Incidental Mutation 'R4786:Szt2'
ID 367065
Institutional Source Beutler Lab
Gene Symbol Szt2
Ensembl Gene ENSMUSG00000033253
Gene Name SZT2 subunit of KICSTOR complex
Synonyms seaizure threshold 2
MMRRC Submission 041995-MU
Accession Numbers
Essential gene? Possibly essential (E-score: 0.610) question?
Stock # R4786 (G1)
Quality Score 225
Status Not validated
Chromosome 4
Chromosomal Location 118219940-118266470 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to T at 118256259 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Methionine to Lysine at position 200 (M200K)
Ref Sequence ENSEMBL: ENSMUSP00000074862 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000075406]
AlphaFold no structure available at present
Predicted Effect probably benign
Transcript: ENSMUST00000075406
AA Change: M200K

PolyPhen 2 Score 0.204 (Sensitivity: 0.92; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000074862
Gene: ENSMUSG00000033253
AA Change: M200K

DomainStartEndE-ValueType
low complexity region 48 64 N/A INTRINSIC
Blast:VWA 93 343 1e-109 BLAST
low complexity region 704 728 N/A INTRINSIC
low complexity region 762 775 N/A INTRINSIC
low complexity region 779 793 N/A INTRINSIC
low complexity region 875 887 N/A INTRINSIC
low complexity region 994 1011 N/A INTRINSIC
low complexity region 1351 1370 N/A INTRINSIC
low complexity region 1619 1630 N/A INTRINSIC
low complexity region 1662 1678 N/A INTRINSIC
low complexity region 1832 1854 N/A INTRINSIC
low complexity region 1862 1881 N/A INTRINSIC
low complexity region 1895 1914 N/A INTRINSIC
low complexity region 2176 2184 N/A INTRINSIC
low complexity region 2284 2292 N/A INTRINSIC
low complexity region 2309 2323 N/A INTRINSIC
low complexity region 2373 2384 N/A INTRINSIC
low complexity region 2500 2508 N/A INTRINSIC
low complexity region 2669 2680 N/A INTRINSIC
low complexity region 2739 2758 N/A INTRINSIC
low complexity region 3239 3252 N/A INTRINSIC
low complexity region 3257 3268 N/A INTRINSIC
low complexity region 3283 3309 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.0%
  • 20x: 94.7%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes a protein associated with low seizure threshold in mice and may contribute to susceptibility to epilepsy. [provided by RefSeq, Aug 2011]
PHENOTYPE: Mice homozygous for mutations in this gene display increased susceptibility to induced seizures. Mice homozygous for null mutations also display partial penetrance of prenatal lethality. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 86 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2700097O09Rik A T 12: 55,106,321 (GRCm39) I134N possibly damaging Het
Acvr1c T C 2: 58,170,366 (GRCm39) Y414C probably damaging Het
Adam32 A C 8: 25,353,509 (GRCm39) S693R probably damaging Het
Aldh2 A T 5: 121,710,887 (GRCm39) F314Y probably benign Het
Anks1 A G 17: 28,271,704 (GRCm39) D874G possibly damaging Het
Ap4b1 T A 3: 103,726,120 (GRCm39) V372E probably benign Het
Aqp12 G A 1: 92,934,177 (GRCm39) C18Y probably damaging Het
Arap1 T A 7: 101,034,212 (GRCm39) I218N possibly damaging Het
Arhgap42 C A 9: 9,238,703 (GRCm39) E28* probably null Het
Asb5 G A 8: 55,038,874 (GRCm39) E247K probably benign Het
Atg9b T C 5: 24,591,087 (GRCm39) D781G possibly damaging Het
Atxn10 A G 15: 85,271,344 (GRCm39) H294R probably benign Het
Bod1l G T 5: 41,976,781 (GRCm39) T1511K probably benign Het
Btnl2 A T 17: 34,582,322 (GRCm39) N296I probably damaging Het
Camta1 A T 4: 151,374,496 (GRCm39) L168H probably damaging Het
Cant1 A T 11: 118,299,665 (GRCm39) V265E possibly damaging Het
Ccdc157 T C 11: 4,101,861 (GRCm39) D20G probably damaging Het
Cd209c T G 8: 3,995,698 (GRCm39) T35P possibly damaging Het
Cdc20b G A 13: 113,215,268 (GRCm39) V279M probably damaging Het
Cdh18 T A 15: 23,410,873 (GRCm39) W453R probably null Het
Cdh24 A G 14: 54,875,007 (GRCm39) S333P possibly damaging Het
Ceacam11 T C 7: 17,706,239 (GRCm39) probably null Het
Ciz1 C T 2: 32,267,539 (GRCm39) P150L probably damaging Het
Crip3 C A 17: 46,741,968 (GRCm39) Q152K possibly damaging Het
Dars2 G A 1: 160,888,330 (GRCm39) R197W probably damaging Het
Dctn4 A G 18: 60,688,267 (GRCm39) D394G probably damaging Het
Dido1 T C 2: 180,312,664 (GRCm39) Y1077C possibly damaging Het
Dnhd1 A G 7: 105,323,651 (GRCm39) T641A probably benign Het
Egln3 A T 12: 54,232,367 (GRCm39) I146N probably damaging Het
Eif2ak3 C T 6: 70,869,602 (GRCm39) T763M possibly damaging Het
Etfbkmt A T 6: 149,048,744 (GRCm39) M1L probably benign Het
Fam171a1 A T 2: 3,226,615 (GRCm39) I583F probably damaging Het
Fbxo38 A C 18: 62,662,745 (GRCm39) L249W probably damaging Het
Fxyd5 T C 7: 30,740,907 (GRCm39) probably benign Het
Gabrr3 C A 16: 59,250,463 (GRCm39) T154K probably benign Het
Gm7233 C A 14: 43,038,347 (GRCm39) D90E probably benign Het
Gm8186 A G 17: 26,318,014 (GRCm39) V61A probably benign Het
Gnao1 A G 8: 94,670,931 (GRCm39) I137V probably benign Het
Gnptab A G 10: 88,272,044 (GRCm39) M945V probably damaging Het
Gpsm1 G A 2: 26,212,493 (GRCm39) A78T probably benign Het
Gtf2b T C 3: 142,487,230 (GRCm39) L222P probably damaging Het
Hnrnpf A G 6: 117,900,857 (GRCm39) Y47C probably damaging Het
Itga6 A G 2: 71,669,034 (GRCm39) N608S possibly damaging Het
Kdm2b T C 5: 123,018,917 (GRCm39) probably null Het
Krit1 T A 5: 3,862,467 (GRCm39) H207Q possibly damaging Het
Ky A G 9: 102,419,186 (GRCm39) N398D probably benign Het
Lama1 T A 17: 68,080,854 (GRCm39) V1294E possibly damaging Het
Lef1 C T 3: 130,905,173 (GRCm39) T18I probably damaging Het
Lrp2 T C 2: 69,368,300 (GRCm39) N178S probably damaging Het
Lrrc36 A G 8: 106,181,910 (GRCm39) T525A probably benign Het
Map3k8 A T 18: 4,340,647 (GRCm39) C222* probably null Het
Mapre2 G C 18: 24,011,016 (GRCm39) S199T probably benign Het
Mcm3ap A G 10: 76,324,300 (GRCm39) N911S probably benign Het
Mroh4 G T 15: 74,482,083 (GRCm39) H722Q probably benign Het
Muc21 A T 17: 35,930,221 (GRCm39) probably benign Het
Myo5b A C 18: 74,828,451 (GRCm39) Y701S probably benign Het
Myt1l G T 12: 29,861,457 (GRCm39) V80L unknown Het
Ncoa7 C A 10: 30,531,638 (GRCm39) V24L probably benign Het
Nlrp10 A T 7: 108,524,445 (GRCm39) V345D probably damaging Het
Nmral1 C A 16: 4,534,288 (GRCm39) G51V probably damaging Het
Npc1 A G 18: 12,332,554 (GRCm39) I797T probably benign Het
Or4x6 A T 2: 89,949,351 (GRCm39) I197N possibly damaging Het
Or8g22 T A 9: 38,958,783 (GRCm39) R22* probably null Het
Or8g34 A T 9: 39,373,137 (GRCm39) I134L probably benign Het
Pclo A T 5: 14,773,281 (GRCm39) I4419F unknown Het
Phf3 C A 1: 30,855,638 (GRCm39) E983* probably null Het
Pitpnm2 A T 5: 124,259,806 (GRCm39) Y1149* probably null Het
Sdc3 A T 4: 130,550,079 (GRCm39) T430S probably damaging Het
Sema3f A G 9: 107,559,881 (GRCm39) V671A probably benign Het
Sigirr T G 7: 140,671,346 (GRCm39) S379R probably benign Het
Slc25a23 T A 17: 57,354,326 (GRCm39) N360I possibly damaging Het
Slco6c1 A T 1: 97,015,720 (GRCm39) M357K probably benign Het
Sox14 C A 9: 99,757,018 (GRCm39) M240I probably benign Het
Stradb A T 1: 59,030,367 (GRCm39) probably benign Het
Tef T C 15: 81,699,453 (GRCm39) S85P probably benign Het
Thada T A 17: 84,766,283 (GRCm39) H41L possibly damaging Het
Tinagl1 A G 4: 130,067,724 (GRCm39) F90S probably benign Het
Tnfaip1 G A 11: 78,421,045 (GRCm39) T5I possibly damaging Het
Tnfrsf23 A T 7: 143,233,801 (GRCm39) V59D probably damaging Het
Tnpo3 A G 6: 29,578,541 (GRCm39) V311A probably benign Het
Trak1 T A 9: 121,301,560 (GRCm39) M772K probably benign Het
Ubash3a A G 17: 31,436,938 (GRCm39) D185G probably benign Het
Vmn2r120 T C 17: 57,829,048 (GRCm39) T516A probably benign Het
Wdr4 A C 17: 31,728,785 (GRCm39) L130R probably damaging Het
Zfp12 T C 5: 143,231,257 (GRCm39) I528T probably damaging Het
Zfp607a T C 7: 27,578,838 (GRCm39) L636P probably damaging Het
Other mutations in Szt2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00092:Szt2 APN 4 118,241,447 (GRCm39) splice site probably benign
IGL01082:Szt2 APN 4 118,254,821 (GRCm39) missense probably damaging 1.00
IGL01348:Szt2 APN 4 118,250,821 (GRCm39) splice site probably benign
IGL01869:Szt2 APN 4 118,256,268 (GRCm39) missense possibly damaging 0.87
IGL01918:Szt2 APN 4 118,241,450 (GRCm39) splice site probably benign
IGL01951:Szt2 APN 4 118,233,690 (GRCm39) unclassified probably benign
IGL01971:Szt2 APN 4 118,244,152 (GRCm39) missense probably benign 0.01
IGL02047:Szt2 APN 4 118,233,834 (GRCm39) unclassified probably benign
IGL02092:Szt2 APN 4 118,220,529 (GRCm39) unclassified probably benign
IGL02120:Szt2 APN 4 118,245,761 (GRCm39) missense probably benign 0.01
IGL02210:Szt2 APN 4 118,247,020 (GRCm39) missense possibly damaging 0.95
IGL02435:Szt2 APN 4 118,248,020 (GRCm39) missense probably damaging 1.00
IGL02622:Szt2 APN 4 118,250,087 (GRCm39) missense probably damaging 0.96
IGL02666:Szt2 APN 4 118,231,252 (GRCm39) missense probably damaging 0.99
IGL02712:Szt2 APN 4 118,242,030 (GRCm39) missense probably benign 0.19
IGL02983:Szt2 APN 4 118,222,976 (GRCm39) unclassified probably benign
IGL03026:Szt2 APN 4 118,249,046 (GRCm39) missense probably benign 0.40
IGL03178:Szt2 APN 4 118,239,886 (GRCm39) missense unknown
IGL03233:Szt2 APN 4 118,229,726 (GRCm39) missense unknown
IGL03377:Szt2 APN 4 118,259,594 (GRCm39) splice site probably benign
IGL03387:Szt2 APN 4 118,221,922 (GRCm39) unclassified probably benign
PIT4687001:Szt2 UTSW 4 118,255,398 (GRCm39) missense possibly damaging 0.84
R0026:Szt2 UTSW 4 118,241,969 (GRCm39) missense possibly damaging 0.92
R0352:Szt2 UTSW 4 118,239,790 (GRCm39) missense unknown
R0396:Szt2 UTSW 4 118,233,544 (GRCm39) unclassified probably benign
R0504:Szt2 UTSW 4 118,230,149 (GRCm39) splice site probably null
R1033:Szt2 UTSW 4 118,244,303 (GRCm39) missense probably damaging 0.98
R1222:Szt2 UTSW 4 118,262,656 (GRCm39) missense possibly damaging 0.77
R1418:Szt2 UTSW 4 118,244,976 (GRCm39) missense probably benign 0.03
R1462:Szt2 UTSW 4 118,231,164 (GRCm39) missense unknown
R1462:Szt2 UTSW 4 118,231,164 (GRCm39) missense unknown
R1763:Szt2 UTSW 4 118,229,565 (GRCm39) missense unknown
R1772:Szt2 UTSW 4 118,262,714 (GRCm39) missense probably damaging 1.00
R1840:Szt2 UTSW 4 118,222,854 (GRCm39) unclassified probably benign
R1942:Szt2 UTSW 4 118,249,817 (GRCm39) missense probably benign 0.17
R1965:Szt2 UTSW 4 118,241,162 (GRCm39) missense probably benign 0.36
R1998:Szt2 UTSW 4 118,232,924 (GRCm39) critical splice donor site probably null
R2009:Szt2 UTSW 4 118,235,261 (GRCm39) critical splice donor site probably null
R2012:Szt2 UTSW 4 118,220,862 (GRCm39) unclassified probably benign
R2044:Szt2 UTSW 4 118,233,645 (GRCm39) nonsense probably null
R2066:Szt2 UTSW 4 118,231,177 (GRCm39) missense unknown
R2345:Szt2 UTSW 4 118,238,594 (GRCm39) missense unknown
R2857:Szt2 UTSW 4 118,226,599 (GRCm39) missense probably damaging 1.00
R3156:Szt2 UTSW 4 118,260,016 (GRCm39) critical splice donor site probably null
R3236:Szt2 UTSW 4 118,240,231 (GRCm39) splice site probably null
R3237:Szt2 UTSW 4 118,240,231 (GRCm39) splice site probably null
R3405:Szt2 UTSW 4 118,251,217 (GRCm39) missense probably benign 0.02
R3795:Szt2 UTSW 4 118,248,927 (GRCm39) missense probably damaging 1.00
R3878:Szt2 UTSW 4 118,247,782 (GRCm39) missense probably damaging 1.00
R3906:Szt2 UTSW 4 118,235,466 (GRCm39) unclassified probably benign
R4012:Szt2 UTSW 4 118,241,097 (GRCm39) missense probably benign 0.02
R4039:Szt2 UTSW 4 118,222,149 (GRCm39) unclassified probably benign
R4081:Szt2 UTSW 4 118,230,764 (GRCm39) splice site probably benign
R4298:Szt2 UTSW 4 118,222,603 (GRCm39) unclassified probably benign
R4299:Szt2 UTSW 4 118,222,603 (GRCm39) unclassified probably benign
R4432:Szt2 UTSW 4 118,241,428 (GRCm39) missense probably damaging 0.99
R4597:Szt2 UTSW 4 118,229,878 (GRCm39) missense unknown
R4657:Szt2 UTSW 4 118,254,866 (GRCm39) missense probably benign 0.06
R4663:Szt2 UTSW 4 118,234,881 (GRCm39) unclassified probably benign
R4670:Szt2 UTSW 4 118,233,026 (GRCm39) unclassified probably benign
R4704:Szt2 UTSW 4 118,251,026 (GRCm39) missense probably damaging 0.99
R4748:Szt2 UTSW 4 118,246,388 (GRCm39) nonsense probably null
R4809:Szt2 UTSW 4 118,246,182 (GRCm39) missense probably damaging 1.00
R4830:Szt2 UTSW 4 118,226,445 (GRCm39) missense unknown
R4944:Szt2 UTSW 4 118,245,866 (GRCm39) missense probably benign 0.03
R5077:Szt2 UTSW 4 118,226,813 (GRCm39) critical splice donor site probably null
R5121:Szt2 UTSW 4 118,242,641 (GRCm39) missense possibly damaging 0.92
R5140:Szt2 UTSW 4 118,244,178 (GRCm39) missense possibly damaging 0.46
R5169:Szt2 UTSW 4 118,247,027 (GRCm39) missense probably benign 0.26
R5198:Szt2 UTSW 4 118,245,519 (GRCm39) missense probably benign 0.03
R5433:Szt2 UTSW 4 118,232,663 (GRCm39) unclassified probably benign
R5625:Szt2 UTSW 4 118,230,414 (GRCm39) missense unknown
R5628:Szt2 UTSW 4 118,230,414 (GRCm39) missense unknown
R5630:Szt2 UTSW 4 118,250,102 (GRCm39) missense possibly damaging 0.83
R5808:Szt2 UTSW 4 118,229,810 (GRCm39) missense unknown
R5902:Szt2 UTSW 4 118,248,700 (GRCm39) missense probably benign 0.05
R6049:Szt2 UTSW 4 118,260,185 (GRCm39) missense probably damaging 0.99
R6066:Szt2 UTSW 4 118,229,171 (GRCm39) missense unknown
R6272:Szt2 UTSW 4 118,231,487 (GRCm39) unclassified probably benign
R6456:Szt2 UTSW 4 118,233,894 (GRCm39) unclassified probably benign
R6538:Szt2 UTSW 4 118,247,674 (GRCm39) splice site probably null
R6604:Szt2 UTSW 4 118,242,671 (GRCm39) missense probably benign 0.01
R6664:Szt2 UTSW 4 118,248,942 (GRCm39) missense probably damaging 1.00
R6834:Szt2 UTSW 4 118,245,522 (GRCm39) missense probably benign 0.01
R7109:Szt2 UTSW 4 118,232,676 (GRCm39) missense unknown
R7163:Szt2 UTSW 4 118,262,727 (GRCm39) missense possibly damaging 0.90
R7190:Szt2 UTSW 4 118,246,203 (GRCm39) missense probably damaging 0.98
R7289:Szt2 UTSW 4 118,233,075 (GRCm39) missense unknown
R7291:Szt2 UTSW 4 118,248,446 (GRCm39) missense probably damaging 0.98
R7383:Szt2 UTSW 4 118,222,411 (GRCm39) nonsense probably null
R7448:Szt2 UTSW 4 118,220,668 (GRCm39) missense unknown
R7637:Szt2 UTSW 4 118,251,025 (GRCm39) missense probably damaging 0.99
R7833:Szt2 UTSW 4 118,223,416 (GRCm39) missense unknown
R7896:Szt2 UTSW 4 118,260,110 (GRCm39) missense possibly damaging 0.62
R7923:Szt2 UTSW 4 118,231,037 (GRCm39) missense unknown
R8090:Szt2 UTSW 4 118,244,199 (GRCm39) splice site probably null
R8103:Szt2 UTSW 4 118,245,061 (GRCm39) missense possibly damaging 0.88
R8288:Szt2 UTSW 4 118,246,973 (GRCm39) missense probably damaging 0.96
R8309:Szt2 UTSW 4 118,232,679 (GRCm39) frame shift probably null
R8341:Szt2 UTSW 4 118,250,033 (GRCm39) missense possibly damaging 0.63
R8480:Szt2 UTSW 4 118,244,015 (GRCm39) missense probably benign 0.01
R8497:Szt2 UTSW 4 118,245,518 (GRCm39) missense possibly damaging 0.94
R8549:Szt2 UTSW 4 118,229,878 (GRCm39) missense unknown
R8768:Szt2 UTSW 4 118,226,613 (GRCm39) missense unknown
R8992:Szt2 UTSW 4 118,239,985 (GRCm39) splice site probably benign
R9001:Szt2 UTSW 4 118,235,529 (GRCm39) missense unknown
R9094:Szt2 UTSW 4 118,242,651 (GRCm39) missense possibly damaging 0.74
R9110:Szt2 UTSW 4 118,242,630 (GRCm39) missense possibly damaging 0.89
R9129:Szt2 UTSW 4 118,221,866 (GRCm39) missense unknown
R9184:Szt2 UTSW 4 118,241,726 (GRCm39) missense possibly damaging 0.92
R9186:Szt2 UTSW 4 118,242,288 (GRCm39) missense probably damaging 1.00
R9424:Szt2 UTSW 4 118,248,151 (GRCm39) missense probably damaging 1.00
R9598:Szt2 UTSW 4 118,266,358 (GRCm39) critical splice donor site probably null
X0023:Szt2 UTSW 4 118,229,601 (GRCm39) missense unknown
Z1176:Szt2 UTSW 4 118,251,173 (GRCm39) missense probably damaging 0.99
Z1177:Szt2 UTSW 4 118,248,411 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TTTCTCCCAGCGTGAATCTG -3'
(R):5'- TTGGATGAGAAGTCAAGACTCG -3'

Sequencing Primer
(F):5'- CCAGCGTGAATCTGGGGTG -3'
(R):5'- TGAGAAGTCAAGACTCGCTAGCAC -3'
Posted On 2015-12-29