Mutagenetix > Incidental Mutations

Incidental Mutation 'R0412:Slc12a5'

36702

Institutional Source

Beutler Lab

Gene Symbol

Slc12a5

Ensembl Gene

ENSMUSG00000017740

Gene Name

solute carrier family 12, member 5

Synonyms

KCC2

MMRRC Submission

038614-MU

Accession Numbers

Is this an essential gene?

Essential (E-score: 1.000) question?

Stock #

R0412 (G1)

Quality Score

217

Status

Validated

Chromosome

Chromosomal Location

164960802-164999731 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

C to T at 164994062 bp

Zygosity

Heterozygous

Amino Acid Change

Threonine to Methionine at position 900 (T900M)

Ref Sequence

ENSEMBL: ENSMUSP00000144623 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000099092] [ENSMUST00000202136] [ENSMUST00000202223] [ENSMUST00000202479] [ENSMUST00000202623]

Predicted Effect

probably benign
Transcript: ENSMUST00000099092
AA Change: T877M

PolyPhen 2 Score 0.006 (Sensitivity: 0.97; Specificity: 0.75)

SMART Domains

Protein: ENSMUSP00000096690
Gene: ENSMUSG00000017740
AA Change: T877M

Domain	Start	End	E-Value	Type
low complexity region	10	22	N/A	INTRINSIC
low complexity region	77	90	N/A	INTRINSIC
Pfam:AA_permease	102	304	5.2e-22	PFAM
Pfam:AA_permease_2	364	632	1e-17	PFAM
Pfam:AA_permease	389	676	1.9e-42	PFAM
Pfam:SLC12	688	814	2.1e-19	PFAM
Pfam:SLC12	807	959	1.8e-20	PFAM
low complexity region	978	1002	N/A	INTRINSIC
Pfam:SLC12	1009	1115	2.1e-15	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000137302

Predicted Effect

probably benign
Transcript: ENSMUST00000202136

SMART Domains

Protein: ENSMUSP00000143973
Gene: ENSMUSG00000017740

Domain	Start	End	E-Value	Type
low complexity region	10	22	N/A	INTRINSIC
low complexity region	77	90	N/A	INTRINSIC
Pfam:AA_permease	102	175	2.5e-10	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000202223
AA Change: T900M

PolyPhen 2 Score 0.046 (Sensitivity: 0.94; Specificity: 0.83)

SMART Domains

Protein: ENSMUSP00000143870
Gene: ENSMUSG00000017740
AA Change: T900M

Domain	Start	End	E-Value	Type
low complexity region	11	19	N/A	INTRINSIC
low complexity region	100	113	N/A	INTRINSIC
Pfam:AA_permease	125	327	1e-19	PFAM
Pfam:AA_permease_2	386	655	4.5e-15	PFAM
Pfam:AA_permease	412	699	3.7e-40	PFAM
Pfam:SLC12	711	837	7.2e-17	PFAM
Pfam:SLC12	830	982	6.2e-18	PFAM
low complexity region	1001	1025	N/A	INTRINSIC
Pfam:SLC12	1030	1133	8.6e-13	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000202479

SMART Domains

Protein: ENSMUSP00000144540
Gene: ENSMUSG00000017740

Domain	Start	End	E-Value	Type
low complexity region	10	22	N/A	INTRINSIC
low complexity region	77	90	N/A	INTRINSIC
Pfam:AA_permease	102	176	5.2e-10	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000202623
AA Change: T900M

PolyPhen 2 Score 0.046 (Sensitivity: 0.94; Specificity: 0.83)

SMART Domains

Protein: ENSMUSP00000144623
Gene: ENSMUSG00000017740
AA Change: T900M

Domain	Start	End	E-Value	Type
low complexity region	11	19	N/A	INTRINSIC
low complexity region	100	113	N/A	INTRINSIC
Pfam:AA_permease	125	327	5.3e-22	PFAM
Pfam:AA_permease_2	386	655	1.2e-17	PFAM
Pfam:AA_permease	412	699	2e-42	PFAM
Pfam:SLC12	711	837	2.1e-19	PFAM
Pfam:SLC12	830	982	1.8e-20	PFAM
low complexity region	1001	1025	N/A	INTRINSIC
Pfam:SLC12	1032	1138	2.2e-15	PFAM

Meta Mutation Damage Score

0.0898

Coding Region Coverage

1x: 99.1%
3x: 98.2%
10x: 95.8%
20x: 90.2%

Validation Efficiency

94% (67/71)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] K-Cl cotransporters are proteins that lower intracellular chloride concentrations below the electrochemical equilibrium potential. The protein encoded by this gene is an integral membrane K-Cl cotransporter that can function in either a net efflux or influx pathway, depending on the chemical concentration gradients of potassium and chloride. The encoded protein can act as a homomultimer, or as a heteromultimer with other K-Cl cotransporters, to maintain chloride homeostasis in neurons. Alternative splicing results in two transcript variants encoding different isoforms. [provided by RefSeq, Sep 2008]
PHENOTYPE: Mice homozygous for disruptions in this gene die within a few minutes of birth of respiratory failure resulting from a motor nerve defect. Mice homozygous for a hypomorphic allele display postnatal lethality and tonic-clonic seizures. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 61 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4932431P20Rik	C	G	7: 29,530,570		noncoding transcript	Het
Arap1	C	A	7: 101,390,222	A563D	probably damaging	Het
Arhgap28	G	A	17: 67,896,258	L67F	probably damaging	Het
Atp7b	G	T	8: 21,995,659		probably null	Het
Auts2	A	G	5: 131,446,831	F485L	probably benign	Het
Ccdc68	A	G	18: 69,960,439	E239G	probably damaging	Het
Cdc42bpg	T	G	19: 6,313,457	L449R	probably damaging	Het
Colgalt2	G	T	1: 152,508,561	A551S	possibly damaging	Het
Ddx41	G	T	13: 55,530,608	S630Y	probably damaging	Het
Dntt	T	C	19: 41,042,933	L274P	probably damaging	Het
Fhl4	G	T	10: 85,098,816	H34N	possibly damaging	Het
Filip1	A	T	9: 79,820,289	N349K	possibly damaging	Het
Gm9894	C	T	13: 67,765,026		noncoding transcript	Het
Gpr179	A	G	11: 97,338,807	S841P	probably damaging	Het
Gpr35	G	T	1: 92,982,784	V73L	probably benign	Het
Grik5	A	G	7: 25,013,674	V809A	possibly damaging	Het
H2-Bl	T	A	17: 36,081,521		probably benign	Het
Heatr5b	T	C	17: 78,820,854	T451A	probably benign	Het
Hmcn2	G	A	2: 31,388,247	V1654M	probably damaging	Het
Htra3	G	T	5: 35,671,065	A157E	probably damaging	Het
Igf2r	A	T	17: 12,683,948	V2405D	probably damaging	Het
Irs3	C	A	5: 137,643,877	R433L	probably benign	Het
Kcmf1	G	A	6: 72,848,241	Q239*	probably null	Het
Kcnk9	A	G	15: 72,513,056		probably benign	Het
Kif28	A	G	1: 179,702,526	V622A	probably benign	Het
Klrb1f	A	T	6: 129,054,331	I164F	probably benign	Het
Lama2	A	G	10: 27,190,625	S1087P	possibly damaging	Het
Mchr1	A	T	15: 81,235,747		probably benign	Het
Mcidas	A	G	13: 112,999,143	T367A	probably damaging	Het
Mphosph8	A	C	14: 56,674,413	K298Q	probably damaging	Het
Mroh2a	G	T	1: 88,235,216	Q360H	probably benign	Het
Mst1	A	C	9: 108,083,594	D461A	probably benign	Het
Nckap1l	A	T	15: 103,464,652	S311C	probably benign	Het
Olfr1036	C	T	2: 86,075,091	A117V	probably benign	Het
Olfr1233	T	A	2: 89,340,078	M75L	probably benign	Het
Olfr1385	T	A	11: 49,494,767	V78E	probably damaging	Het
Olfr251	A	C	9: 38,378,794	K298N	probably damaging	Het
Pde3a	T	G	6: 141,498,684	C1073G	probably damaging	Het
Pkhd1	T	C	1: 20,117,788	D3432G	probably damaging	Het
Ppargc1b	G	T	18: 61,315,861	P130Q	probably damaging	Het
Ppp6r1	A	G	7: 4,642,214	I228T	probably damaging	Het
Pram1	A	G	17: 33,641,506	N349S	probably benign	Het
Ranbp6	C	T	19: 29,812,083	V290I	possibly damaging	Het
Rcan3	A	T	4: 135,416,603		probably null	Het
Scn8a	G	C	15: 101,008,306		probably benign	Het
Srsf10	A	G	4: 135,858,403	Y55C	probably damaging	Het
Syt7	G	T	19: 10,444,080	E450*	probably null	Het
Tbrg4	T	C	11: 6,623,832	K130R	probably benign	Het
Tgm7	C	A	2: 121,101,065	V206F	probably damaging	Het
Tmem131l	T	C	3: 84,031,648	D67G	probably damaging	Het
Ttc7	A	G	17: 87,330,044	K409R	probably benign	Het
Unc80	A	T	1: 66,550,937		probably benign	Het
Vmn1r171	C	T	7: 23,632,655	L102F	possibly damaging	Het
Vmn2r59	A	C	7: 42,046,492		probably benign	Het
Vsig2	A	G	9: 37,542,690	R191G	probably damaging	Het
Wdr86	T	A	5: 24,718,234	Q153H	probably benign	Het
Xxylt1	T	A	16: 31,007,798	N233I	probably damaging	Het
Zfp160	A	T	17: 21,026,877	E563V	probably damaging	Het
Zfp345	T	A	2: 150,473,403	E71D	probably benign	Het
Zfp541	A	G	7: 16,082,174	D862G	possibly damaging	Het
Zfp639	A	C	3: 32,517,110	Q47P	possibly damaging	Het

Other mutations in Slc12a5

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00324:Slc12a5	APN	2	164997121	missense	probably damaging	1.00
IGL00425:Slc12a5	APN	2	164983281	missense	probably damaging	1.00
IGL00976:Slc12a5	APN	2	164979304	missense	probably damaging	1.00
IGL01654:Slc12a5	APN	2	164973755	missense	possibly damaging	0.91
IGL01905:Slc12a5	APN	2	164990381	missense	probably benign	0.02
IGL02205:Slc12a5	APN	2	164996479	missense	probably benign	0.03
IGL02510:Slc12a5	APN	2	164982808	splice site	probably benign
IGL02746:Slc12a5	APN	2	164974916	missense	probably benign	0.01
R0051:Slc12a5	UTSW	2	164986663	missense	probably damaging	1.00
R0254:Slc12a5	UTSW	2	164997245	critical splice donor site	probably null
R0587:Slc12a5	UTSW	2	164976533	missense	probably damaging	1.00
R0835:Slc12a5	UTSW	2	164994038	missense	probably damaging	0.97
R0932:Slc12a5	UTSW	2	164996885	splice site	probably benign
R1643:Slc12a5	UTSW	2	164994027	missense	probably benign	0.01
R1700:Slc12a5	UTSW	2	164992376	missense	possibly damaging	0.94
R1760:Slc12a5	UTSW	2	164996128	missense	probably damaging	0.99
R2063:Slc12a5	UTSW	2	164997147	missense	probably damaging	1.00
R2293:Slc12a5	UTSW	2	164992330	missense	probably benign	0.03
R2412:Slc12a5	UTSW	2	164976462	critical splice donor site	probably null
R3035:Slc12a5	UTSW	2	164980258	missense	probably benign	0.06
R3116:Slc12a5	UTSW	2	164996181	splice site	probably null
R3412:Slc12a5	UTSW	2	164968431	missense	probably benign	0.26
R3788:Slc12a5	UTSW	2	164993775	missense	probably damaging	1.00
R4039:Slc12a5	UTSW	2	164992330	missense	probably benign	0.03
R4174:Slc12a5	UTSW	2	164979490	missense	probably damaging	1.00
R4492:Slc12a5	UTSW	2	164979343	missense	probably benign	0.08
R4608:Slc12a5	UTSW	2	164973765	missense	probably damaging	0.99
R4750:Slc12a5	UTSW	2	164982931	missense	probably benign	0.06
R4994:Slc12a5	UTSW	2	164983365	splice site	probably null
R5103:Slc12a5	UTSW	2	164992433	missense	probably damaging	1.00
R5539:Slc12a5	UTSW	2	164987206	missense	possibly damaging	0.94
R5632:Slc12a5	UTSW	2	164987221	missense	possibly damaging	0.86
R5771:Slc12a5	UTSW	2	164973768	missense	possibly damaging	0.88
R6139:Slc12a5	UTSW	2	164992311	missense	probably damaging	0.98
R6336:Slc12a5	UTSW	2	164992464	splice site	probably null
R6581:Slc12a5	UTSW	2	164987115	missense	probably damaging	1.00
R6706:Slc12a5	UTSW	2	164988589	missense	probably damaging	1.00
R6886:Slc12a5	UTSW	2	164982905	missense	probably benign
R7134:Slc12a5	UTSW	2	164974958	missense	probably damaging	1.00
R7310:Slc12a5	UTSW	2	164992440	missense	probably damaging	1.00
R7402:Slc12a5	UTSW	2	164982932	missense	probably benign	0.01
R8079:Slc12a5	UTSW	2	164992452	missense	probably damaging	1.00
R8301:Slc12a5	UTSW	2	164993691	missense	probably damaging	0.98

Predicted Primers

PCR Primer
(F):5'- CCTGCTGGTCACCAAGAATGTTTCC -3'
(R):5'- GAAGGCGACCTGTATCATCCACTG -3'

Sequencing Primer
(F):5'- GTGTCCATGCAGGTCCATC -3'
(R):5'- GTATCATCCACTGACGGCTATG -3'

Posted On

2013-05-09