign Het
Rif1 T C 2: 52,112,747 V2071A probably damaging Het
Ripply2 A T 9: 87,019,796 N125I probably damaging Het
Rps6kc1 A T 1: 190,750,188 H284Q probably benign Het
Scara3 A T 14: 65,953,501 M1K probably null Het
Sfswap A G 5: 129,513,083 T215A probably damaging Het
Shroom2 A C X: 152,660,907 F421V probably benign Het
Sipa1l3 A G 7: 29,377,641 V902A probably damaging Het
Slamf8 G T 1: 172,584,214 P238Q probably damaging Het
Slc44a3 T C 3: 121,527,074 T93A possibly damaging Het
Slc5a7 A T 17: 54,278,700 I363N probably damaging Het
Slc7a2 T A 8: 40,911,058 M436K probably benign Het
Spindoc A G 19: 7,374,091 S223P probably benign Het
Stk11ip T C 1: 75,530,281 F669L possibly damaging Het
Sun3 G A 11: 9,038,266 L19F probably benign Het
Sycp1 C A 3: 102,853,489 A703S possibly damaging Het
Tas2r139 T G 6: 42,141,284 F117V probably damaging Het
Tdrd6 T C 17: 43,625,576 Y1527C probably damaging Het
Tenm4 A C 7: 96,774,046 K683Q probably damaging Het
Tfeb T A 17: 47,788,227 probably null Het
Tmco4 T C 4: 138,998,039 S121P probably damaging Het
Tmprss11d C T 5: 86,306,281 V222M probably damaging Het
Tnks1bp1 T C 2: 85,063,034 W440R probably damaging Het
Trp53bp2 A G 1: 182,448,997 T848A probably benign Het
Tssk1 G A 16: 17,895,062 R237H probably benign Het
Ttll4 A T 1: 74,679,007 T6S possibly damaging Het
Ttn G T 2: 76,721,797 Y29419* probably null Het
Ttn A G 2: 76,769,603 Y19076H probably damaging Het
Ubr3 T A 2: 69,959,603 V867D probably damaging Het
Usp29 A G 7: 6,961,391 T78A probably damaging Het
Utrn T G 10: 12,654,745 Q2108P probably benign Het
Vcan T C 13: 89,705,789 N351D probably damaging Het
Vmn1r61 A T 7: 5,611,125 Y63* probably null Het
Vmn1r61 A T 7: 5,611,127 Y63N probably benign Het
Vmn1r85 A T 7: 13,084,861 W119R probably damaging Het
Zbtb21 A C 16: 97,950,455 V190G possibly damaging Het
Zfp157 C A 5: 138,444,789 T14N probably damaging Het
Zfp942 A T 17: 21,929,419 H76Q probably damaging Het
Other mutations in Ap3d1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00094:Ap3d1 APN 10 80741979 missense probably benign 0.00
IGL00827:Ap3d1 APN 10 80713559 missense possibly damaging 0.92
IGL01668:Ap3d1 APN 10 80719159 missense possibly damaging 0.95
IGL01934:Ap3d1 APN 10 80709258 nonsense probably null
IGL03404:Ap3d1 APN 10 80730037 missense probably damaging 1.00
christian UTSW 10 80730042 missense probably damaging 1.00
R0119:Ap3d1 UTSW 10 80723615 splice site probably benign
R0197:Ap3d1 UTSW 10 80730042 missense probably damaging 1.00
R0356:Ap3d1 UTSW 10 80727978 missense probably damaging 1.00
R0372:Ap3d1 UTSW 10 80723567 missense probably damaging 1.00
R0491:Ap3d1 UTSW 10 80719241 missense probably damaging 1.00
R0636:Ap3d1 UTSW 10 80719382 nonsense probably null
R0792:Ap3d1 UTSW 10 80708479 missense probably benign
R0942:Ap3d1 UTSW 10 80732955 splice site probably benign
R1015:Ap3d1 UTSW 10 80716489 missense probably damaging 1.00
R1023:Ap3d1 UTSW 10 80714258 missense probably damaging 1.00
R1170:Ap3d1 UTSW 10 80732840 splice site probably benign
R1540:Ap3d1 UTSW 10 80715941 missense probably benign 0.00
R1639:Ap3d1 UTSW 10 80730010 missense probably damaging 0.98
R1664:Ap3d1 UTSW 10 80717737 nonsense probably null
R1669:Ap3d1 UTSW 10 80710836 unclassified probably benign
R1839:Ap3d1 UTSW 10 80727108 missense probably damaging 1.00
R1940:Ap3d1 UTSW 10 80709773 missense probably benign 0.03
R2081:Ap3d1 UTSW 10 80732936 missense probably damaging 1.00
R2258:Ap3d1 UTSW 10 80721132 missense probably benign 0.03
R2281:Ap3d1 UTSW 10 80713998 missense probably damaging 0.96
R2398:Ap3d1 UTSW 10 80719172 nonsense probably null
R2849:Ap3d1 UTSW 10 80741908 missense possibly damaging 0.65
R3856:Ap3d1 UTSW 10 80712185 missense probably benign
R4350:Ap3d1 UTSW 10 80719285 missense probably benign 0.15
R4590:Ap3d1 UTSW 10 80719812 nonsense probably null
R4782:Ap3d1 UTSW 10 80721586 splice site probably null
R4834:Ap3d1 UTSW 10 80719726 missense probably damaging 1.00
R4864:Ap3d1 UTSW 10 80712778 frame shift probably null
R5051:Ap3d1 UTSW 10 80719199 missense probably damaging 1.00
R5109:Ap3d1 UTSW 10 80709450 missense probably benign 0.11
R5219:Ap3d1 UTSW 10 80709817 missense probably benign 0.03
R5220:Ap3d1 UTSW 10 80727167 missense probably damaging 1.00
R5307:Ap3d1 UTSW 10 80723549 missense probably benign 0.29
R5586:Ap3d1 UTSW 10 80719130 missense possibly damaging 0.92
R5796:Ap3d1 UTSW 10 80714037 missense possibly damaging 0.70
R5905:Ap3d1 UTSW 10 80722927 missense possibly damaging 0.50
R6025:Ap3d1 UTSW 10 80710464 missense probably benign 0.01
R6028:Ap3d1 UTSW 10 80722927 missense possibly damaging 0.50
R6364:Ap3d1 UTSW 10 80710494 intron probably null
R6469:Ap3d1 UTSW 10 80712158 missense probably benign
R6603:Ap3d1 UTSW 10 80714047 missense probably benign 0.04
R6872:Ap3d1 UTSW 10 80714322 nonsense probably null
R6887:Ap3d1 UTSW 10 80723698 missense probably damaging 1.00
R7249:Ap3d1 UTSW 10 80741933 missense probably damaging 1.00
R7316:Ap3d1 UTSW 10 80717859 missense probably damaging 1.00
X0019:Ap3d1 UTSW 10 80719102 missense probably damaging 1.00
X0026:Ap3d1 UTSW 10 80721147 missense possibly damaging 0.46
Z1088:Ap3d1 UTSW 10 80719237 missense possibly damaging 0.91
Predicted Primers PCR Primer
(F):5'- TGGGGATACAAATGAGACCCTG -3'
(R):5'- ATCCATAGGGCCAGCTGTACAG -3'

Sequencing Primer
(F):5'- TGAGACCCTGAGGACACACG -3'
(R):5'- GCTCAGCCCAGTGACAC -3'
Posted On2015-12-29