Incidental Mutation 'R4785:Lrp1'
ID366992
Institutional Source Beutler Lab
Gene Symbol Lrp1
Ensembl Gene ENSMUSG00000040249
Gene Namelow density lipoprotein receptor-related protein 1
SynonymsA2mr, b2b1554Clo, CD91
MMRRC Submission 042417-MU
Accession Numbers

NCBI RefSeq: NM_008512.2; MGI:96828

Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R4785 (G1)
Quality Score225
Status Not validated
Chromosome10
Chromosomal Location127538161-127621148 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 127558133 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Serine at position 2621 (N2621S)
Ref Sequence ENSEMBL: ENSMUSP00000044004 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000049149]
Predicted Effect probably benign
Transcript: ENSMUST00000049149
AA Change: N2621S

PolyPhen 2 Score 0.121 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000044004
Gene: ENSMUSG00000040249
AA Change: N2621S

DomainStartEndE-ValueType
low complexity region 2 13 N/A INTRINSIC
LDLa 27 67 1.03e-15 SMART
LDLa 72 111 1.04e-11 SMART
EGF 115 150 8.78e-2 SMART
EGF_CA 151 190 4.49e-8 SMART
low complexity region 222 232 N/A INTRINSIC
LY 273 315 7.07e-6 SMART
LY 316 359 2.31e-10 SMART
LY 360 402 8.3e-12 SMART
EGF 478 521 9.93e-1 SMART
LY 552 594 8.84e-7 SMART
LY 595 638 6.54e-10 SMART
LY 641 690 2.5e-15 SMART
LY 691 734 1.06e-9 SMART
EGF 807 844 1.38e1 SMART
LDLa 854 893 3.39e-16 SMART
LDLa 895 934 1.73e-13 SMART
LDLa 936 974 4.47e-16 SMART
LDLa 976 1014 2.53e-15 SMART
LDLa 1015 1054 2.95e-16 SMART
LDLa 1062 1100 3.24e-13 SMART
LDLa 1104 1143 2.97e-12 SMART
LDLa 1145 1185 1.24e-9 SMART
EGF 1185 1223 4.97e-1 SMART
EGF 1227 1263 6.02e0 SMART
LY 1290 1332 3.76e-1 SMART
LY 1337 1379 8.56e-14 SMART
LY 1380 1424 8.43e-13 SMART
LY 1425 1469 3.05e-10 SMART
LY 1471 1513 3.88e-3 SMART
EGF 1540 1580 1.85e0 SMART
LY 1606 1650 2.83e-5 SMART
LY 1651 1695 2.01e-10 SMART
LY 1698 1735 1.87e-5 SMART
LY 1736 1777 3.54e-6 SMART
LY 1778 1820 4.17e1 SMART
EGF 1850 1888 1.24e-1 SMART
LY 1915 1957 3.2e-4 SMART
LY 1958 2000 2.33e-15 SMART
LY 2001 2044 7.45e-14 SMART
LY 2045 2087 3.87e-12 SMART
LY 2089 2131 1.37e0 SMART
EGF 2159 2196 1.66e1 SMART
LY 2276 2318 5.57e-4 SMART
LY 2324 2369 3.3e-6 SMART
LY 2370 2412 3.93e-13 SMART
LY 2413 2454 3.62e-3 SMART
EGF_like 2482 2519 3.16e1 SMART
LDLa 2524 2564 3.31e-10 SMART
LDLa 2566 2603 7.21e-11 SMART
LDLa 2605 2642 1.09e-10 SMART
LDLa 2660 2691 6.05e-4 SMART
LDLa 2696 2733 2.49e-14 SMART
LDLa 2734 2772 4.65e-14 SMART
LDLa 2774 2815 3.92e-12 SMART
LDLa 2818 2856 1.51e-13 SMART
LDLa 2858 2900 1.93e-11 SMART
LDLa 2904 2942 1.73e-13 SMART
EGF_CA 2941 2982 6.16e-6 SMART
EGF_CA 2983 3023 2.66e-10 SMART
LY 3050 3094 6.64e-11 SMART
LY 3095 3137 7.17e-16 SMART
LY 3138 3181 4.28e-14 SMART
LY 3182 3224 8.11e-15 SMART
LY 3225 3265 1.44e-6 SMART
EGF 3294 3332 1.02e-2 SMART
LDLa 3334 3372 2.25e-12 SMART
LDLa 3374 3411 9.81e-13 SMART
LDLa 3413 3451 9.81e-13 SMART
LDLa 3453 3492 5.67e-18 SMART
LDLa 3494 3534 7.15e-15 SMART
LDLa 3536 3573 1.79e-15 SMART
EGF_like 3575 3611 4.83e1 SMART
LDLa 3575 3612 1.92e-15 SMART
LDLa 3613 3650 1.18e-15 SMART
LDLa 3654 3693 7.55e-14 SMART
LDLa 3695 3734 1.14e-8 SMART
LDLa 3741 3779 6.28e-11 SMART
EGF 3785 3824 1.06e1 SMART
EGF 3828 3862 1.51e0 SMART
LY 3893 3935 9.43e0 SMART
LY 3951 3993 1.23e-14 SMART
LY 3994 4037 2.98e-13 SMART
LY 4038 4080 4.28e-14 SMART
EGF 4151 4184 3.76e-1 SMART
low complexity region 4185 4198 N/A INTRINSIC
EGF 4200 4233 3.82e-2 SMART
EGF 4236 4269 4.03e-1 SMART
EGF 4272 4305 5.2e-4 SMART
EGF 4308 4341 1.22e0 SMART
EGF_like 4344 4376 4.11e1 SMART
EGF 4377 4410 5.12e-3 SMART
transmembrane domain 4423 4445 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 94.4%
Validation Efficiency
MGI Phenotype Strain: 2178192
Lethality: E10-E13
FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the low-density lipoprotein receptor family of proteins. The encoded preproprotein is proteolytically processed by furin to generate 515 kDa and 85 kDa subunits that form the mature receptor (PMID: 8546712). This receptor is involved in several cellular processes, including intracellular signaling, lipid homeostasis, and clearance of apoptotic cells. In addition, the encoded protein is necessary for the alpha 2-macroglobulin-mediated clearance of secreted amyloid precursor protein and beta-amyloid, the main component of amyloid plaques found in Alzheimer patients. Expression of this gene decreases with age and has been found to be lower than controls in brain tissue from Alzheimer's disease patients. [provided by RefSeq, Oct 2015]
PHENOTYPE: Mice homozygous for a null allele exhibit lethality during late organogenesis. [provided by MGI curators]
Allele List at MGI

All alleles(42) : Targeted(9) Gene trapped(33)

Other mutations in this stock
Total: 145 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4921517D22Rik T C 13: 59,691,592 D13G probably benign Het
4930442H23Rik C T 10: 81,183,144 probably benign Het
5330417C22Rik A T 3: 108,458,227 probably benign Het
Adamts13 T A 2: 26,983,042 S341T probably damaging Het
Adamts2 A G 11: 50,792,722 I944V probably benign Het
Adcy3 A G 12: 4,206,542 T783A probably benign Het
Ago3 A T 4: 126,368,503 M418K probably benign Het
Alpk1 G T 3: 127,687,592 N175K possibly damaging Het
Als2 A G 1: 59,215,313 V295A probably benign Het
Anapc13 T C 9: 102,629,821 I11T probably benign Het
Ankrd12 T A 17: 65,982,999 N1813I probably damaging Het
Anks1b A T 10: 90,914,750 I176F probably null Het
Ap3d1 TTCTCTCTCTCTCTCTCT TTCTCTCTCTCTCTCT 10: 80,712,778 probably null Het
Arhgap32 A G 9: 32,129,653 D67G probably damaging Het
Arhgap32 T C 9: 32,260,780 C1619R probably damaging Het
Atp1a4 A T 1: 172,254,110 Y158* probably null Het
Atp8b5 A T 4: 43,356,980 D576V probably damaging Het
Atrnl1 A G 19: 57,629,158 I122V probably damaging Het
B430203G13Rik A T 12: 17,924,519 noncoding transcript Het
Baz1b T G 5: 135,217,413 L572R possibly damaging Het
Ccnd2 T C 6: 127,148,798 T92A possibly damaging Het
Ccndbp1 A T 2: 121,008,522 T5S probably benign Het
Ccr2 G A 9: 124,106,372 V230I probably benign Het
Cct4 T A 11: 23,002,866 V514E probably damaging Het
Cep152 A G 2: 125,586,329 probably null Het
Cflar C T 1: 58,752,567 T343M probably benign Het
Chrm5 A C 2: 112,479,585 N395K probably benign Het
Chrna10 G A 7: 102,113,219 P255S possibly damaging Het
Chrna6 T A 8: 27,407,106 I248F probably damaging Het
Clip1 T C 5: 123,579,293 D1387G probably damaging Het
Clstn3 T C 6: 124,437,372 probably null Het
Cntnap5a C T 1: 116,101,565 R250W probably benign Het
Col12a1 C A 9: 79,678,494 V1228F possibly damaging Het
Cxcr5 T C 9: 44,513,341 T340A probably benign Het
Cyp2a4 G A 7: 26,312,875 R361K probably damaging Het
Dnah1 T A 14: 31,263,479 K3818N probably damaging Het
Dnah3 T A 7: 119,967,824 K2393M probably benign Het
Dpy19l1 A T 9: 24,424,823 L529Q probably damaging Het
Eif4g2 C T 7: 111,076,796 R399H probably damaging Het
Fam160a1 G T 3: 85,688,570 T115K probably damaging Het
Fam76a A T 4: 132,902,117 probably null Het
Fam76a A G 4: 132,916,190 Y78H probably damaging Het
Fbn1 A T 2: 125,324,919 C2026S probably damaging Het
Fbxo4 T C 15: 3,969,041 T312A probably benign Het
Fbxw26 A G 9: 109,724,800 V257A possibly damaging Het
Flnb A T 14: 7,905,701 E1150D probably benign Het
Fndc3c1 A T X: 106,437,702 S661R possibly damaging Het
Gba2 A C 4: 43,568,315 L684R probably damaging Het
Gbf1 G T 19: 46,268,395 C812F possibly damaging Het
Glt8d2 A T 10: 82,660,749 D158E probably damaging Het
Golga2 T A 2: 32,297,156 N89K probably damaging Het
Got1 A G 19: 43,502,937 I358T possibly damaging Het
Gpx6 C T 13: 21,312,264 Q3* probably null Het
Grin1 T A 2: 25,292,381 H956L possibly damaging Het
Grin2d A G 7: 45,856,781 V562A probably damaging Het
Grm6 A G 11: 50,857,277 I405V probably benign Het
Hcar2 C G 5: 123,864,450 G330A probably benign Het
Hcfc1 T C X: 73,965,946 K20E probably damaging Het
Iars T A 13: 49,724,663 Y888N probably damaging Het
Ifi206 A T 1: 173,480,866 H521Q probably benign Het
Impg1 A G 9: 80,398,450 S112P probably benign Het
Incenp C A 19: 9,877,690 R619M unknown Het
Incenp T A 19: 9,877,691 R619W unknown Het
Kat2b A G 17: 53,653,203 E513G possibly damaging Het
Kbtbd12 G T 6: 88,618,021 L276I probably damaging Het
Kctd9 T A 14: 67,734,164 D229E probably damaging Het
Kdm1b C T 13: 47,063,077 R308W probably damaging Het
Kif2b G A 11: 91,576,428 P343L probably benign Het
Kntc1 T G 5: 123,816,762 M2081R possibly damaging Het
Lamc1 T C 1: 153,231,740 N1231S probably damaging Het
Lclat1 T A 17: 73,240,070 Y327* probably null Het
Lgals3bp G A 11: 118,393,514 T413I probably damaging Het
Lin54 A G 5: 100,459,738 I250T probably damaging Het
Lrrtm3 T A 10: 64,088,002 H462L probably benign Het
Lysmd1 A G 3: 95,134,986 Y57C probably damaging Het
Mccc1 C A 3: 35,975,873 M429I probably damaging Het
Metrnl A G 11: 121,707,924 E40G probably benign Het
Mios T A 6: 8,222,464 M466K probably benign Het
Mrgpra1 A G 7: 47,335,470 S154P probably damaging Het
Mrpl24 T C 3: 87,922,050 probably null Het
Myo1f A G 17: 33,598,191 N736S possibly damaging Het
Myo1h A G 5: 114,360,599 I919V possibly damaging Het
Nampt T C 12: 32,848,714 L443P possibly damaging Het
Ndufaf2 C G 13: 108,052,780 A145P probably damaging Het
Nek10 A T 14: 14,855,714 T403S probably benign Het
Nme8 C A 13: 19,657,930 V219L probably damaging Het
Nov A T 15: 54,752,207 probably null Het
Nps T A 7: 135,268,788 L13Q probably damaging Het
Nutm1 G A 2: 112,248,936 A878V probably benign Het
Ogdh T C 11: 6,349,875 F794L probably damaging Het
Olfr1305 A T 2: 111,873,050 D268E possibly damaging Het
Olfr1441 A T 19: 12,422,977 I223F probably damaging Het
Olfr292 T C 7: 86,694,528 L24P probably damaging Het
Olfr305 C A 7: 86,363,735 G201C probably damaging Het
Olfr721-ps1 A C 14: 14,407,729 Y167S possibly damaging Het
Olfr998 A G 2: 85,590,938 T133A probably benign Het
Pik3cg T C 12: 32,205,199 E263G probably damaging Het
Pikfyve A G 1: 65,267,846 T1798A probably benign Het
Poldip3 T C 15: 83,131,501 Y305C probably damaging Het
Pqlc2 G T 4: 139,300,001 H343Q probably benign Het
Prkdc T C 16: 15,648,976 I107T probably benign Het
Prmt2 A G 10: 76,226,221 I50T probably damaging Het
Ptprd T C 4: 76,140,553 T168A probably benign Het
Pudp A G 18: 50,568,065 V199A probably damaging Het
Rab3c T C 13: 110,061,900 E198G probably benign Het
Rasl12 A G 9: 65,413,448 Y156C probably damaging Het
Rbm12 T C 2: 156,096,564 D596G possibly damaging Het
Rbm6 T C 9: 107,787,352 E694G probably benign Het
Rif1 T C 2: 52,112,747 V2071A probably damaging Het
Ripply2 A T 9: 87,019,796 N125I probably damaging Het
Rps6kc1 A T 1: 190,750,188 H284Q probably benign Het
Scara3 A T 14: 65,953,501 M1K probably null Het
Sfswap A G 5: 129,513,083 T215A probably damaging Het
Shroom2 A C X: 152,660,907 F421V probably benign Het
Sipa1l3 A G 7: 29,377,641 V902A probably damaging Het
Slamf8 G T 1: 172,584,214 P238Q probably damaging Het
Slc44a3 T C 3: 121,527,074 T93A possibly damaging Het
Slc5a7 A T 17: 54,278,700 I363N probably damaging Het
Slc7a2 T A 8: 40,911,058 M436K probably benign Het
Spindoc A G 19: 7,374,091 S223P probably benign Het
Stk11ip T C 1: 75,530,281 F669L possibly damaging Het
Sun3 G A 11: 9,038,266 L19F probably benign Het
Sycp1 C A 3: 102,853,489 A703S possibly damaging Het
Tas2r139 T G 6: 42,141,284 F117V probably damaging Het
Tdrd6 T C 17: 43,625,576 Y1527C probably damaging Het
Tenm4 A C 7: 96,774,046 K683Q probably damaging Het
Tfeb T A 17: 47,788,227 probably null Het
Tmco4 T C 4: 138,998,039 S121P probably damaging Het
Tmprss11d C T 5: 86,306,281 V222M probably damaging Het
Tnks1bp1 T C 2: 85,063,034 W440R probably damaging Het
Trp53bp2 A G 1: 182,448,997 T848A probably benign Het
Tssk1 G A 16: 17,895,062 R237H probably benign Het
Ttll4 A T 1: 74,679,007 T6S possibly damaging Het
Ttn G T 2: 76,721,797 Y29419* probably null Het
Ttn A G 2: 76,769,603 Y19076H probably damaging Het
Ubr3 T A 2: 69,959,603 V867D probably damaging Het
Usp29 A G 7: 6,961,391 T78A probably damaging Het
Utrn T G 10: 12,654,745 Q2108P probably benign Het
Vcan T C 13: 89,705,789 N351D probably damaging Het
Vmn1r61 A T 7: 5,611,125 Y63* probably null Het
Vmn1r61 A T 7: 5,611,127 Y63N probably benign Het
Vmn1r85 A T 7: 13,084,861 W119R probably damaging Het
Zbtb21 A C 16: 97,950,455 V190G possibly damaging Het
Zfp157 C A 5: 138,444,789 T14N probably damaging Het
Zfp942 A T 17: 21,929,419 H76Q probably damaging Het
Other mutations in Lrp1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00793:Lrp1 APN 10 127542205 missense possibly damaging 0.89
IGL01065:Lrp1 APN 10 127575038 missense probably benign 0.10
IGL01121:Lrp1 APN 10 127583853 nonsense probably null
IGL01360:Lrp1 APN 10 127545820 missense possibly damaging 0.93
IGL01402:Lrp1 APN 10 127595032 missense probably damaging 1.00
IGL01404:Lrp1 APN 10 127595032 missense probably damaging 1.00
IGL01411:Lrp1 APN 10 127581765 nonsense probably null
IGL01469:Lrp1 APN 10 127584414 missense probably damaging 1.00
IGL01552:Lrp1 APN 10 127588510 nonsense probably null
IGL01682:Lrp1 APN 10 127574978 missense probably benign 0.00
IGL01760:Lrp1 APN 10 127573501 missense probably benign 0.00
IGL01918:Lrp1 APN 10 127554589 missense probably damaging 0.99
IGL01989:Lrp1 APN 10 127578129 missense probably damaging 1.00
IGL02105:Lrp1 APN 10 127544579 missense probably damaging 1.00
IGL02158:Lrp1 APN 10 127554271 missense probably benign 0.02
IGL02164:Lrp1 APN 10 127563667 missense probably benign 0.39
IGL02337:Lrp1 APN 10 127576887 missense possibly damaging 0.87
IGL02425:Lrp1 APN 10 127571887 critical splice donor site probably null
IGL02493:Lrp1 APN 10 127581778 missense probably damaging 0.99
IGL02563:Lrp1 APN 10 127551686 missense probably damaging 1.00
IGL02590:Lrp1 APN 10 127552791 missense probably damaging 1.00
IGL02624:Lrp1 APN 10 127572422 missense probably damaging 0.98
IGL02625:Lrp1 APN 10 127574486 missense probably damaging 1.00
IGL02825:Lrp1 APN 10 127542605 missense probably damaging 1.00
IGL02880:Lrp1 APN 10 127540222 missense probably benign 0.12
IGL02900:Lrp1 APN 10 127576647 splice site probably benign
IGL02956:Lrp1 APN 10 127544559 missense probably benign 0.00
IGL02974:Lrp1 APN 10 127555016 missense probably damaging 0.99
IGL02983:Lrp1 APN 10 127550199 missense probably damaging 1.00
IGL03002:Lrp1 APN 10 127589636 missense probably damaging 1.00
IGL03091:Lrp1 APN 10 127559124 missense probably benign 0.30
IGL03109:Lrp1 APN 10 127566645 missense probably benign
IGL03194:Lrp1 APN 10 127568685 missense probably damaging 1.00
IGL03232:Lrp1 APN 10 127539376 missense probably damaging 1.00
extremis UTSW 10 127556988 missense probably benign 0.00
Jockey UTSW 10 127560136 missense probably damaging 1.00
peripheral UTSW 10 127610381 missense probably damaging 1.00
tangential UTSW 10 127593848 missense probably damaging 0.99
P0015:Lrp1 UTSW 10 127566663 missense probably damaging 0.99
PIT4519001:Lrp1 UTSW 10 127607974 missense possibly damaging 0.91
PIT4520001:Lrp1 UTSW 10 127607974 missense possibly damaging 0.91
R0004:Lrp1 UTSW 10 127541825 splice site probably null
R0034:Lrp1 UTSW 10 127545651 missense probably benign 0.42
R0091:Lrp1 UTSW 10 127540979 missense probably damaging 1.00
R0098:Lrp1 UTSW 10 127552738 missense probably benign
R0098:Lrp1 UTSW 10 127552738 missense probably benign
R0143:Lrp1 UTSW 10 127593942 missense probably damaging 1.00
R0372:Lrp1 UTSW 10 127592136 missense probably damaging 1.00
R0379:Lrp1 UTSW 10 127594969 missense probably damaging 1.00
R0445:Lrp1 UTSW 10 127590636 nonsense probably null
R0529:Lrp1 UTSW 10 127541594 intron probably null
R0551:Lrp1 UTSW 10 127571958 missense probably benign
R0570:Lrp1 UTSW 10 127555009 nonsense probably null
R0600:Lrp1 UTSW 10 127567383 missense probably benign 0.00
R0626:Lrp1 UTSW 10 127567364 missense probably damaging 1.00
R0647:Lrp1 UTSW 10 127571477 missense probably damaging 1.00
R0680:Lrp1 UTSW 10 127589661 missense probably damaging 1.00
R0792:Lrp1 UTSW 10 127567364 missense probably damaging 1.00
R0792:Lrp1 UTSW 10 127575286 missense probably benign 0.04
R0848:Lrp1 UTSW 10 127553362 splice site probably null
R0866:Lrp1 UTSW 10 127539278 missense probably damaging 1.00
R0918:Lrp1 UTSW 10 127593965 missense probably damaging 1.00
R1076:Lrp1 UTSW 10 127563797 splice site probably benign
R1107:Lrp1 UTSW 10 127557435 missense probably damaging 1.00
R1346:Lrp1 UTSW 10 127605866 missense probably damaging 1.00
R1403:Lrp1 UTSW 10 127581891 critical splice acceptor site probably null
R1403:Lrp1 UTSW 10 127581891 critical splice acceptor site probably null
R1496:Lrp1 UTSW 10 127539011 missense probably damaging 1.00
R1522:Lrp1 UTSW 10 127567364 missense probably damaging 1.00
R1522:Lrp1 UTSW 10 127575286 missense probably benign 0.04
R1525:Lrp1 UTSW 10 127539529 missense probably damaging 1.00
R1539:Lrp1 UTSW 10 127584381 unclassified probably null
R1589:Lrp1 UTSW 10 127605606 missense probably benign 0.00
R1591:Lrp1 UTSW 10 127605606 missense probably benign 0.00
R1663:Lrp1 UTSW 10 127556921 missense probably damaging 1.00
R1682:Lrp1 UTSW 10 127574332 missense probably damaging 1.00
R1717:Lrp1 UTSW 10 127556269 missense possibly damaging 0.59
R1717:Lrp1 UTSW 10 127563665 missense probably damaging 1.00
R1758:Lrp1 UTSW 10 127588584 missense possibly damaging 0.76
R1826:Lrp1 UTSW 10 127553707 missense probably damaging 1.00
R1842:Lrp1 UTSW 10 127573468 missense possibly damaging 0.93
R1844:Lrp1 UTSW 10 127595283 critical splice donor site probably null
R1845:Lrp1 UTSW 10 127578673 missense probably damaging 1.00
R1896:Lrp1 UTSW 10 127559998 missense possibly damaging 0.64
R1952:Lrp1 UTSW 10 127567431 missense probably damaging 1.00
R2009:Lrp1 UTSW 10 127544516 missense probably damaging 1.00
R2015:Lrp1 UTSW 10 127540694 missense probably benign 0.00
R2116:Lrp1 UTSW 10 127576493 nonsense probably null
R2161:Lrp1 UTSW 10 127555738 missense probably damaging 1.00
R2199:Lrp1 UTSW 10 127546840 missense probably damaging 1.00
R2213:Lrp1 UTSW 10 127540702 missense probably damaging 1.00
R2300:Lrp1 UTSW 10 127556915 nonsense probably null
R2324:Lrp1 UTSW 10 127566586 missense possibly damaging 0.92
R2849:Lrp1 UTSW 10 127542296 missense probably damaging 1.00
R2926:Lrp1 UTSW 10 127588113 missense probably damaging 0.98
R2993:Lrp1 UTSW 10 127610381 missense probably damaging 1.00
R3522:Lrp1 UTSW 10 127553555 missense probably damaging 1.00
R3702:Lrp1 UTSW 10 127595103 missense probably damaging 1.00
R3789:Lrp1 UTSW 10 127571969 missense possibly damaging 0.94
R3898:Lrp1 UTSW 10 127592100 nonsense probably null
R3941:Lrp1 UTSW 10 127553396 missense probably damaging 1.00
R3958:Lrp1 UTSW 10 127571958 missense probably benign
R4369:Lrp1 UTSW 10 127550286 missense possibly damaging 0.87
R4510:Lrp1 UTSW 10 127593848 missense probably damaging 0.99
R4511:Lrp1 UTSW 10 127593848 missense probably damaging 0.99
R4576:Lrp1 UTSW 10 127540188 small deletion probably benign
R4583:Lrp1 UTSW 10 127541372 missense probably benign 0.00
R4662:Lrp1 UTSW 10 127552185 nonsense probably null
R4721:Lrp1 UTSW 10 127555059 missense possibly damaging 0.58
R4728:Lrp1 UTSW 10 127563737 missense probably damaging 1.00
R4745:Lrp1 UTSW 10 127549944 missense probably benign 0.20
R4841:Lrp1 UTSW 10 127583936 missense probably damaging 1.00
R4842:Lrp1 UTSW 10 127583936 missense probably damaging 1.00
R4855:Lrp1 UTSW 10 127610442 missense probably benign 0.03
R4860:Lrp1 UTSW 10 127553824 missense probably damaging 1.00
R4860:Lrp1 UTSW 10 127553824 missense probably damaging 1.00
R4891:Lrp1 UTSW 10 127541752 missense probably damaging 1.00
R4925:Lrp1 UTSW 10 127575075 nonsense probably null
R4970:Lrp1 UTSW 10 127539520 missense probably benign 0.11
R4999:Lrp1 UTSW 10 127553779 missense probably damaging 1.00
R5044:Lrp1 UTSW 10 127567495 missense probably damaging 1.00
R5127:Lrp1 UTSW 10 127539634 intron probably benign
R5188:Lrp1 UTSW 10 127607952 missense probably damaging 1.00
R5218:Lrp1 UTSW 10 127548619 missense probably damaging 1.00
R5225:Lrp1 UTSW 10 127556096 missense probably benign 0.04
R5291:Lrp1 UTSW 10 127593878 missense probably damaging 1.00
R5386:Lrp1 UTSW 10 127592114 missense probably damaging 1.00
R5395:Lrp1 UTSW 10 127595297 missense probably damaging 1.00
R5413:Lrp1 UTSW 10 127588067 critical splice donor site probably null
R5430:Lrp1 UTSW 10 127541061 missense probably damaging 0.99
R5499:Lrp1 UTSW 10 127572944 missense possibly damaging 0.58
R5526:Lrp1 UTSW 10 127555724 missense probably benign 0.37
R5580:Lrp1 UTSW 10 127588520 missense probably benign
R5583:Lrp1 UTSW 10 127588463 missense probably benign 0.08
R5599:Lrp1 UTSW 10 127593869 missense probably damaging 1.00
R5639:Lrp1 UTSW 10 127593839 missense probably damaging 0.99
R5677:Lrp1 UTSW 10 127574429 missense probably damaging 1.00
R5730:Lrp1 UTSW 10 127583834 missense probably benign 0.00
R5742:Lrp1 UTSW 10 127548347 missense probably damaging 0.98
R5764:Lrp1 UTSW 10 127595318 missense probably benign 0.41
R5864:Lrp1 UTSW 10 127567505 missense possibly damaging 0.58
R5937:Lrp1 UTSW 10 127583876 missense possibly damaging 0.93
R5947:Lrp1 UTSW 10 127589554 critical splice donor site probably null
R5976:Lrp1 UTSW 10 127583901 missense probably damaging 1.00
R6021:Lrp1 UTSW 10 127578014 missense probably damaging 1.00
R6026:Lrp1 UTSW 10 127573403 missense probably damaging 1.00
R6045:Lrp1 UTSW 10 127566600 missense probably damaging 0.98
R6057:Lrp1 UTSW 10 127567490 missense probably damaging 1.00
R6084:Lrp1 UTSW 10 127560553 missense probably benign 0.09
R6131:Lrp1 UTSW 10 127560157 missense probably benign
R6235:Lrp1 UTSW 10 127588177 missense probably damaging 1.00
R6280:Lrp1 UTSW 10 127589584 missense probably benign 0.04
R6307:Lrp1 UTSW 10 127592075 missense probably damaging 1.00
R6532:Lrp1 UTSW 10 127541682 missense probably damaging 1.00
R6532:Lrp1 UTSW 10 127549407 missense probably damaging 1.00
R6536:Lrp1 UTSW 10 127558068 splice site probably null
R6605:Lrp1 UTSW 10 127560136 missense probably damaging 1.00
R6607:Lrp1 UTSW 10 127560136 missense probably damaging 1.00
R6631:Lrp1 UTSW 10 127574332 missense probably damaging 1.00
R6676:Lrp1 UTSW 10 127560136 missense probably damaging 1.00
R6678:Lrp1 UTSW 10 127560136 missense probably damaging 1.00
R6809:Lrp1 UTSW 10 127555056 missense probably benign 0.04
R6884:Lrp1 UTSW 10 127559117 missense probably benign 0.00
R6925:Lrp1 UTSW 10 127556988 missense probably benign 0.00
R6987:Lrp1 UTSW 10 127575005 missense probably damaging 1.00
R7016:Lrp1 UTSW 10 127559967 critical splice donor site probably null
R7030:Lrp1 UTSW 10 127552876 missense probably damaging 0.97
R7053:Lrp1 UTSW 10 127541094 missense probably damaging 1.00
R7076:Lrp1 UTSW 10 127550183 critical splice donor site probably null
R7136:Lrp1 UTSW 10 127558622 missense probably damaging 1.00
R7180:Lrp1 UTSW 10 127556965 missense probably damaging 1.00
R7199:Lrp1 UTSW 10 127573456 missense probably damaging 0.99
R7219:Lrp1 UTSW 10 127557228 missense probably benign 0.40
R7233:Lrp1 UTSW 10 127595061 missense probably damaging 1.00
R7251:Lrp1 UTSW 10 127572554 missense probably damaging 1.00
R7264:Lrp1 UTSW 10 127592093 missense probably damaging 1.00
R7302:Lrp1 UTSW 10 127538987 missense probably benign 0.01
R7313:Lrp1 UTSW 10 127553468 missense probably damaging 1.00
R7322:Lrp1 UTSW 10 127545564 missense probably benign 0.24
R7354:Lrp1 UTSW 10 127571408 missense probably damaging 1.00
R7375:Lrp1 UTSW 10 127539348 missense probably damaging 1.00
R7388:Lrp1 UTSW 10 127583897 nonsense probably null
R7404:Lrp1 UTSW 10 127582708 missense
R7405:Lrp1 UTSW 10 127581751 missense possibly damaging 0.93
R7477:Lrp1 UTSW 10 127568920 missense probably damaging 1.00
R7555:Lrp1 UTSW 10 127546862 missense probably damaging 1.00
R7600:Lrp1 UTSW 10 127555706 missense probably benign
R7678:Lrp1 UTSW 10 127574053 missense probably damaging 1.00
R7679:Lrp1 UTSW 10 127588428 nonsense probably null
R7951:Lrp1 UTSW 10 127539064 nonsense probably null
R7964:Lrp1 UTSW 10 127575044 missense possibly damaging 0.94
R8006:Lrp1 UTSW 10 127589619 missense probably damaging 1.00
R8021:Lrp1 UTSW 10 127548346 missense possibly damaging 0.92
R8098:Lrp1 UTSW 10 127574455 missense possibly damaging 0.78
R8112:Lrp1 UTSW 10 127605846 missense probably damaging 1.00
R8210:Lrp1 UTSW 10 127576485 missense probably damaging 1.00
R8249:Lrp1 UTSW 10 127605543 missense probably benign
R8291:Lrp1 UTSW 10 127589703 missense probably damaging 1.00
R8332:Lrp1 UTSW 10 127571936 missense probably damaging 1.00
V3553:Lrp1 UTSW 10 127571442 missense probably damaging 1.00
Y5406:Lrp1 UTSW 10 127554283 missense probably damaging 1.00
Z1088:Lrp1 UTSW 10 127584379 missense probably damaging 1.00
Z1176:Lrp1 UTSW 10 127554962 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CAACTGTCAATCATGGGCAG -3'
(R):5'- AGCCATCTGCCTCATCACTG -3'

Sequencing Primer
(F):5'- TCAATCATGGGCAGGCTGTCAG -3'
(R):5'- AGTCTCAGACTGTACCCCG -3'
Posted On2015-12-29