Incidental Mutation 'R4785:Dnah1'
ID367017
Institutional Source Beutler Lab
Gene Symbol Dnah1
Ensembl Gene ENSMUSG00000019027
Gene Namedynein, axonemal, heavy chain 1
SynonymsE030034C22Rik, MDHC7, Dnahc1, B230373P09Rik
MMRRC Submission 042417-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4785 (G1)
Quality Score225
Status Not validated
Chromosome14
Chromosomal Location31260375-31323896 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 31263479 bp
ZygosityHeterozygous
Amino Acid Change Lysine to Asparagine at position 3818 (K3818N)
Ref Sequence ENSEMBL: ENSMUSP00000043281 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000022458] [ENSMUST00000048603] [ENSMUST00000187156]
Predicted Effect probably benign
Transcript: ENSMUST00000022458
SMART Domains Protein: ENSMUSP00000022458
Gene: ENSMUSG00000021901

DomainStartEndE-ValueType
Pfam:Peptidase_C12 5 215 3e-70 PFAM
low complexity region 282 293 N/A INTRINSIC
low complexity region 396 407 N/A INTRINSIC
low complexity region 577 596 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000048603
AA Change: K3818N

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000043281
Gene: ENSMUSG00000019027
AA Change: K3818N

DomainStartEndE-ValueType
low complexity region 43 59 N/A INTRINSIC
Pfam:DHC_N2 998 1404 6.3e-146 PFAM
AAA 1558 1697 6.02e-1 SMART
AAA 1839 2077 4.66e0 SMART
low complexity region 2149 2157 N/A INTRINSIC
AAA 2204 2353 2.35e-1 SMART
Pfam:AAA_8 2533 2803 7.7e-84 PFAM
Pfam:MT 2815 3165 9.9e-57 PFAM
Pfam:AAA_9 3185 3410 1.1e-93 PFAM
Pfam:Dynein_heavy 3545 4246 2.7e-275 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000185700
Predicted Effect probably benign
Transcript: ENSMUST00000187156
SMART Domains Protein: ENSMUSP00000139903
Gene: ENSMUSG00000021901

DomainStartEndE-ValueType
low complexity region 33 44 N/A INTRINSIC
transmembrane domain 59 81 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000190788
Predicted Effect noncoding transcript
Transcript: ENSMUST00000228429
Meta Mutation Damage Score 0.0728 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 94.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes an inner dynein arm heavy chain that provides structural support between the radial spokes and the outer doublet of the sperm tail. Naturally occurring mutations in this gene are associated with primary ciliary dyskinesia and multiple morphological anomalies of the flagella that result in asthenozoospermia and male infertility. Mice with a homozygous knockout of the orthologous gene are viable but have reduced sperm motility and are infertile. [provided by RefSeq, Feb 2017]
PHENOTYPE: Homozygous mutants are male sterile, and show impaired ciliary and flagellar motility that is also observed in the tracheal cilia. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 145 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4921517D22Rik T C 13: 59,691,592 D13G probably benign Het
4930442H23Rik C T 10: 81,183,144 probably benign Het
5330417C22Rik A T 3: 108,458,227 probably benign Het
Adamts13 T A 2: 26,983,042 S341T probably damaging Het
Adamts2 A G 11: 50,792,722 I944V probably benign Het
Adcy3 A G 12: 4,206,542 T783A probably benign Het
Ago3 A T 4: 126,368,503 M418K probably benign Het
Alpk1 G T 3: 127,687,592 N175K possibly damaging Het
Als2 A G 1: 59,215,313 V295A probably benign Het
Anapc13 T C 9: 102,629,821 I11T probably benign Het
Ankrd12 T A 17: 65,982,999 N1813I probably damaging Het
Anks1b A T 10: 90,914,750 I176F probably null Het
Ap3d1 TTCTCTCTCTCTCTCTCT TTCTCTCTCTCTCTCT 10: 80,712,778 probably null Het
Arhgap32 A G 9: 32,129,653 D67G probably damaging Het
Arhgap32 T C 9: 32,260,780 C1619R probably damaging Het
Atp1a4 A T 1: 172,254,110 Y158* probably null Het
Atp8b5 A T 4: 43,356,980 D576V probably damaging Het
Atrnl1 A G 19: 57,629,158 I122V probably damaging Het
B430203G13Rik A T 12: 17,924,519 noncoding transcript Het
Baz1b T G 5: 135,217,413 L572R possibly damaging Het
Ccnd2 T C 6: 127,148,798 T92A possibly damaging Het
Ccndbp1 A T 2: 121,008,522 T5S probably benign Het
Ccr2 G A 9: 124,106,372 V230I probably benign Het
Cct4 T A 11: 23,002,866 V514E probably damaging Het
Cep152 A G 2: 125,586,329 probably null Het
Cflar C T 1: 58,752,567 T343M probably benign Het
Chrm5 A C 2: 112,479,585 N395K probably benign Het
Chrna10 G A 7: 102,113,219 P255S possibly damaging Het
Chrna6 T A 8: 27,407,106 I248F probably damaging Het
Clip1 T C 5: 123,579,293 D1387G probably damaging Het
Clstn3 T C 6: 124,437,372 probably null Het
Cntnap5a C T 1: 116,101,565 R250W probably benign Het
Col12a1 C A 9: 79,678,494 V1228F possibly damaging Het
Cxcr5 T C 9: 44,513,341 T340A probably benign Het
Cyp2a4 G A 7: 26,312,875 R361K probably damaging Het
Dnah3 T A 7: 119,967,824 K2393M probably benign Het
Dpy19l1 A T 9: 24,424,823 L529Q probably damaging Het
Eif4g2 C T 7: 111,076,796 R399H probably damaging Het
Fam160a1 G T 3: 85,688,570 T115K probably damaging Het
Fam76a A T 4: 132,902,117 probably null Het
Fam76a A G 4: 132,916,190 Y78H probably damaging Het
Fbn1 A T 2: 125,324,919 C2026S probably damaging Het
Fbxo4 T C 15: 3,969,041 T312A probably benign Het
Fbxw26 A G 9: 109,724,800 V257A possibly damaging Het
Flnb A T 14: 7,905,701 E1150D probably benign Het
Fndc3c1 A T X: 106,437,702 S661R possibly damaging Het
Gba2 A C 4: 43,568,315 L684R probably damaging Het
Gbf1 G T 19: 46,268,395 C812F possibly damaging Het
Glt8d2 A T 10: 82,660,749 D158E probably damaging Het
Golga2 T A 2: 32,297,156 N89K probably damaging Het
Got1 A G 19: 43,502,937 I358T possibly damaging Het
Gpx6 C T 13: 21,312,264 Q3* probably null Het
Grin1 T A 2: 25,292,381 H956L possibly damaging Het
Grin2d A G 7: 45,856,781 V562A probably damaging Het
Grm6 A G 11: 50,857,277 I405V probably benign Het
Hcar2 C G 5: 123,864,450 G330A probably benign Het
Hcfc1 T C X: 73,965,946 K20E probably damaging Het
Iars T A 13: 49,724,663 Y888N probably damaging Het
Ifi206 A T 1: 173,480,866 H521Q probably benign Het
Impg1 A G 9: 80,398,450 S112P probably benign Het
Incenp C A 19: 9,877,690 R619M unknown Het
Incenp T A 19: 9,877,691 R619W unknown Het
Kat2b A G 17: 53,653,203 E513G possibly damaging Het
Kbtbd12 G T 6: 88,618,021 L276I probably damaging Het
Kctd9 T A 14: 67,734,164 D229E probably damaging Het
Kdm1b C T 13: 47,063,077 R308W probably damaging Het
Kif2b G A 11: 91,576,428 P343L probably benign Het
Kntc1 T G 5: 123,816,762 M2081R possibly damaging Het
Lamc1 T C 1: 153,231,740 N1231S probably damaging Het
Lclat1 T A 17: 73,240,070 Y327* probably null Het
Lgals3bp G A 11: 118,393,514 T413I probably damaging Het
Lin54 A G 5: 100,459,738 I250T probably damaging Het
Lrp1 T C 10: 127,558,133 N2621S probably benign Het
Lrrtm3 T A 10: 64,088,002 H462L probably benign Het
Lysmd1 A G 3: 95,134,986 Y57C probably damaging Het
Mccc1 C A 3: 35,975,873 M429I probably damaging Het
Metrnl A G 11: 121,707,924 E40G probably benign Het
Mios T A 6: 8,222,464 M466K probably benign Het
Mrgpra1 A G 7: 47,335,470 S154P probably damaging Het
Mrpl24 T C 3: 87,922,050 probably null Het
Myo1f A G 17: 33,598,191 N736S possibly damaging Het
Myo1h A G 5: 114,360,599 I919V possibly damaging Het
Nampt T C 12: 32,848,714 L443P possibly damaging Het
Ndufaf2 C G 13: 108,052,780 A145P probably damaging Het
Nek10 A T 14: 14,855,714 T403S probably benign Het
Nme8 C A 13: 19,657,930 V219L probably damaging Het
Nov A T 15: 54,752,207 probably null Het
Nps T A 7: 135,268,788 L13Q probably damaging Het
Nutm1 G A 2: 112,248,936 A878V probably benign Het
Ogdh T C 11: 6,349,875 F794L probably damaging Het
Olfr1305 A T 2: 111,873,050 D268E possibly damaging Het
Olfr1441 A T 19: 12,422,977 I223F probably damaging Het
Olfr292 T C 7: 86,694,528 L24P probably damaging Het
Olfr305 C A 7: 86,363,735 G201C probably damaging Het
Olfr721-ps1 A C 14: 14,407,729 Y167S possibly damaging Het
Olfr998 A G 2: 85,590,938 T133A probably benign Het
Pik3cg T C 12: 32,205,199 E263G probably damaging Het
Pikfyve A G 1: 65,267,846 T1798A probably benign Het
Poldip3 T C 15: 83,131,501 Y305C probably damaging Het
Pqlc2 G T 4: 139,300,001 H343Q probably benign Het
Prkdc T C 16: 15,648,976 I107T probably benign Het
Prmt2 A G 10: 76,226,221 I50T probably damaging Het
Ptprd T C 4: 76,140,553 T168A probably benign Het
Pudp A G 18: 50,568,065 V199A probably damaging Het
Rab3c T C 13: 110,061,900 E198G probably benign Het
Rasl12 A G 9: 65,413,448 Y156C probably damaging Het
Rbm12 T C 2: 156,096,564 D596G possibly damaging Het
Rbm6 T C 9: 107,787,352 E694G probably benign Het
Rif1 T C 2: 52,112,747 V2071A probably damaging Het
Ripply2 A T 9: 87,019,796 N125I probably damaging Het
Rps6kc1 A T 1: 190,750,188 H284Q probably benign Het
Scara3 A T 14: 65,953,501 M1K probably null Het
Sfswap A G 5: 129,513,083 T215A probably damaging Het
Shroom2 A C X: 152,660,907 F421V probably benign Het
Sipa1l3 A G 7: 29,377,641 V902A probably damaging Het
Slamf8 G T 1: 172,584,214 P238Q probably damaging Het
Slc44a3 T C 3: 121,527,074 T93A possibly damaging Het
Slc5a7 A T 17: 54,278,700 I363N probably damaging Het
Slc7a2 T A 8: 40,911,058 M436K probably benign Het
Spindoc A G 19: 7,374,091 S223P probably benign Het
Stk11ip T C 1: 75,530,281 F669L possibly damaging Het
Sun3 G A 11: 9,038,266 L19F probably benign Het
Sycp1 C A 3: 102,853,489 A703S possibly damaging Het
Tas2r139 T G 6: 42,141,284 F117V probably damaging Het
Tdrd6 T C 17: 43,625,576 Y1527C probably damaging Het
Tenm4 A C 7: 96,774,046 K683Q probably damaging Het
Tfeb T A 17: 47,788,227 probably null Het
Tmco4 T C 4: 138,998,039 S121P probably damaging Het
Tmprss11d C T 5: 86,306,281 V222M probably damaging Het
Tnks1bp1 T C 2: 85,063,034 W440R probably damaging Het
Trp53bp2 A G 1: 182,448,997 T848A probably benign Het
Tssk1 G A 16: 17,895,062 R237H probably benign Het
Ttll4 A T 1: 74,679,007 T6S possibly damaging Het
Ttn G T 2: 76,721,797 Y29419* probably null Het
Ttn A G 2: 76,769,603 Y19076H probably damaging Het
Ubr3 T A 2: 69,959,603 V867D probably damaging Het
Usp29 A G 7: 6,961,391 T78A probably damaging Het
Utrn T G 10: 12,654,745 Q2108P probably benign Het
Vcan T C 13: 89,705,789 N351D probably damaging Het
Vmn1r61 A T 7: 5,611,125 Y63* probably null Het
Vmn1r61 A T 7: 5,611,127 Y63N probably benign Het
Vmn1r85 A T 7: 13,084,861 W119R probably damaging Het
Zbtb21 A C 16: 97,950,455 V190G possibly damaging Het
Zfp157 C A 5: 138,444,789 T14N probably damaging Het
Zfp942 A T 17: 21,929,419 H76Q probably damaging Het
Other mutations in Dnah1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00090:Dnah1 APN 14 31287873 missense probably benign 0.01
IGL00227:Dnah1 APN 14 31286896 missense probably damaging 1.00
IGL00491:Dnah1 APN 14 31261839 missense probably damaging 1.00
IGL00787:Dnah1 APN 14 31300063 missense possibly damaging 0.91
IGL00809:Dnah1 APN 14 31300809 nonsense probably null
IGL00911:Dnah1 APN 14 31304434 splice site probably null
IGL00949:Dnah1 APN 14 31307090 missense probably benign 0.00
IGL00976:Dnah1 APN 14 31278138 missense probably damaging 1.00
IGL01484:Dnah1 APN 14 31299940 missense probably damaging 0.98
IGL01629:Dnah1 APN 14 31292320 missense probably damaging 1.00
IGL01716:Dnah1 APN 14 31263378 missense probably benign 0.34
IGL01893:Dnah1 APN 14 31266470 missense probably damaging 1.00
IGL01933:Dnah1 APN 14 31310915 missense probably benign 0.40
IGL01938:Dnah1 APN 14 31283887 missense probably benign
IGL02032:Dnah1 APN 14 31274369 missense probably benign
IGL02052:Dnah1 APN 14 31268786 missense probably damaging 0.99
IGL02097:Dnah1 APN 14 31305001 missense possibly damaging 0.92
IGL02127:Dnah1 APN 14 31304928 missense probably benign 0.00
IGL02143:Dnah1 APN 14 31283289 missense probably damaging 1.00
IGL02158:Dnah1 APN 14 31300967 missense probably benign 0.00
IGL02442:Dnah1 APN 14 31287878 missense probably damaging 1.00
IGL02525:Dnah1 APN 14 31305833 missense probably benign 0.05
IGL02558:Dnah1 APN 14 31274379 missense possibly damaging 0.96
IGL02633:Dnah1 APN 14 31284815 missense probably benign 0.05
IGL02720:Dnah1 APN 14 31262220 missense probably damaging 0.96
IGL02728:Dnah1 APN 14 31283998 missense probably benign 0.44
IGL02738:Dnah1 APN 14 31292640 missense probably benign 0.27
IGL02863:Dnah1 APN 14 31295293 missense probably damaging 0.99
IGL02944:Dnah1 APN 14 31300871 missense possibly damaging 0.88
IGL03110:Dnah1 APN 14 31266717 missense probably benign 0.40
IGL03201:Dnah1 APN 14 31300949 missense probably benign 0.13
IGL03215:Dnah1 APN 14 31274391 missense probably damaging 1.00
IGL03230:Dnah1 APN 14 31270066 missense probably damaging 1.00
IGL03248:Dnah1 APN 14 31269889 missense probably damaging 1.00
IGL03267:Dnah1 APN 14 31286588 missense probably benign 0.00
IGL03299:Dnah1 APN 14 31315122 nonsense probably null
IGL03301:Dnah1 APN 14 31292692 missense probably damaging 1.00
ergonomic UTSW 14 31300748 missense possibly damaging 0.91
faraday UTSW 14 31310882 missense probably null 0.05
K3955:Dnah1 UTSW 14 31266459 missense probably benign
PIT1430001:Dnah1 UTSW 14 31262580 missense probably damaging 1.00
PIT4382001:Dnah1 UTSW 14 31284455 missense probably damaging 1.00
R0043:Dnah1 UTSW 14 31274405 missense probably damaging 0.97
R0092:Dnah1 UTSW 14 31271609 missense probably benign 0.00
R0100:Dnah1 UTSW 14 31262152 critical splice donor site probably null
R0100:Dnah1 UTSW 14 31262152 critical splice donor site probably null
R0101:Dnah1 UTSW 14 31283899 missense probably damaging 1.00
R0119:Dnah1 UTSW 14 31276158 missense probably damaging 1.00
R0136:Dnah1 UTSW 14 31276158 missense probably damaging 1.00
R0144:Dnah1 UTSW 14 31267874 splice site probably benign
R0279:Dnah1 UTSW 14 31302375 missense possibly damaging 0.94
R0299:Dnah1 UTSW 14 31276158 missense probably damaging 1.00
R0316:Dnah1 UTSW 14 31278151 missense probably benign 0.00
R0739:Dnah1 UTSW 14 31265915 nonsense probably null
R0789:Dnah1 UTSW 14 31304591 missense probably benign
R0826:Dnah1 UTSW 14 31303907 missense probably benign 0.02
R1102:Dnah1 UTSW 14 31296457 nonsense probably null
R1116:Dnah1 UTSW 14 31307867 missense probably benign 0.13
R1229:Dnah1 UTSW 14 31310851 missense probably benign 0.11
R1447:Dnah1 UTSW 14 31306898 missense probably benign 0.06
R1449:Dnah1 UTSW 14 31263951 missense probably damaging 1.00
R1462:Dnah1 UTSW 14 31268781 splice site probably benign
R1482:Dnah1 UTSW 14 31294874 missense probably damaging 1.00
R1500:Dnah1 UTSW 14 31316758 missense probably benign
R1512:Dnah1 UTSW 14 31293037 missense probably damaging 1.00
R1591:Dnah1 UTSW 14 31272332 missense probably benign 0.01
R1598:Dnah1 UTSW 14 31301262 missense probably benign 0.07
R1644:Dnah1 UTSW 14 31302292 splice site probably benign
R1672:Dnah1 UTSW 14 31276200 missense probably damaging 1.00
R1713:Dnah1 UTSW 14 31279182 missense probably damaging 1.00
R1769:Dnah1 UTSW 14 31310882 missense probably null 0.05
R1796:Dnah1 UTSW 14 31261093 missense probably benign 0.00
R1902:Dnah1 UTSW 14 31319759 missense probably damaging 0.99
R1903:Dnah1 UTSW 14 31319759 missense probably damaging 0.99
R1905:Dnah1 UTSW 14 31264630 missense probably benign 0.06
R1908:Dnah1 UTSW 14 31262558 missense probably damaging 1.00
R1972:Dnah1 UTSW 14 31265391 nonsense probably null
R1973:Dnah1 UTSW 14 31265391 nonsense probably null
R2004:Dnah1 UTSW 14 31301856 missense possibly damaging 0.79
R2051:Dnah1 UTSW 14 31279123 missense probably damaging 1.00
R2062:Dnah1 UTSW 14 31271129 missense probably damaging 1.00
R2188:Dnah1 UTSW 14 31279164 missense probably damaging 0.98
R2240:Dnah1 UTSW 14 31299974 missense probably benign 0.00
R2862:Dnah1 UTSW 14 31284762 missense probably benign 0.21
R2894:Dnah1 UTSW 14 31298761 missense possibly damaging 0.67
R3120:Dnah1 UTSW 14 31266822 nonsense probably null
R3410:Dnah1 UTSW 14 31269817 missense possibly damaging 0.55
R3411:Dnah1 UTSW 14 31269817 missense possibly damaging 0.55
R3435:Dnah1 UTSW 14 31316674 missense probably damaging 0.96
R3615:Dnah1 UTSW 14 31315148 missense possibly damaging 0.92
R3616:Dnah1 UTSW 14 31315148 missense possibly damaging 0.92
R3741:Dnah1 UTSW 14 31265467 splice site probably benign
R3805:Dnah1 UTSW 14 31294763 missense possibly damaging 0.67
R3894:Dnah1 UTSW 14 31307028 missense probably benign
R4007:Dnah1 UTSW 14 31303784 splice site probably benign
R4201:Dnah1 UTSW 14 31262270 missense probably benign 0.00
R4232:Dnah1 UTSW 14 31304916 missense probably benign
R4372:Dnah1 UTSW 14 31304922 missense probably damaging 1.00
R4391:Dnah1 UTSW 14 31294835 missense probably damaging 1.00
R4423:Dnah1 UTSW 14 31284761 missense probably benign 0.00
R4526:Dnah1 UTSW 14 31285998 missense probably benign 0.05
R4650:Dnah1 UTSW 14 31284887 splice site probably null
R4723:Dnah1 UTSW 14 31272942 missense probably damaging 1.00
R4748:Dnah1 UTSW 14 31319945 missense probably benign
R4783:Dnah1 UTSW 14 31263479 missense probably damaging 1.00
R4784:Dnah1 UTSW 14 31263479 missense probably damaging 1.00
R4843:Dnah1 UTSW 14 31264963 missense probably damaging 1.00
R4879:Dnah1 UTSW 14 31300748 missense possibly damaging 0.91
R4897:Dnah1 UTSW 14 31267539 missense probably damaging 1.00
R4911:Dnah1 UTSW 14 31295323 missense probably damaging 1.00
R4985:Dnah1 UTSW 14 31286898 missense probably null 1.00
R5070:Dnah1 UTSW 14 31282418 missense probably benign 0.05
R5128:Dnah1 UTSW 14 31296195 splice site probably null
R5409:Dnah1 UTSW 14 31263255 missense probably damaging 1.00
R5436:Dnah1 UTSW 14 31316747 missense probably benign
R5481:Dnah1 UTSW 14 31308871 missense possibly damaging 0.55
R5550:Dnah1 UTSW 14 31316708 missense probably benign 0.00
R5555:Dnah1 UTSW 14 31290819 missense probably damaging 0.99
R5566:Dnah1 UTSW 14 31274366 missense probably benign 0.35
R5623:Dnah1 UTSW 14 31286023 missense possibly damaging 0.62
R5701:Dnah1 UTSW 14 31274044 missense probably damaging 1.00
R5751:Dnah1 UTSW 14 31310906 missense probably benign 0.00
R5823:Dnah1 UTSW 14 31266418 missense possibly damaging 0.92
R6030:Dnah1 UTSW 14 31268027 missense probably damaging 1.00
R6030:Dnah1 UTSW 14 31268027 missense probably damaging 1.00
R6090:Dnah1 UTSW 14 31269425 missense possibly damaging 0.83
R6139:Dnah1 UTSW 14 31286027 missense probably benign 0.02
R6145:Dnah1 UTSW 14 31300970 missense probably benign 0.07
R6306:Dnah1 UTSW 14 31304587 missense probably damaging 0.97
R6376:Dnah1 UTSW 14 31275608 missense probably damaging 1.00
R6451:Dnah1 UTSW 14 31300808 missense probably benign 0.08
R6549:Dnah1 UTSW 14 31269383 missense probably damaging 1.00
R6748:Dnah1 UTSW 14 31299988 missense probably damaging 0.99
R6826:Dnah1 UTSW 14 31286290 missense probably benign 0.00
R6870:Dnah1 UTSW 14 31271061 nonsense probably null
R6932:Dnah1 UTSW 14 31287776 missense probably damaging 1.00
R6944:Dnah1 UTSW 14 31268904 missense probably damaging 1.00
R7033:Dnah1 UTSW 14 31264925 missense probably damaging 1.00
R7078:Dnah1 UTSW 14 31297110 missense probably damaging 1.00
R7133:Dnah1 UTSW 14 31286076 missense probably benign
R7136:Dnah1 UTSW 14 31298656 missense probably damaging 1.00
R7203:Dnah1 UTSW 14 31274382 missense probably benign
R7241:Dnah1 UTSW 14 31264939 missense probably benign 0.00
R7260:Dnah1 UTSW 14 31269386 missense probably damaging 1.00
R7264:Dnah1 UTSW 14 31269894 missense probably benign
R7291:Dnah1 UTSW 14 31298705 missense probably damaging 1.00
R7293:Dnah1 UTSW 14 31287863 missense probably damaging 1.00
R7300:Dnah1 UTSW 14 31269841 missense probably benign 0.05
R7319:Dnah1 UTSW 14 31296594 missense probably benign 0.02
R7323:Dnah1 UTSW 14 31298707 missense probably damaging 1.00
Z1088:Dnah1 UTSW 14 31304811 missense probably benign 0.17
Predicted Primers PCR Primer
(F):5'- AGTATGTTCATGACACAACGGCG -3'
(R):5'- GGTGAGACACAATTCTAAGCAC -3'

Sequencing Primer
(F):5'- CAGCTGTATACTTGAGAACCTATGGG -3'
(R):5'- GTGAGACACAATTCTAAGCACTTACC -3'
Posted On2015-12-29