Incidental Mutation 'R4786:Stradb'
ID367050
Institutional Source Beutler Lab
Gene Symbol Stradb
Ensembl Gene ENSMUSG00000026027
Gene NameSTE20-related kinase adaptor beta
SynonymsAls2cr2, D1Ucla2, PRO1038
MMRRC Submission 041995-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4786 (G1)
Quality Score225
Status Not validated
Chromosome1
Chromosomal Location58973522-58995715 bp(+) (GRCm38)
Type of Mutationintron
DNA Base Change (assembly) A to T at 58991208 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000137724 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000027185] [ENSMUST00000114296] [ENSMUST00000123301] [ENSMUST00000153990]
Predicted Effect probably benign
Transcript: ENSMUST00000027185
SMART Domains Protein: ENSMUSP00000027185
Gene: ENSMUSG00000026027

DomainStartEndE-ValueType
Pfam:Pkinase_Tyr 58 290 3.2e-26 PFAM
Pfam:Pkinase 58 369 7.9e-37 PFAM
Predicted Effect unknown
Transcript: ENSMUST00000114296
AA Change: D207V
SMART Domains Protein: ENSMUSP00000109935
Gene: ENSMUSG00000026027
AA Change: D207V

DomainStartEndE-ValueType
Pfam:Pkinase 58 185 1.1e-16 PFAM
Pfam:Pkinase_Tyr 58 188 1.3e-13 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000123301
SMART Domains Protein: ENSMUSP00000138036
Gene: ENSMUSG00000026027

DomainStartEndE-ValueType
Pfam:Pkinase 58 184 2.7e-17 PFAM
Pfam:Pkinase_Tyr 58 185 1.1e-13 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000147637
Predicted Effect probably benign
Transcript: ENSMUST00000152318
Predicted Effect probably benign
Transcript: ENSMUST00000153990
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.0%
  • 20x: 94.7%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that belongs to the serine/threonine protein kinase STE20 subfamily. One of the active site residues in the protein kinase domain of this protein is altered, and it is thus a pseudokinase. This protein is a component of a complex involved in the activation of serine/threonine kinase 11, a master kinase that regulates cell polarity and energy-generating metabolism. This complex regulates the relocation of this kinase from the nucleus to the cytoplasm, and it is essential for G1 cell cycle arrest mediated by this kinase. The protein encoded by this gene can also interact with the X chromosome-linked inhibitor of apoptosis protein, and this interaction enhances the anti-apoptotic activity of this protein via the JNK1 signal transduction pathway. Two pseudogenes, located on chromosomes 1 and 7, have been found for this gene. Alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, May 2011]
Allele List at MGI
Other mutations in this stock
Total: 86 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2700097O09Rik A T 12: 55,059,536 I134N possibly damaging Het
Acvr1c T C 2: 58,280,354 Y414C probably damaging Het
Adam32 A C 8: 24,863,493 S693R probably damaging Het
Aldh2 A T 5: 121,572,824 F314Y probably benign Het
Anks1 A G 17: 28,052,730 D874G possibly damaging Het
Ap4b1 T A 3: 103,818,804 V372E probably benign Het
Aqp12 G A 1: 93,006,455 C18Y probably damaging Het
Arap1 T A 7: 101,385,005 I218N possibly damaging Het
Arhgap42 C A 9: 9,238,698 E28* probably null Het
Asb5 G A 8: 54,585,839 E247K probably benign Het
Atg9b T C 5: 24,386,089 D781G possibly damaging Het
Atxn10 A G 15: 85,387,143 H294R probably benign Het
Bod1l G T 5: 41,819,438 T1511K probably benign Het
Btnl2 A T 17: 34,363,348 N296I probably damaging Het
Camta1 A T 4: 151,290,039 L168H probably damaging Het
Cant1 A T 11: 118,408,839 V265E possibly damaging Het
Ccdc157 T C 11: 4,151,861 D20G probably damaging Het
Cd209c T G 8: 3,945,698 T35P possibly damaging Het
Cdc20b G A 13: 113,078,734 V279M probably damaging Het
Cdh18 T A 15: 23,410,787 W453R probably null Het
Cdh24 A G 14: 54,637,550 S333P possibly damaging Het
Ceacam11 T C 7: 17,972,314 probably null Het
Ciz1 C T 2: 32,377,527 P150L probably damaging Het
Crip3 C A 17: 46,431,042 Q152K possibly damaging Het
Dars2 G A 1: 161,060,760 R197W probably damaging Het
Dctn4 A G 18: 60,555,195 D394G probably damaging Het
Dido1 T C 2: 180,670,871 Y1077C possibly damaging Het
Dnhd1 A G 7: 105,674,444 T641A probably benign Het
Egln3 A T 12: 54,185,581 I146N probably damaging Het
Eif2ak3 C T 6: 70,892,618 T763M possibly damaging Het
Etfbkmt A T 6: 149,147,246 M1L probably benign Het
Fam171a1 A T 2: 3,225,578 I583F probably damaging Het
Fbxo38 A C 18: 62,529,674 L249W probably damaging Het
Fxyd5 T C 7: 31,041,482 probably benign Het
Gabrr3 C A 16: 59,430,100 T154K probably benign Het
Gm7233 C A 14: 43,180,890 D90E probably benign Het
Gm8186 A G 17: 26,099,040 V61A probably benign Het
Gm9573 A T 17: 35,619,329 probably benign Het
Gnao1 A G 8: 93,944,303 I137V probably benign Het
Gnptab A G 10: 88,436,182 M945V probably damaging Het
Gpsm1 G A 2: 26,322,481 A78T probably benign Het
Gtf2b T C 3: 142,781,469 L222P probably damaging Het
Hnrnpf A G 6: 117,923,896 Y47C probably damaging Het
Itga6 A G 2: 71,838,690 N608S possibly damaging Het
Kdm2b T C 5: 122,880,854 probably null Het
Krit1 T A 5: 3,812,467 H207Q possibly damaging Het
Ky A G 9: 102,541,987 N398D probably benign Het
Lama1 T A 17: 67,773,859 V1294E possibly damaging Het
Lef1 C T 3: 131,111,524 T18I probably damaging Het
Lrp2 T C 2: 69,537,956 N178S probably damaging Het
Lrrc36 A G 8: 105,455,278 T525A probably benign Het
Map3k8 A T 18: 4,340,647 C222* probably null Het
Mapre2 G C 18: 23,877,959 S199T probably benign Het
Mcm3ap A G 10: 76,488,466 N911S probably benign Het
Mroh4 G T 15: 74,610,234 H722Q probably benign Het
Myo5b A C 18: 74,695,380 Y701S probably benign Het
Myt1l G T 12: 29,811,458 V80L unknown Het
Ncoa7 C A 10: 30,655,642 V24L probably benign Het
Nlrp10 A T 7: 108,925,238 V345D probably damaging Het
Nmral1 C A 16: 4,716,424 G51V probably damaging Het
Npc1 A G 18: 12,199,497 I797T probably benign Het
Olfr1269 A T 2: 90,119,007 I197N possibly damaging Het
Olfr936 T A 9: 39,047,487 R22* probably null Het
Olfr954 A T 9: 39,461,841 I134L probably benign Het
Pclo A T 5: 14,723,267 I4419F unknown Het
Phf3 C A 1: 30,816,557 E983* probably null Het
Pitpnm2 A T 5: 124,121,743 Y1149* probably null Het
Sdc3 A T 4: 130,822,768 T430S probably damaging Het
Sema3f A G 9: 107,682,682 V671A probably benign Het
Sigirr T G 7: 141,091,433 S379R probably benign Het
Slc25a23 T A 17: 57,047,326 N360I possibly damaging Het
Slco6c1 A T 1: 97,087,995 M357K probably benign Het
Sox14 C A 9: 99,874,965 M240I probably benign Het
Szt2 A T 4: 118,399,062 M200K probably benign Het
Tef T C 15: 81,815,252 S85P probably benign Het
Thada T A 17: 84,458,855 H41L possibly damaging Het
Tinagl1 A G 4: 130,173,931 F90S probably benign Het
Tnfaip1 G A 11: 78,530,219 T5I possibly damaging Het
Tnfrsf23 A T 7: 143,680,064 V59D probably damaging Het
Tnpo3 A G 6: 29,578,542 V311A probably benign Het
Trak1 T A 9: 121,472,494 M772K probably benign Het
Ubash3a A G 17: 31,217,964 D185G probably benign Het
Vmn2r120 T C 17: 57,522,048 T516A probably benign Het
Wdr4 A C 17: 31,509,811 L130R probably damaging Het
Zfp12 T C 5: 143,245,502 I528T probably damaging Het
Zfp607a T C 7: 27,879,413 L636P probably damaging Het
Other mutations in Stradb
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00784:Stradb APN 1 58988529 missense probably damaging 0.98
IGL00843:Stradb APN 1 58994409 missense probably benign
IGL01288:Stradb APN 1 58992301 missense possibly damaging 0.61
IGL02045:Stradb APN 1 58989778 missense probably damaging 1.00
IGL02818:Stradb APN 1 58979962 missense probably damaging 0.99
P0047:Stradb UTSW 1 58989798 missense probably null 0.86
R0739:Stradb UTSW 1 58977015 unclassified probably benign
R0970:Stradb UTSW 1 58977060 missense possibly damaging 0.92
R1809:Stradb UTSW 1 58994390 missense possibly damaging 0.54
R1930:Stradb UTSW 1 58991105 missense probably benign 0.07
R1931:Stradb UTSW 1 58991105 missense probably benign 0.07
R1932:Stradb UTSW 1 58991105 missense probably benign 0.07
R2570:Stradb UTSW 1 58988584 missense probably damaging 1.00
R2919:Stradb UTSW 1 58992669 missense probably benign 0.44
R3104:Stradb UTSW 1 58992291 missense possibly damaging 0.86
R3105:Stradb UTSW 1 58992291 missense possibly damaging 0.86
R3106:Stradb UTSW 1 58992291 missense possibly damaging 0.86
R3772:Stradb UTSW 1 58985385 missense probably benign 0.04
R4120:Stradb UTSW 1 58980009 missense possibly damaging 0.92
R4417:Stradb UTSW 1 58994372 missense probably benign
R4569:Stradb UTSW 1 58979958 nonsense probably null
R4601:Stradb UTSW 1 58993572 missense probably damaging 0.98
R4758:Stradb UTSW 1 58988571 missense probably benign 0.02
R4944:Stradb UTSW 1 58980440 missense probably benign 0.27
R5113:Stradb UTSW 1 58991174 intron probably benign
R5568:Stradb UTSW 1 58992742 missense possibly damaging 0.72
R5765:Stradb UTSW 1 58992744 missense probably benign 0.31
R5970:Stradb UTSW 1 58980016 critical splice donor site probably null
R6234:Stradb UTSW 1 58988548 missense probably damaging 1.00
R7411:Stradb UTSW 1 58988518 missense possibly damaging 0.95
R7511:Stradb UTSW 1 58992949 missense probably damaging 0.97
R7569:Stradb UTSW 1 58991151 missense unknown
R7575:Stradb UTSW 1 58988580 missense probably benign 0.00
R7646:Stradb UTSW 1 58994408 missense probably benign 0.14
R7658:Stradb UTSW 1 58992726 missense probably damaging 0.96
R8306:Stradb UTSW 1 58991197 missense unknown
R8812:Stradb UTSW 1 58994319 missense probably benign 0.16
Z1176:Stradb UTSW 1 58992999 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGCTCCTAAGGACCTACTTTCC -3'
(R):5'- TAATCTGGGCATGGGTTCCTC -3'

Sequencing Primer
(F):5'- CTAAGGACCTACTTTCCTGATGG -3'
(R):5'- GGTTCCTCCCTACCCCC -3'
Posted On2015-12-29