Incidental Mutation 'R4786:Szt2'
ID 367065
Institutional Source Beutler Lab
Gene Symbol Szt2
Ensembl Gene ENSMUSG00000033253
Gene Name seizure threshold 2
Synonyms
MMRRC Submission 041995-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.612) question?
Stock # R4786 (G1)
Quality Score 225
Status Not validated
Chromosome 4
Chromosomal Location 118362743-118409273 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to T at 118399062 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Methionine to Lysine at position 200 (M200K)
Ref Sequence ENSEMBL: ENSMUSP00000074862 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000075406]
AlphaFold no structure available at present
Predicted Effect probably benign
Transcript: ENSMUST00000075406
AA Change: M200K

PolyPhen 2 Score 0.204 (Sensitivity: 0.92; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000074862
Gene: ENSMUSG00000033253
AA Change: M200K

DomainStartEndE-ValueType
low complexity region 48 64 N/A INTRINSIC
Blast:VWA 93 343 1e-109 BLAST
low complexity region 704 728 N/A INTRINSIC
low complexity region 762 775 N/A INTRINSIC
low complexity region 779 793 N/A INTRINSIC
low complexity region 875 887 N/A INTRINSIC
low complexity region 994 1011 N/A INTRINSIC
low complexity region 1351 1370 N/A INTRINSIC
low complexity region 1619 1630 N/A INTRINSIC
low complexity region 1662 1678 N/A INTRINSIC
low complexity region 1832 1854 N/A INTRINSIC
low complexity region 1862 1881 N/A INTRINSIC
low complexity region 1895 1914 N/A INTRINSIC
low complexity region 2176 2184 N/A INTRINSIC
low complexity region 2284 2292 N/A INTRINSIC
low complexity region 2309 2323 N/A INTRINSIC
low complexity region 2373 2384 N/A INTRINSIC
low complexity region 2500 2508 N/A INTRINSIC
low complexity region 2669 2680 N/A INTRINSIC
low complexity region 2739 2758 N/A INTRINSIC
low complexity region 3239 3252 N/A INTRINSIC
low complexity region 3257 3268 N/A INTRINSIC
low complexity region 3283 3309 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.0%
  • 20x: 94.7%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes a protein associated with low seizure threshold in mice and may contribute to susceptibility to epilepsy. [provided by RefSeq, Aug 2011]
PHENOTYPE: Mice homozygous for mutations in this gene display increased susceptibility to induced seizures. Mice homozygous for null mutations also display partial penetrance of prenatal lethality. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 86 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2700097O09Rik A T 12: 55,059,536 I134N possibly damaging Het
Acvr1c T C 2: 58,280,354 Y414C probably damaging Het
Adam32 A C 8: 24,863,493 S693R probably damaging Het
Aldh2 A T 5: 121,572,824 F314Y probably benign Het
Anks1 A G 17: 28,052,730 D874G possibly damaging Het
Ap4b1 T A 3: 103,818,804 V372E probably benign Het
Aqp12 G A 1: 93,006,455 C18Y probably damaging Het
Arap1 T A 7: 101,385,005 I218N possibly damaging Het
Arhgap42 C A 9: 9,238,698 E28* probably null Het
Asb5 G A 8: 54,585,839 E247K probably benign Het
Atg9b T C 5: 24,386,089 D781G possibly damaging Het
Atxn10 A G 15: 85,387,143 H294R probably benign Het
Bod1l G T 5: 41,819,438 T1511K probably benign Het
Btnl2 A T 17: 34,363,348 N296I probably damaging Het
Camta1 A T 4: 151,290,039 L168H probably damaging Het
Cant1 A T 11: 118,408,839 V265E possibly damaging Het
Ccdc157 T C 11: 4,151,861 D20G probably damaging Het
Cd209c T G 8: 3,945,698 T35P possibly damaging Het
Cdc20b G A 13: 113,078,734 V279M probably damaging Het
Cdh18 T A 15: 23,410,787 W453R probably null Het
Cdh24 A G 14: 54,637,550 S333P possibly damaging Het
Ceacam11 T C 7: 17,972,314 probably null Het
Ciz1 C T 2: 32,377,527 P150L probably damaging Het
Crip3 C A 17: 46,431,042 Q152K possibly damaging Het
Dars2 G A 1: 161,060,760 R197W probably damaging Het
Dctn4 A G 18: 60,555,195 D394G probably damaging Het
Dido1 T C 2: 180,670,871 Y1077C possibly damaging Het
Dnhd1 A G 7: 105,674,444 T641A probably benign Het
Egln3 A T 12: 54,185,581 I146N probably damaging Het
Eif2ak3 C T 6: 70,892,618 T763M possibly damaging Het
Etfbkmt A T 6: 149,147,246 M1L probably benign Het
Fam171a1 A T 2: 3,225,578 I583F probably damaging Het
Fbxo38 A C 18: 62,529,674 L249W probably damaging Het
Fxyd5 T C 7: 31,041,482 probably benign Het
Gabrr3 C A 16: 59,430,100 T154K probably benign Het
Gm7233 C A 14: 43,180,890 D90E probably benign Het
Gm8186 A G 17: 26,099,040 V61A probably benign Het
Gm9573 A T 17: 35,619,329 probably benign Het
Gnao1 A G 8: 93,944,303 I137V probably benign Het
Gnptab A G 10: 88,436,182 M945V probably damaging Het
Gpsm1 G A 2: 26,322,481 A78T probably benign Het
Gtf2b T C 3: 142,781,469 L222P probably damaging Het
Hnrnpf A G 6: 117,923,896 Y47C probably damaging Het
Itga6 A G 2: 71,838,690 N608S possibly damaging Het
Kdm2b T C 5: 122,880,854 probably null Het
Krit1 T A 5: 3,812,467 H207Q possibly damaging Het
Ky A G 9: 102,541,987 N398D probably benign Het
Lama1 T A 17: 67,773,859 V1294E possibly damaging Het
Lef1 C T 3: 131,111,524 T18I probably damaging Het
Lrp2 T C 2: 69,537,956 N178S probably damaging Het
Lrrc36 A G 8: 105,455,278 T525A probably benign Het
Map3k8 A T 18: 4,340,647 C222* probably null Het
Mapre2 G C 18: 23,877,959 S199T probably benign Het
Mcm3ap A G 10: 76,488,466 N911S probably benign Het
Mroh4 G T 15: 74,610,234 H722Q probably benign Het
Myo5b A C 18: 74,695,380 Y701S probably benign Het
Myt1l G T 12: 29,811,458 V80L unknown Het
Ncoa7 C A 10: 30,655,642 V24L probably benign Het
Nlrp10 A T 7: 108,925,238 V345D probably damaging Het
Nmral1 C A 16: 4,716,424 G51V probably damaging Het
Npc1 A G 18: 12,199,497 I797T probably benign Het
Olfr1269 A T 2: 90,119,007 I197N possibly damaging Het
Olfr936 T A 9: 39,047,487 R22* probably null Het
Olfr954 A T 9: 39,461,841 I134L probably benign Het
Pclo A T 5: 14,723,267 I4419F unknown Het
Phf3 C A 1: 30,816,557 E983* probably null Het
Pitpnm2 A T 5: 124,121,743 Y1149* probably null Het
Sdc3 A T 4: 130,822,768 T430S probably damaging Het
Sema3f A G 9: 107,682,682 V671A probably benign Het
Sigirr T G 7: 141,091,433 S379R probably benign Het
Slc25a23 T A 17: 57,047,326 N360I possibly damaging Het
Slco6c1 A T 1: 97,087,995 M357K probably benign Het
Sox14 C A 9: 99,874,965 M240I probably benign Het
Stradb A T 1: 58,991,208 probably benign Het
Tef T C 15: 81,815,252 S85P probably benign Het
Thada T A 17: 84,458,855 H41L possibly damaging Het
Tinagl1 A G 4: 130,173,931 F90S probably benign Het
Tnfaip1 G A 11: 78,530,219 T5I possibly damaging Het
Tnfrsf23 A T 7: 143,680,064 V59D probably damaging Het
Tnpo3 A G 6: 29,578,542 V311A probably benign Het
Trak1 T A 9: 121,472,494 M772K probably benign Het
Ubash3a A G 17: 31,217,964 D185G probably benign Het
Vmn2r120 T C 17: 57,522,048 T516A probably benign Het
Wdr4 A C 17: 31,509,811 L130R probably damaging Het
Zfp12 T C 5: 143,245,502 I528T probably damaging Het
Zfp607a T C 7: 27,879,413 L636P probably damaging Het
Other mutations in Szt2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00092:Szt2 APN 4 118384250 splice site probably benign
IGL01082:Szt2 APN 4 118397624 missense probably damaging 1.00
IGL01348:Szt2 APN 4 118393624 splice site probably benign
IGL01869:Szt2 APN 4 118399071 missense possibly damaging 0.87
IGL01918:Szt2 APN 4 118384253 splice site probably benign
IGL01951:Szt2 APN 4 118376493 unclassified probably benign
IGL01971:Szt2 APN 4 118386955 missense probably benign 0.01
IGL02047:Szt2 APN 4 118376637 unclassified probably benign
IGL02092:Szt2 APN 4 118363332 unclassified probably benign
IGL02120:Szt2 APN 4 118388564 missense probably benign 0.01
IGL02210:Szt2 APN 4 118389823 missense possibly damaging 0.95
IGL02435:Szt2 APN 4 118390823 missense probably damaging 1.00
IGL02622:Szt2 APN 4 118392890 missense probably damaging 0.96
IGL02666:Szt2 APN 4 118374055 missense probably damaging 0.99
IGL02712:Szt2 APN 4 118384833 missense probably benign 0.19
IGL02983:Szt2 APN 4 118365779 unclassified probably benign
IGL03026:Szt2 APN 4 118391849 missense probably benign 0.40
IGL03178:Szt2 APN 4 118382689 missense unknown
IGL03233:Szt2 APN 4 118372529 missense unknown
IGL03377:Szt2 APN 4 118402397 splice site probably benign
IGL03387:Szt2 APN 4 118364725 unclassified probably benign
PIT4687001:Szt2 UTSW 4 118398201 missense possibly damaging 0.84
R0026:Szt2 UTSW 4 118384772 missense possibly damaging 0.92
R0352:Szt2 UTSW 4 118382593 missense unknown
R0396:Szt2 UTSW 4 118376347 unclassified probably benign
R0504:Szt2 UTSW 4 118372952 splice site probably null
R1033:Szt2 UTSW 4 118387106 missense probably damaging 0.98
R1222:Szt2 UTSW 4 118405459 missense possibly damaging 0.77
R1418:Szt2 UTSW 4 118387779 missense probably benign 0.03
R1462:Szt2 UTSW 4 118373967 missense unknown
R1462:Szt2 UTSW 4 118373967 missense unknown
R1763:Szt2 UTSW 4 118372368 missense unknown
R1772:Szt2 UTSW 4 118405517 missense probably damaging 1.00
R1840:Szt2 UTSW 4 118365657 unclassified probably benign
R1942:Szt2 UTSW 4 118392620 missense probably benign 0.17
R1965:Szt2 UTSW 4 118383965 missense probably benign 0.36
R1998:Szt2 UTSW 4 118375727 critical splice donor site probably null
R2009:Szt2 UTSW 4 118378064 critical splice donor site probably null
R2012:Szt2 UTSW 4 118363665 unclassified probably benign
R2044:Szt2 UTSW 4 118376448 nonsense probably null
R2066:Szt2 UTSW 4 118373980 missense unknown
R2345:Szt2 UTSW 4 118381397 missense unknown
R2857:Szt2 UTSW 4 118369402 missense probably damaging 1.00
R3156:Szt2 UTSW 4 118402819 critical splice donor site probably null
R3236:Szt2 UTSW 4 118383034 splice site probably null
R3237:Szt2 UTSW 4 118383034 splice site probably null
R3405:Szt2 UTSW 4 118394020 missense probably benign 0.02
R3795:Szt2 UTSW 4 118391730 missense probably damaging 1.00
R3878:Szt2 UTSW 4 118390585 missense probably damaging 1.00
R3906:Szt2 UTSW 4 118378269 unclassified probably benign
R4012:Szt2 UTSW 4 118383900 missense probably benign 0.02
R4039:Szt2 UTSW 4 118364952 unclassified probably benign
R4081:Szt2 UTSW 4 118373567 splice site probably benign
R4298:Szt2 UTSW 4 118365406 unclassified probably benign
R4299:Szt2 UTSW 4 118365406 unclassified probably benign
R4432:Szt2 UTSW 4 118384231 missense probably damaging 0.99
R4597:Szt2 UTSW 4 118372681 missense unknown
R4657:Szt2 UTSW 4 118397669 missense probably benign 0.06
R4663:Szt2 UTSW 4 118377684 unclassified probably benign
R4670:Szt2 UTSW 4 118375829 unclassified probably benign
R4704:Szt2 UTSW 4 118393829 missense probably damaging 0.99
R4748:Szt2 UTSW 4 118389191 nonsense probably null
R4809:Szt2 UTSW 4 118388985 missense probably damaging 1.00
R4830:Szt2 UTSW 4 118369248 missense unknown
R4944:Szt2 UTSW 4 118388669 missense probably benign 0.03
R5077:Szt2 UTSW 4 118369616 critical splice donor site probably null
R5121:Szt2 UTSW 4 118385444 missense possibly damaging 0.92
R5140:Szt2 UTSW 4 118386981 missense possibly damaging 0.46
R5169:Szt2 UTSW 4 118389830 missense probably benign 0.26
R5198:Szt2 UTSW 4 118388322 missense probably benign 0.03
R5433:Szt2 UTSW 4 118375466 unclassified probably benign
R5625:Szt2 UTSW 4 118373217 missense unknown
R5628:Szt2 UTSW 4 118373217 missense unknown
R5630:Szt2 UTSW 4 118392905 missense possibly damaging 0.83
R5808:Szt2 UTSW 4 118372613 missense unknown
R5902:Szt2 UTSW 4 118391503 missense probably benign 0.05
R6049:Szt2 UTSW 4 118402988 missense probably damaging 0.99
R6066:Szt2 UTSW 4 118371974 missense unknown
R6272:Szt2 UTSW 4 118374290 unclassified probably benign
R6456:Szt2 UTSW 4 118376697 unclassified probably benign
R6538:Szt2 UTSW 4 118390477 splice site probably null
R6604:Szt2 UTSW 4 118385474 missense probably benign 0.01
R6664:Szt2 UTSW 4 118391745 missense probably damaging 1.00
R6834:Szt2 UTSW 4 118388325 missense probably benign 0.01
R7109:Szt2 UTSW 4 118375479 missense unknown
R7163:Szt2 UTSW 4 118405530 missense possibly damaging 0.90
R7190:Szt2 UTSW 4 118389006 missense probably damaging 0.98
R7289:Szt2 UTSW 4 118375878 missense unknown
R7291:Szt2 UTSW 4 118391249 missense probably damaging 0.98
R7383:Szt2 UTSW 4 118365214 nonsense probably null
R7448:Szt2 UTSW 4 118363471 missense unknown
R7637:Szt2 UTSW 4 118393828 missense probably damaging 0.99
R7833:Szt2 UTSW 4 118366219 missense unknown
R7896:Szt2 UTSW 4 118402913 missense possibly damaging 0.62
R7923:Szt2 UTSW 4 118373840 missense unknown
R8090:Szt2 UTSW 4 118387002 splice site probably null
R8103:Szt2 UTSW 4 118387864 missense possibly damaging 0.88
R8288:Szt2 UTSW 4 118389776 missense probably damaging 0.96
R8309:Szt2 UTSW 4 118375482 frame shift probably null
R8341:Szt2 UTSW 4 118392836 missense possibly damaging 0.63
R8480:Szt2 UTSW 4 118386818 missense probably benign 0.01
R8497:Szt2 UTSW 4 118388321 missense possibly damaging 0.94
R8549:Szt2 UTSW 4 118372681 missense unknown
R8768:Szt2 UTSW 4 118369416 missense unknown
R8992:Szt2 UTSW 4 118382788 splice site probably benign
R9001:Szt2 UTSW 4 118378332 missense unknown
R9094:Szt2 UTSW 4 118385454 missense possibly damaging 0.74
R9110:Szt2 UTSW 4 118385433 missense possibly damaging 0.89
R9129:Szt2 UTSW 4 118364669 missense unknown
R9184:Szt2 UTSW 4 118384529 missense possibly damaging 0.92
R9186:Szt2 UTSW 4 118385091 missense probably damaging 1.00
R9424:Szt2 UTSW 4 118390954 missense probably damaging 1.00
R9598:Szt2 UTSW 4 118409161 critical splice donor site probably null
X0023:Szt2 UTSW 4 118372404 missense unknown
Z1176:Szt2 UTSW 4 118393976 missense probably damaging 0.99
Z1177:Szt2 UTSW 4 118391214 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TTTCTCCCAGCGTGAATCTG -3'
(R):5'- TTGGATGAGAAGTCAAGACTCG -3'

Sequencing Primer
(F):5'- CCAGCGTGAATCTGGGGTG -3'
(R):5'- TGAGAAGTCAAGACTCGCTAGCAC -3'
Posted On 2015-12-29