Incidental Mutation 'R0412:Wdr86'
ID36705
Institutional Source Beutler Lab
Gene Symbol Wdr86
Ensembl Gene ENSMUSG00000055235
Gene NameWD repeat domain 86
Synonyms
MMRRC Submission 038614-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.088) question?
Stock #R0412 (G1)
Quality Score124
Status Validated
Chromosome5
Chromosomal Location24711738-24730727 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 24718234 bp
ZygosityHeterozygous
Amino Acid Change Glutamine to Histidine at position 153 (Q153H)
Ref Sequence ENSEMBL: ENSMUSP00000064785 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000068693]
Predicted Effect probably benign
Transcript: ENSMUST00000068693
AA Change: Q153H

PolyPhen 2 Score 0.007 (Sensitivity: 0.96; Specificity: 0.75)
SMART Domains Protein: ENSMUSP00000064785
Gene: ENSMUSG00000055235
AA Change: Q153H

DomainStartEndE-ValueType
WD40 4 43 1.62e-8 SMART
WD40 46 83 3.17e-2 SMART
WD40 86 123 1.9e-5 SMART
WD40 126 179 3e-3 SMART
WD40 182 221 2.78e-7 SMART
WD40 224 261 9.9e-4 SMART
WD40 264 301 1.29e-2 SMART
WD40 304 341 6.28e-6 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000127320
SMART Domains Protein: ENSMUSP00000119649
Gene: ENSMUSG00000055235

DomainStartEndE-ValueType
WD40 29 63 1.27e2 SMART
WD40 66 103 6.28e-6 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000142607
Predicted Effect noncoding transcript
Transcript: ENSMUST00000196443
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.2%
  • 10x: 95.8%
  • 20x: 90.2%
Validation Efficiency 94% (67/71)
Allele List at MGI
Other mutations in this stock
Total: 61 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932431P20Rik C G 7: 29,530,570 noncoding transcript Het
Arap1 C A 7: 101,390,222 A563D probably damaging Het
Arhgap28 G A 17: 67,896,258 L67F probably damaging Het
Atp7b G T 8: 21,995,659 probably null Het
Auts2 A G 5: 131,446,831 F485L probably benign Het
Ccdc68 A G 18: 69,960,439 E239G probably damaging Het
Cdc42bpg T G 19: 6,313,457 L449R probably damaging Het
Colgalt2 G T 1: 152,508,561 A551S possibly damaging Het
Ddx41 G T 13: 55,530,608 S630Y probably damaging Het
Dntt T C 19: 41,042,933 L274P probably damaging Het
Fhl4 G T 10: 85,098,816 H34N possibly damaging Het
Filip1 A T 9: 79,820,289 N349K possibly damaging Het
Gm9894 C T 13: 67,765,026 noncoding transcript Het
Gpr179 A G 11: 97,338,807 S841P probably damaging Het
Gpr35 G T 1: 92,982,784 V73L probably benign Het
Grik5 A G 7: 25,013,674 V809A possibly damaging Het
H2-Bl T A 17: 36,081,521 probably benign Het
Heatr5b T C 17: 78,820,854 T451A probably benign Het
Hmcn2 G A 2: 31,388,247 V1654M probably damaging Het
Htra3 G T 5: 35,671,065 A157E probably damaging Het
Igf2r A T 17: 12,683,948 V2405D probably damaging Het
Irs3 C A 5: 137,643,877 R433L probably benign Het
Kcmf1 G A 6: 72,848,241 Q239* probably null Het
Kcnk9 A G 15: 72,513,056 probably benign Het
Kif28 A G 1: 179,702,526 V622A probably benign Het
Klrb1f A T 6: 129,054,331 I164F probably benign Het
Lama2 A G 10: 27,190,625 S1087P possibly damaging Het
Mchr1 A T 15: 81,235,747 probably benign Het
Mcidas A G 13: 112,999,143 T367A probably damaging Het
Mphosph8 A C 14: 56,674,413 K298Q probably damaging Het
Mroh2a G T 1: 88,235,216 Q360H probably benign Het
Mst1 A C 9: 108,083,594 D461A probably benign Het
Nckap1l A T 15: 103,464,652 S311C probably benign Het
Olfr1036 C T 2: 86,075,091 A117V probably benign Het
Olfr1233 T A 2: 89,340,078 M75L probably benign Het
Olfr1385 T A 11: 49,494,767 V78E probably damaging Het
Olfr251 A C 9: 38,378,794 K298N probably damaging Het
Pde3a T G 6: 141,498,684 C1073G probably damaging Het
Pkhd1 T C 1: 20,117,788 D3432G probably damaging Het
Ppargc1b G T 18: 61,315,861 P130Q probably damaging Het
Ppp6r1 A G 7: 4,642,214 I228T probably damaging Het
Pram1 A G 17: 33,641,506 N349S probably benign Het
Ranbp6 C T 19: 29,812,083 V290I possibly damaging Het
Rcan3 A T 4: 135,416,603 probably null Het
Scn8a G C 15: 101,008,306 probably benign Het
Slc12a5 C T 2: 164,994,062 T900M probably benign Het
Srsf10 A G 4: 135,858,403 Y55C probably damaging Het
Syt7 G T 19: 10,444,080 E450* probably null Het
Tbrg4 T C 11: 6,623,832 K130R probably benign Het
Tgm7 C A 2: 121,101,065 V206F probably damaging Het
Tmem131l T C 3: 84,031,648 D67G probably damaging Het
Ttc7 A G 17: 87,330,044 K409R probably benign Het
Unc80 A T 1: 66,550,937 probably benign Het
Vmn1r171 C T 7: 23,632,655 L102F possibly damaging Het
Vmn2r59 A C 7: 42,046,492 probably benign Het
Vsig2 A G 9: 37,542,690 R191G probably damaging Het
Xxylt1 T A 16: 31,007,798 N233I probably damaging Het
Zfp160 A T 17: 21,026,877 E563V probably damaging Het
Zfp345 T A 2: 150,473,403 E71D probably benign Het
Zfp541 A G 7: 16,082,174 D862G possibly damaging Het
Zfp639 A C 3: 32,517,110 Q47P possibly damaging Het
Other mutations in Wdr86
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02419:Wdr86 APN 5 24722704 missense probably damaging 1.00
R0899:Wdr86 UTSW 5 24718007 missense probably benign 0.15
R2520:Wdr86 UTSW 5 24712575 makesense probably null
R3522:Wdr86 UTSW 5 24718307 missense probably benign 0.00
R3686:Wdr86 UTSW 5 24718341 missense probably damaging 1.00
R4439:Wdr86 UTSW 5 24730237 missense probably damaging 1.00
R4657:Wdr86 UTSW 5 24718231 missense probably benign 0.00
R4989:Wdr86 UTSW 5 24712845 splice site probably null
R5649:Wdr86 UTSW 5 24718087 missense probably benign
R5940:Wdr86 UTSW 5 24722662 missense probably damaging 1.00
R6254:Wdr86 UTSW 5 24718283 missense probably benign 0.04
R8012:Wdr86 UTSW 5 24730179 critical splice donor site probably null
R8395:Wdr86 UTSW 5 24730189 missense probably damaging 1.00
Z1177:Wdr86 UTSW 5 24712748 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GGTCTCACCTCCAAACAGATGACAG -3'
(R):5'- CCTAGTTGCCAATGACCAGCTCTTC -3'

Sequencing Primer
(F):5'- TGGTGCTCCCGGAAAACTC -3'
(R):5'- CAGCAGTTCCTATGATCGGACAG -3'
Posted On2013-05-09